Workshop on Methods for Isolation and Identification of Campylobacter spp. June 13-17, 2005 Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species and detect outbreaks by: Providing hands-on experience with laboratory procedures for the isolation and characterization of the Campylobacter species commonly isolated from clinical specimens
33
Embed
Workshop on Methods for Isolation and Identification of ... · VNTR-37 6 3 19 14 Yes VNTR-36 7 3 15 14 No VNTR-34 18 5 10 6 Yes VNTR-25 6 1 20 8 No VNTR-19 6 4 10 7 Yes VNTR-17 6
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Workshop on Methods for Isolation and Identification of Campylobacter spp.
June 13-17, 2005
Goal: build capacity within the state public health laboratories to effectively identify Campylobacter species and detect outbreaks by:Providing hands-on experience with laboratory procedures for the isolation and characterization of the Campylobacter species commonly isolated from clinical specimens
PFGE and Beyond: PulseNet in PFGE and Beyond: PulseNet in the Next Decadethe Next Decade
Bala Swaminathan, Ph.D.Bala Swaminathan, Ph.D.Centers for Disease Control and Centers for Disease Control and
PreventionPrevention
Why Next Generation Subtyping Why Next Generation Subtyping Methods?Methods?
PFGE (and other RFLPPFGE (and other RFLP--based methods) are difficult to based methods) are difficult to standardizestandardizeComparability of patterns within and between laboratories Comparability of patterns within and between laboratories requires strict adherence to a standard protocolrequires strict adherence to a standard protocolNormalization of patterns is complexNormalization of patterns is complexPFGE is laborPFGE is labor--intensive and requires high concentrations of a intensive and requires high concentrations of a pure culturepure cultureIn some instances or for some pathogen groups, discrimination In some instances or for some pathogen groups, discrimination may not be adequatemay not be adequate
Requirements for the next generation Requirements for the next generation subtyping method for PulseNetsubtyping method for PulseNet
Broad applicabilityBroad applicabilityRapid results (Rapid results (<< 24 h)24 h)InexpensiveInexpensiveBetter discrimination than PFGEBetter discrimination than PFGEQuantitative relatedness between strainsQuantitative relatedness between strainsAccurate snapshot of the genome diversityAccurate snapshot of the genome diversityBackward compatibility with PFGE dataBackward compatibility with PFGE dataEasy to perform on a routine basis Easy to perform on a routine basis Amenable to automationAmenable to automationResults should be readily comparable within Results should be readily comparable within and between laboratoriesand between laboratories
..............
Perna et al., Nature 409:529-533, 2001
Methodologic ApproachesMethodologic Approaches
MultiMulti--locus sequence typing (MLST)locus sequence typing (MLST)Inadequate discrimination for most enteric Inadequate discrimination for most enteric pathogens for outbreak investigationspathogens for outbreak investigationsUseful for Useful for Campylobacter jejuniCampylobacter jejuni
MultiMulti--locus Variablelocus Variable--Number Tandem Repeat Number Tandem Repeat Analysis (MLVA)Analysis (MLVA)
Most promising for nearMost promising for near--term subtypingterm subtypingHigh throughput SNP analysisHigh throughput SNP analysis
Method of choice for the long termMethod of choice for the long term
Conserved repeat motif found in the genomeConserved repeat motif found in the genomeExample: TAACCGExample: TAACCG
Variable numbers of repeat units among isolates of the same Variable numbers of repeat units among isolates of the same speciesspecies
MLVA examines the number of repeats at multiple loci MLVA examines the number of repeats at multiple loci to determine genetic relationships to determine genetic relationships
TAACCG
TAACCGTAACCG
TAACCGTAACCGTAACCGTAACCGTAACCG
TAACCGTAACCGTAACCGTAACCG
Isolate AIsolate BIsolate CIsolate D
Variable Number Tandem RepeatsVNTRs
Variable Number Tandem RepeatsVariable Number Tandem RepeatsVNTRsVNTRs
InsertionInsertion
DeletionDeletion
Multiple Locus VNTR Analysis can beMultiple Locus VNTR Analysis can bedeveloped from lowdeveloped from low--pass sequence datapass sequence data
Development of Development of E. coliE. coli O157 MLVA O157 MLVA protocolprotocol
Contract awarded to the Massachusetts Contract awarded to the Massachusetts Department of Public Health / State Laboratory Department of Public Health / State Laboratory Institute in fall 2001Institute in fall 2001Collaboration with Dr. Paul Keim (The Collaboration with Dr. Paul Keim (The Northern Arizona University)Northern Arizona University)
E.E. colicoli O157 strains used in the initial O157 strains used in the initial validation at CDCvalidation at CDC
152 isolates analyzed by both MLVA and PFGE 152 isolates analyzed by both MLVA and PFGE using using XbaXbaII
Geographically diverse sporadic isolates with unique Geographically diverse sporadic isolates with unique XbaXbaI I PFGEPFGE patterns (UPP collection) patterns (UPP collection) Outbreak isolates from eight well characterized outbreaksOutbreak isolates from eight well characterized outbreaksEpidemiologically unrelated isolates clustered by PFGEEpidemiologically unrelated isolates clustered by PFGEA subset of 54 isolates were further characterized with A subset of 54 isolates were further characterized with BlnBlnII
Nine VNTR loci included in the optimized Nine VNTR loci included in the optimized
MLVA protocol for MLVA protocol for E. coliE. coli O157O157
Vhec7Vhec7
Vhec2, TR6Vhec2, TR6
TR4TR4
TR7TR7
TR3TR3
Vhec1, TR2Vhec1, TR2
Vhec4, TR1Vhec4, TR1
Vhec3, TR5Vhec3, TR5
Alternative Alternative namename11
YesYes141419193366VNTRVNTR--3737
NoNo141415153377VNTRVNTR--3636
YesYes661010551818VNTRVNTR--3434
NoNo8820201166VNTRVNTR--2525
YesYes7710104466VNTRVNTR--1919
YesYes111118182266VNTRVNTR--1717
YesYes39396868101066VNTRVNTR--1010
NoNo171720205566VNTRVNTR--99
YesYes202023234466VNTRVNTR--33
MaximumMaximumMinimumMinimum
InsideInsideORFORF
No. ofNo. ofallelesalleles
No. of repeatsNo. of repeatsRepeat size Repeat size (bp)(bp)VNTRVNTR
1 Vhec loci are form Lindstedt et al. (2003); TR loci are from Noller et al. (2003)
Discriminatory power of MLVA Discriminatory power of MLVA compared to PFGEcompared to PFGE
Clustering of outbreak isolates and some selected sporadic isolates by MLVA
Conclusions from the onConclusions from the on--going going validation of the validation of the E. coliE. coli O157 MLVA O157 MLVA
protocolprotocol
Overall, MLVA slightly less discriminating than Overall, MLVA slightly less discriminating than PFGE with two enzymesPFGE with two enzymesMLVA can further discriminate some of the MLVA can further discriminate some of the most common PFGE patternsmost common PFGE patternsEpidemiological congruence of the MLVA data Epidemiological congruence of the MLVA data appears to be equal to or better than PFGEappears to be equal to or better than PFGEDevelopment of interpretation guidelines may Development of interpretation guidelines may pose a challengepose a challenge
Future plansFuture plans2005: 2005:
JulyJuly: Complete the CDC internal validation of the : Complete the CDC internal validation of the E. E. colicoli O157 MLVA protocolO157 MLVA protocolAugustAugust--SeptemberSeptember: Begin collaborative validation of : Begin collaborative validation of the the E. coliE. coli O157 MLVA protocol by transferring the O157 MLVA protocol by transferring the protocol to PulseNet participating laboratoriesprotocol to PulseNet participating laboratories
PFGE vs MLVA in Outbreak IsolatesPFGE vs MLVA in Outbreak Isolates(Data from Minnesota Dept. of Health)(Data from Minnesota Dept. of Health)
823 backbone genes (22% of 3,729)376 S-loop genes (23% of 1,632)
836 SNPs in 511 genes (42% of 1,199)309 in 9 typical O157:H7 isolatesOn average, 34 SNPs/1,199 genes between two isolatesEstimated ~152 SNPs/5,361 genes between two isolates
PFGE will continue to be an essential subtyping PFGE will continue to be an essential subtyping method for PulseNet in the near futuremethod for PulseNet in the near futureMLVA may provide additional discrimination for MLVA may provide additional discrimination for E. coliE. coliO157:[H7] and some O157:[H7] and some SalmonellaSalmonella serotypesserotypesWill start transferring MLVA protocol for Will start transferring MLVA protocol for E. coliE. coli O157 O157 :[H7]to state and local public health laboratories in 2005:[H7]to state and local public health laboratories in 2005SNP is the subtyping method of the future; SNP may SNP is the subtyping method of the future; SNP may be used in combination with MLVAbe used in combination with MLVAMuch work remains to be done on new subtyping Much work remains to be done on new subtyping methods for PulseNet; we hope to continue active methods for PulseNet; we hope to continue active participation with public health laboratoriesparticipation with public health laboratories
Bioterrorism Preparedness and Bioterrorism Preparedness and Response Funds for PulseNet ActivitiesResponse Funds for PulseNet Activities
ELC and BT are separate funding streams with ELC and BT are separate funding streams with different (some overlap) goals and objectivesdifferent (some overlap) goals and objectivesELC funds have not increased ELC funds have not increased –– maintenance of maintenance of successful projects; some new projectssuccessful projects; some new projectsBT funds for PulseNetBT funds for PulseNet
Enhance preparedness Enhance preparedness –– accelerated or more informative accelerated or more informative subtypingsubtypingIncrease surge capacityIncrease surge capacityFoodborne pathogen priorities: Foodborne pathogen priorities: E. coliE. coli O157:[H7], O157:[H7], ListeriaListeria