Top Banner
ILLAWARRA Thursday 10 May 2012 Cover Details Page 3 OPEN HOUSE LIFTOUT PAGES 45- 47 92 Pages of Property
92

Wol 10th May 2012

Mar 15, 2016

Download

Documents

realestateworld.com.au
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
  • ILLAWARRA Thursday 10 May 2012

    Cover Details Page 3 OPEN HOUSE LIFTOUT PAGES 45- 4792 Pages of Property

  • experience the possibilities

    IRT Links Seaside1 Ross Street WollongongT 1800 132 202 (Freecall) E [email protected] W www.irt.org.au facebook.com/IRTGroup twitter.com/IRTGroup

    More than jujujujuj ststststst aaaa a cccc cooononontttetempmmppppppporororary y apartment compmplex,x, IRIRIRIRIRTTTTT LiLiLiLinks Seaside e ofoffefefersrsrs s ssene iors lifestyle livvining thhatat iiss sesecocondndd t to o nononene aandnd b besest of all y youo ddonontt n neee d toto b be e reer titireed d toto enjjoyoy t thihis lifesttylyle,e, j jusust t 55 ooor overe .

    1. Charactterer: Thherereess s sososo mm muucuchh h toto d do o atat I IRTRT LLinnksk Seaside, noo one dddayyyy will bebe t thehe s samame.e. Y YYououuuuuuuu ccccccananananananan cccchohohhoohooose to take part in ththe e enennnnenendless actitivvivv ties ooorr rereeerelax inn yoyourur ownwn hhomommmeeeeee e eee anannnnnnd d dddd enennene jojojojoyyy ththt e comforts of f low w mamamm inintenanncee eee livingggg

    2. Lifestyle: WhWhWhWWhWWWhhWWhWWW atatt m m mmororee ccoulu d you ask for innn thehheh oone locccaattttioion. WWWitith hhh hhh aanan a la carte restauuruu ananaaaaaaaanantttt,ttt,tt p priirivavatete cc cinema,, b beaeauty salooooon anaaaaaa dd d daday y sspsppppppaaaa,,,a, tt tennnnis s cccocouuru t,tttttt,ttttt,ttt gym, swimmiinnngggggg g gg ppppopp ol and saunaa, zen gagagarden, cccococcc mmmmmmmmmmm ununaal llououooouoooo nnnge aareaeeeaaaeea with replaceeeeeeeee, llliiilibbbbrrrrbb arary y anand d ininteternr et kioskkk, commmmmmunuuuuu aall v vegegegeetetabaabbbaaaableee gaarararaa deddeeeeeeeed n n aannnnndddddddddddddddddd outdoor BBQQQ QQ QQQ fafafafafaaaaaaaaciiiiiiiiic lilitititiiesesee yyouullll neneveveerr r bebebe ll looooooooooooooo kkkingngg fff orrrrrrrrr soomomettthhiihiingnggggggggggggggg ttto ddooooo

    3.3 Activitieeeeees:sss::ss TTTTThTTTTTTTTThere eeees ssss a aaaa widededededde rangee o oooffff ff plppppp annnnnnnen d ddddddddd acccttivititit eeseessee y yyyyyyyyyyyyyyyoouuo caananaaanan ttttttttttaakakkaaaakaaa ee part in, includdddddiididiiiiingngnngnnngggngngngggnngggngggng wwwwwweeklkly y mommmmmm viv e niin ghghghtststststttsts,, , mmem nnnnnss ss ss clllluubb, , ththememmmmedeededdddddedede d ddinnnnnnenenenenn rrrrrr rrrr nninin gghgg ts,,, fantastic dinniiin ngngnggnngnngnnn eeeeeexpxpperere ieiencncn esess, , bubuus trips,s,s,ss,s,,,, w ww w alkikkiikk ngnnnn g roooupupss aanannnndddddd dddddd mmmucchccchchcccc mmmmmmmmmorre

    4.4 Safe and ddddddd SSSeSSS cure: Safety and securitttty y yy yy is ppaarramamouuo ntnnnttntnntttn innn thhhhhhhhiisi gggggggggggggggggatateed communityy.y.y FFFFFFFFFFFuululullllyly ffenceced with electronic acccccceccceccc ssssssss , , sseecucuriittyyy a aaaaccccesssssssss totooooooooooooo apartment bubuuuuuuuuuuuuililiiilililildidddididddddid ngnnnnnn s, intterercoc ms available inn nn allll l lllll aappaa arartmmmt enennnnnnnttt ttt bbbuillddddidd ngnnnngggngnnggngs,s, a andddddddddd nightly patrroloollllls.s. You can ppack up aaandnnn head oooooooo onnn yourr r trtrraaavaaaaaveeels kkkknkknkk owooooowowoowoooooo iinng ggg ttthhhhhthhhhhhhhataata your homeee e isssssssssss ssaaafaaa e and seeeecure

    5. Stunninnnngg Apartmmmmenenenentststs::: E E EE ortless sttttttttylylee eeeee aanand deeeesisignggggngggng meeeeeeee ttt tt t t t iiiniii tthheseeeeeeeeee stunninglylyy aaaaaaaaaappppppppppppppppppppppppppoioiooioiointntntntnntedeeee apartments,sss neutrallllllyly d ddddddddeececoratedededddedd reeae dyyyyy forooooorrorror yooou tooooooo ooooomom ve in aannd ddddddddd mmmmamamamamammamam kekekekekekekekeke y y yyyyyyouuuuouuououuuuouououuououourrrr rrrrr rrr owowowowowwowownnnnnn nnnnnn markrrr

    6. Coast: BeBBBeeeeeachsh iddiddidididdeeee eee lililililililliiliiivivivivivivivvvivivingngngnngngngngnggg hhhhhhhhhas never beeeee n nn n nnn mmmore ppppererrrrrrffefefef ccct. WWWaWWWWWW kkkekeekk uuuuupp p ppp pppp anannnnnnnnndd d d greet the moomornnrnrnining g gg susun n ovovererrr t tt thehehhe o o ooocececceeanana , , wwwatctcctctct hh h the ssuus rfrrfffrfrffereerrs hiiiiiitttinnnnnnng g ttttththtttthhe e ee wwwwawawawawwww veveveves,s,ss wawawwwwwwww veveveveveeveveeeeeeeeeeeeeeeee tt tt ttto oooooooooo migrating whales andndnd r releellaxaxaxax a aa as ss yoyyy u wawaatch h ttthheeee eeee titiddessss ss rooooooolllll i innn

    7.7.7777 G GGG GGGGGGGGoolololo f:fffffffffff:f: PaPaaaaaPaaaPaPaPPaPaPaaaPaPaaarkrkrkkk y yyyyyyyy yyyyy yyyyyyyouououuuuuuuuouuuuuuuuurr r r rr gogogogogooogoooogoggoooooooooolflflfllflff b b b bbbbbbbbugggy and recharge it in thhhhe ee dedededesis gggngnngg aaaaataaa edededed ss ssaaafa eeeee e eee anananand seesesesessesssssssss cucucuc rere a arerea a rrrreeeereereaadaadadaaaaaaaaaaaaaaaaa y y yy fofofoffof r r yyyyyyoyyyyyyyyyyyy uruuuurururruuuuruurr n nnexexeeeeexeexeeeeeexeeee t t t rrrrorrrororororororrrorrrooroooununuuu d of golf. Adjacennnt t t tototoo W WW WWoloolooloo lolololongonnnnnnnnnnnggg g GGoGoG lf ClClCCCClCClClClCCClububuubuuububububub meaeaeaannnnnnnsnssnsnsnnsnss yyyy y yyyy yoouoooooooouououoooooooo cccccccccccccaanaanaaanaaaaaa ddd dddddddddddddddddddrirririr vveeveeeeeeeeeveeeeeve yyyy ouooouoouuuuououuuuuuuuur r rr bububbubububububbubbububbbuuugggggggg y or walk straight oooontntnn oooo oooo ththhthe e couuuuururuuu sesesese andnd ststststststarararararartt t tt t tt yoyoyoyoyoyyoyyoy ururururururur rrr rr rr rrrouououououooooo ndddndndndndndnnnndndnd

    8.8.88 C C CCulululu tututurererere: :: WoWoWoWoWoWoWoWollllllllllllll onononononononono gogogoggogoggogoongngngngngngngng i i isssssss sssssssssssss reeeeeeeeeeeeenononnnnononnonnnonnn wnwnnnnnnwnnnnneedeeee for being one of Austrararaaliiliaaaaassssss s momoosts lillilivevev ababbabbabbbbbabbababbababababababaabbbblellleleleleleleleeleeleeleeeel cc cccccitititttititttieieieieieieeieieiees.s.ssss JJJJJJJJJusususususususust ttt t ttt mimimimimimimim nununununununuunuun tetetetetetees s s s ss s wwwwwawwwwwwwwwww llkkklkkllkllllkll tttttt t ttttttttttttttttto o o o thththhhhhhhhthhee eeeeeeeeeeeeeee WoWoWW llongong CBD and maiaiaiainnnn n cultltl uru ala , ennnnnnnnnnnnenntetetttttttteerttrtttaiaiaiaiaiaiaiaiaiaiiaiia nmnmnmnmnmnmnmnmnmnmnmnmnmnmmn enenenenenenennent,tt,ttttt d dddddddininnininininininininininiing,gg,g,gggg, s s sssssspopopopopopopooortrttrtrtrtttr inininnnnininnng g gggg g aananannnnnnnnanannnnnnnnnnnd d dd leeleeleeleisiisisisisisisiiiisisiisiiiii ururreeee eeeee didddddddddd tsttriririiririiiiririririiictcctcctccc sss yoyoyooyoyooouu ll never racacccacack k upuppp tthehe kmkkmkkmkmmmkmkmkmkmkmmss sssssss onononononononononn y yyy yyy y y y yyouououououououououououuo r rrrrrrrrr rr cacacacacacacacacc r r rr r rrr heheheheheheheherererererereree

    9.9.9.9.9. PPPProrororoxixixiximimimimim tytytyty: : : YoYoYoYoYoYoYoYouuuuuuuurererererererrere oo oo oooooonlnllnlnlnlnlnln y yy yy yyyy aaaaaaaa a ssststttststsstsstssssssssssstsssststtepppppppppppp aa a aawwwwwwwwwawwwwwwwwwwwwwwww y y frfrfrfrfrrrfrfrfrfrffrfrrrrroomoooooooooooo tttttttthehhhhhhhhhhhhhhhh hhhhusuuusuususususuusu tlttt e ananananaannanaand bububububuubbubuuuustststss lele o oooooooooof fff fSySySySySySySySySySySySSSySySySSySySyySySySydndndndndddddd eyeyeyeyeyyeyeyy ( (((((((((((909090909090909090909 m mmm m mm ininnininininutututututututututututttteseseseseseseseseseseseses tt t tt t tooo o CBCBCBCBCBCBCBCBCBCBCBBBBD)D)D)D)D)D)D)D)D)DDDDDD a a aa a a a aa annnndnnddddndndndndndnnndn aaaaaa s s ss hhohohohhohooohoohooooohohohooh rtt ttririiiiiiiiir pp pppppppppp ppppppppp to SSSSSSSSSSSSSSSydyyyyyyyyyyyyyyyyy neeeeyy yy y yyyyyy yyyy Airppppppooororoooooo t (6(6(6666(660 00000000 mmmmmmiiiiiiiminuunuunnnnnnnnnn teteeteteet s)s)ss)s)ss). Att thehehheheheheheeeeeee g g gg g g g gggg ggggatatatatatatatataatatata eweweweweweweweeweweweewwwwwwwwayayayayayayayayayayaaayy tto oo thththththtththththththhe e eeeeeeeee fafafafafafafafafafafabubububbubububbubulololololololololooooousususuusususususususususus SSSSSS SSSS SS SS SSSSSSSSSouuuuuuuuuuuuththhthhhhh C CCCC CCCCCCCCCCCCoastttttttttttttt,,, , , , , ,, , Souttttttthhhehhhhhhhhhhhh rn HHHHHHHHHHHHHigi hlananananananananannnnndssssss a a aaaaaaannnnnndndnn ooooouurururuu nnananannanananannaaann titititiiiittt ononnnonnonononnononononononononssssssssssssss cccccc ccccccc cc ccapapapapaapapapppapapaapapaaa itittititititiititiitititittalalalalalaalalaalala y y yyyyyyyyyouououoo ccccc c ccccccccananananananananananananannnnnnttttttttttt b b b bbeaeaeaaeat t ttt ttttttttttt ttttttthhtttttthtthtttttttttttttt is llllllloococccccococcaaaaataaaaaaaaaaaaaaa ion

    1110101 . . CoCoCoCoCoCoCCommmmmmmmmmmmmmmunununnnnnitititititiitity:y:yy:y:y:y:y WhWhWhWhWWWW atatatttttttata sssssssssssss t t tttttttttttthehehehhehehehehehhheheeeee b b bbbbb eeeeeeeseeeeeeeeeeeee t ppppapappppppapppppppppappapap rtrtrtrttr o o oooooffff fff f f liilililillil vvviviviivvivvvvv ngnnnnnngngngn aa a at IRIRIRRRRRRRIRRRRRRRRRRRT T Linkkkkkkkkkkkkkkkkkkkkkssssss s sssssssssss SSSSSeSeeeSeeSSSSSSeeSSeSeeSSSeSeeeSeSSSeasasasssaaaa ididididii e???? idde? ThThTTTT e e neneneneneeeeeneneneeeeewwww w wwwwwwwwwwwwwww frfrfrfrfrfrffrfrffrfrfff ieieiei ndndndddddddss sss yoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyoyyoyoyooouuuuuuuuuuuuuuuu llllllllllll m m mmm eeeeeeeeeeett ttttttttt anananananananananananannanannd ddddddddddddd thhhhhhhhhhhhthhhthhhhhhe fafafafafaafafafaantntasaaasasassaassaasaaaasssssssa tititit ccc CoCoCoCoCC mmmmmmmmmmmmmmmmmmmmmmmmmmmunnunununnunnuu itititti y sunnu titity y y spspsppppppiiririt, alallalalwawawawaw ysysysysysysysysysysysysysysyysys a aaaaaaaaaaaaaaaaaaaa h h hh h h h h h h h ivivivve e ee ofoffffffffffffffffofff aaaaaaaa a aaaactctctctctctctctctcctctctctcctcctttttiviviviviviviviviivivvitityyyyyy

    TaTaTaTaTaTaTaTaTaTaTaTaTaakekekekeke aaa aa v vvvvvvvvvvvvvvvviririririririririririririririirirrrtututututututtttttttt alalalalal tttoooootutuuutututualalalal t t ttououuuuuuouour rr rrrrrr tototototototototodadadadaday y y yy ononononononononon o oo o ooo ooour wwwwebebbbbbbbbbbbsisisis te oooooooorr rrrrr viv sissisiiiiiiiittttttttt ttyoyoututututututtututu ubububububububububbe.eee.e.eeee.cocococoom/m/m///m//m/IRIRIRIRIRIRIRIRRTgTgTgTgTgTgTgTgrorororoupupupup

    10 things youll love about IRT Links Seaside

  • 10 May 2012 3

    Front Cover Feature Property

    This is a home of understated elegance.Architecturally designed to maximise its stunning views it is set on a large, gracefully landscaped block. The house features open plan living on 2 levels with wrap around verandahs upstairs and down. The top level includes a large, open plan living area with sweeping views over the lake, to the ocean and the escarpment. The extra large main bedroom has a walk through robe and en-suite with spa. The added attraction of an external door leading to the upstairs balcony ensures summer breezes. The other two spacious bedrooms have built-ins and a shared bathroom. The same level ERDVWVDNLWFKHQHWWHSHUIHFWIRUSUHSDULQJDQLJKWWLPHFRIIHHRUEUHDNIDVWWRWDNHEDFNWREHG7KHJURXQGRRURSHQVLQWRDVSDFLRXVPRGHUQeat in kitchen which is the focal point of the mezzanine and the dining areas, making it easy for guests to sit around, chatting with the host while the PHDOLVEHLQJSUHSDUHGRUIRUWKHZKROHIDPLO\WRVRFLDOLVH7KHNLWFKHQRZVVPRRWKO\RXWRQWRWKHJURXQGYHUDQGDKDGGLQJDQLQVWDQWH[WHQVLRQWRthe living area through the triple sliding glass doors. The tranquillity of the native garden and lively bird life can be experienced from the large gazebo where you really get to appreciate the love and care that has gone into the thoughtful landscaping.7KLVKRPHKDVTXDOLW\WWLQJVWKURXJKRXWZKLFKLQFOXGHVWXQQLQJOLJKWLQJWKDWFUHDWHVDPELHQWQLJKWWLPHHIIHFWVVHHWKURXJKVHFXULW\VKXWWHUVDQGFDUaccess to top and bottom levels. The third bathroom downstairs and large storage area, perhaps a teenage retreat with its own external access adds an extra bonus.

    Contact Dusko to book in your private viewing before its too late, as the owners of this elegant home might accept an offer before the auction.

    WHERE: 16 Buena Vista Avenue, Lake Heights

    INSPECT: 12pm - 1pm, Saturdays prior to Auction

    AUCTION:June 16, 2012 - On site at 1pm

    AGENT: LJ Hooker Warrawong - 4274 0334

    CONTACT: Dusko Vasileski - 0411 713 523Graham Bath - 0418 291 717

    All information contained herein is gathered from sources we consider to be reliable. However we cannot guarantee or give anywarranty about the information provided and interested parties must solely rely on their own enquiries. Residential l Commercial l Rural l Finance

    ljhooker.com.au

    1

    2LJ Hooker Warrawong4274 0334Shop 3, 53-57 King Street

    For Sale $265,000View Open House Saturday 10:30am - 11:00amljhooker.com.au/7EWGMHContact Dusko Vasileski 0411 713 523

    Youll be more than impressed upon inspecting this beautifully presented three bedroom home, within a 700m radius from your door step is Berkeley West Public School, Fred Finch Park and Lake Illawarra. This stunning home features a solid timber kitchen with a separate dining area, modern newly renovated bathroom, three newly carpeted bedrooms, generous yard and spacious garage with enough room for a work space.

    1

    2LJ Hooker Warrawong4274 0334Shop 3, 53-57 King Street

    For Sale $295,000View Open House Saturday 11:00am - 11:30amljhooker.com.au/4PRGMHContact Graham Bath 0418 291 717

    Set in the hills of Lake Heights is where you will find this rare opportunity. The home is positioned on the high side of Canberra Road with stunning views over looking Lake Illawarra. This clad and tile home comprises of 3 bedrooms Aluminium windows Well established lawns and grounds Plus an extra shed at the rear of the property.

    1

    Offers 3 bedrooms, 2 with mirrored BIWs, spacious dining/kitchen area & renovated bathroom. Downstairs retreat featuring a bedroom/lounge & kitchenette.

    For Sale $250,000View By Appointment ljhooker.com.au/615GMHContact Dusko Vasileski 0411 713 523

    LJ Hooker Warrawong 4274 0334Shop 3, 53-57 King Street

    Ideally Designed With Your Family In Mind

    1

    Heres your chance to act with 6 lots of land totalling approx 1863m2 with a 42meter frontage of land which also comes with a free standing brick building previously used as a shop.

    For Sale Offers Above $300,000View By Appointment ljhooker.com.au/4GXGMHContact Dusko Vasileski 0411 713 523

    LJ Hooker Warrawong 4274 0334Shop 3, 53-57 King Street

    Build Your Own Empire

  • All information contained herein is gathered from sources we consider to be reliable. However we cannot guarantee or give any warranty about the information provided andinterested parties must solely rely on their own enquiries. Residential | Commercial | Rural | Finance

    ljhooker.com.au

    1

    2LJ Hooker Dapto4261 344464 Princes Highway

    For Sale $370,000View Saturday 11:00am-11:30amContact Patrick Ciocca 0405 373 916

    Set back from the road, in a private complex that is well looked after, is this fantastic single level villa. This property has been well fitted out, starting with the 3 generous size bedrooms all with BIWs & the main bedroom with a WIR & a well appointed en suite. This villa has an open plan lounge room, dining room & kitchen area that offers access to the private courtyard. There is also a good sized 2nd bathroom & double garage.

    1

    2LJ Hooker Dapto4261 344464 Princes Highway

    Auction Saturday 12:00pm On SiteContact Sharon Horner 0402 844 636

    If you want to live a more peaceful existence, this property is a must see. There is a huge shed with 3 phase power, stables, old cattle yards, chook & pig pens & carports. Step back in time when you view the original residence. There are 3 bedrooms, 2 bathrooms, separate formal dining room, lounge room & a separate kitchen. There is also separate brick caretakers accommodation suitable after some renovation. With dual access, town water & several tanks, the propertys potential is limited only by your imagination.

    1

    2LJ Hooker Dapto4261 344464 Princes Highway

    For Sale $318,000View Saturday 1:00pm-1:30pmContact Patrick Ciocca 0405 373 916

    This very well kept brick and tiled home offers the space for your family to grow. With a good size separate lounge room for the parents to unwind in while the kids can entertain themselves in the large rumpus room out the back. There is a combined kitchen and dining area and all three bedrooms are a fantastic size all of which have built in wardrobes. This home offers a good size back yard and a covered entertainment area. This home is set back from the road and offers plenty of off street parking.

    1

    2LJ Hooker Dapto4261 344464 Princes Highway

    Auction 2nd June 2012 10:00am On SiteView Saturday 11:00am-11:30amContact Sharon Horner 0402 844 636

    Only 10 years young, this 4 bedroom single level residence on a 639m2 block. Featuring a beautiful open plan kitchen with pantry and dishwasher. Large lounge room at the front of the house and massive sunken family room at the rear. The main bedroom which offers an ensuite and WIR is away from the other bedrooms giving parents some privacy. Also offering a large pergola at the side and double remote garage.

    1

    2LJ Hooker Dapto4261 344464 Princes Highway

    For Sale $319,000View Saturday 10:00am-10:30amContact Patrick Ciocca 0405 373 916

    Positioned on the low side of the road is this well kept brick & tiled home. Suited to all whether it be the first home buyer, investor, renovator, young family & even retiree. Offering great access, very private & set back from the road. There is plenty of off street parking & a single drive through carport to the back yard. Internally this home offers 3 bedrooms, an L shaped lounge room & dining area & a functional kitchen. Out the back there is loads of space for the kids & a garden shed.

    1

    LJ Hooker Dapto4261 344464 Princes Highway

    Auction 2nd June 2012 11:00am On SiteView Saturday 10:00am-10:30amContact Sharon Horner 0402 844 636

    First time on the market is this brick and tile residence on a 600m2 level block. Situated on a quiet street in ever popular Kanahooka. Offering three bedrooms all with built in wardrobes, lounge room and separate dining area, sun room at the front and plenty of storage under the house.The rear yard has a large in-ground pool with a pergola and garden shed. There is also a carport. This well loved family home is ready for a new family to bring it back to life. A first home buyers or investors delight.

    1

    This stylish & modern home boasts a low maintenance lifestyle. Internally this home offers 3 bedrooms, 2 with BIWs & the main bedroom with a WIR & ensuite. Offering a generous kitchen, lounge room,dining area, covered entertainment area & a private and landscaped yard.

    For Sale $379,000Contact Patrick Ciocca 0405 373 916

    LJ Hooker Dapto 4261 344464 Princes Highway

    Stylish Residence

    1

    Set back from the road in a very private location is this tidy villa. Offering a fully renovated kitchen & bathroom, open plan combined lounge & dining room. All 3 bedrooms offer BIWs. This property also offers a good size yard & carport. Just grab your furniture & move in.

    For Sale $295,000Contact Patrick Ciocca 0405 373 916

    LJ Hooker Dapto 4261 344464 Princes Highway

    Tucked Away

    1

    2LJ Hooker Dapto4261 344464 Princes Highway

    For Sale $220,000-$240,000Contact Sharon Horner 0402 844 636

    Have you decided it is time to take a step back from your busy lifestyle and really start taking some time for yourself? This immaculate 2 bedroom home has new carpet & fresh paint throughout, an air conditioner in the lounge room, BIWs, plenty of under house storage & a massive tandem carport. Some of the major benefits of living in Oaklands Village is the peace and mind of living in a secure estate, with its own pool and community centre and organised activities if you choose to take part.

  • All information contained herein is gathered from sources we consider to be reliable. However we cannot guarantee or give any warranty about the information provided andinterested parties must solely rely on their own enquiries. Residential | Commercial | Rural | Finance

    ljhooker.com.au

    LJ Hooker Albion Park Rail4256 3344195 Princes Highway

    LJ Hooker proudly has for sale a stunning Clarendon built home, only 1 year old. This beautiful home, just opposite the 13th hole at Shell Cove links golf course really has all the features people want in a property.

    Featuring 5 large bedrooms, study, 3 huge living areas, ducted air conditioning, stunning kitchen with stainless steel appliances and caesar stone bench tops, alarm, large double garage with remote access, side access and a huge rear yard.

    For Sale$729,000

    ViewSaturday 12th May 1.45pm - 2.45pm

    ContactCraig Hyde 0404 497 521

    32

    1 1

    2LJ Hooker Albion Park Rail4256 3344195 Princes Highway

    For Sale $469,000View Saturday 12th May 12.15pm - 1pmContact Craig Hyde 0404 497 521

    Properties in this area are in great demand and this is one of the best to come on the market in sometime.

    With picture perfect presentation and featuring; Over sized formal lounge & dining, Tassie Oak kitchen, Security roller shutters on front windows, Reverse cycle air conditioning unit, single garage plus double carport, a teenager retreat complete with bathroom and kitchenette and no rear neighbours.

    1

    2LJ Hooker Albion Park Rail4256 3344195 Princes Highway

    For Sale Offers above $560,000View Saturday 12th May 11am - 11.45amContact Craig Hyde 0404 497 521

    Designed for the entertainer and capturing a lasting impression is this Family built Tri level Marksman built home.

    Featuring; Fully ducted A-C, oversized kitchen with stainless steel appliances, 3 spacious living areas and side access for the boat or caravan.

    It has all you will need, its truly a wonderful property.

    1

    2LJ Hooker Albion Park Rail4256 3344195 Princes Highway

    For Sale $305,000View Saturday 12th May 11am - 11.30amContact Vito Scioscia 0402 121 870

    L J Hooker Albion Park Rail offers for sale this single level 2 Bedroom villa which you can either retire, invest or use as a stepping stone.

    A short walk directly to Shellharbour Square, just across the road to Blackbutt reserve and a long stroll will take you to Shellharbour Village.

    Featuring 2 bedrooms with walk in/ built-ins, garage with auto opener and internal access and Rear pergola plus lawn in the back yard.

    1

    2LJ Hooker Albion Park Rail4256 3344195 Princes Highway

    For Sale $455,000View Saturday 12th May 12pm - 12.45pmContact Vito Scioscia 0402 121 870

    This 4 bedroom home has something to offer everyone.

    Located in great area and consisting of 2 bathrooms, formal and informal living areas, provisions for ducted air conditioning, 2 car security garaging, garden shed, water tank and side access for the boat or caravan.

    With parklands and picnic areas at your door step makes this an ideal family home.

    1

    2LJ Hooker Albion Park Rail4256 3344195 Princes Highway

    For Sale $469,000View By Appointment OnlyContact Craig Hyde 0404 497 521

    This Masterton built home is sure to impress any buyer, featuring 3 massive living areas formal and informal, ensuite and walk in robe to main, built in wardrobes to the other 3 bedrooms, 3rd toilet, polyurethane kitchen with granite bench tops and stainless steel appliances, ducted vacuum system, floating timber floors, gas fire place in formal living, back to base alarm system and side access to the rear yard perfect for the boat or caravan.

    1

    2LJ Hooker Albion Park Rail4256 3344195 Princes Highway

    For Sale $399,000View Saturday 12th May 1.30pm - 2.15pmContact Vito Scioscia 0402 121 870

    You will be amazed by the presentation of this stunning home located in a quiet cul de sac.

    Featuring; Study, 2 living areas, re - modelled kitchen, split system reverse cycle a-c, b.i.ws in all bedrooms, sunny rear north facing pergola, single garage with carport, 2nd toilet and shower.

    All you need to do is move your furniture in...and call it home.

  • All information contained herein is gathered from sources we consider to be reliable. However we cannot guarantee or give any warranty about the information provided andinterested parties must solely rely on their own enquiries. Residential | Commercial | Rural | Finance

    ljhooker.com.au

    LJ Hooker Wollongong4229 105568 Market Street

    Secure long term tenants in QUEST one of the largest networks of serviced apartments in Australasia.Lease term 14.06.2015 with 5x5x5x5 year options & 4% per annum automatic rental increases. Bright sunny north west facing modern 2 bedroom apartments on levels 7 & 8 in the heart of the Wollongongs CBD. Serviced by lift & Security basement parking.

    For Sale$284,900 each unit

    ViewBy Appointment

    ContactPhil Oppenauer 0408 422 864

    OVER 8% RETURN IDEAL FOR YOUR SUPERFUND!

    32

    1 1

    2LJ Hooker Wollongong4229 105568 Market Street

    For Sale $679,000 NEW PRICE!!View Saturday 12th May 11.00 - 11.30amContact Phil Oppenauer 0408 422 864,Marnie Oppenauer 0421 039 659

    High ceilings, polished timber floorboards and sunny north facing rear garden. Features a formal lounge opening through french doors which lead to a wrap covered deck perfect for alfresco dining. New polyurethane kitchen with caesar stone benchtops. Supersize air conditioned family room & separate dining. 12m long master bedroom with huge ensuite and parents retreat.

    A fine example of a most successful renovation.

    1

    2LJ Hooker Wollongong4229 105568 Market Street

    For Sale $337,000View Saturday 12th May 10.00-10.30amContact Phil Oppenauer 0408 422 864,Marnie Oppenauer 0421 039 659

    A 2 bedroom apartment on ground floor in a well maintained 13 year old building. Spotless interior with new timber floors and access to sunny terrace through both bedrooms and air conditioned lounge. Separate dining area adjoins modern laminate kitchen with breakfast bar. Internal access to basement parking. Close to University, Beaton Park Leisure Centre on free bus route. An ideal first purchase or perfect investment in this location.

    1

    Formal & informal living, defined dining Massive all weather entertainment area

    featuring outdoor spa, double garage plus space for trailer.

    For Sale $440,000View Saturday 12th May 11.30-12.00pm ljhooker.com.au/Contact Marnie Oppenauer 0421 039 659

    LJ Hooker Wollongong 4229 105568 Market Street

    NEW PRICE! SINGLE LEVEL HOME

    1

    Small self managed development of only 3 located at the end of a cul-de-sac bordering Figtree

    Currently leased until Sept at $300 p.w.

    For Sale $280,000View By Appointment ljhooker.com.au/Contact Marnie Oppenauer 0421 039 659

    LJ Hooker Wollongong 4229 105568 Market Street

    FIRST HOME BUYER BUDGET?

    1

    If you are tired of looking at properties with small bedrooms then this one will surprise! Timber & granite kitchen, defined dining area, large bathroom. Level walk to CBD.

    For Sale $369,000View Saturday 12th May 10.30-11.00am ljhooker.com.au/Contact Marnie Oppenauer 0421 039 659

    LJ Hooker Wollongong 4229 105568 Market Street

    NEW LISTING! INNER CITY TOWNHOUSE!

    1

    Situated in small development of only 3 Freshly painted & new carpet Wrap courtyard just enough for a small garden Internal access to garage (remote).

    For Sale $379,000View By Appointment ljhooker.com.au/Contact Phil Oppenauer 0408 422 864

    LJ Hooker Wollongong 4229 105568 Market Street

    VILLA - LEVEL WALK TO TOWN

    1

    A rare find in this ever popular suburb. 628 m2 battleaxe block, handy to village. 19.7 m x 23.4 m (approx) - wide fronted. Plans available for viewing a large 3 brm home with 4 car garage. Single level home permitted only.

    For Sale $289,900View By Appointment ljhooker.com.au/Contact Phil Oppenauer 0408 422 864

    LJ Hooker Wollongong 4229 105568 Market Street

    LEVEL, EASY BUILDING HOME SITE

    1

    Land at this price is a rare find! New subdivision, bushland outlook cul-de-sac. Handy to Nareena Hills Primary School. Land size 515m2 & building envelope 315m2.

    For Sale $227,900View By Appointment ljhooker.com.au/Contact Phil Oppenauer 0408 422 864

    LJ Hooker Wollongong 4229 105568 Market Street

    LAST ONE, LAST OPPORTUNITY!

    1

    Sep lounge & air cond family room extension Original kitchen & bathroom 3 bedrooms all with built-in robes 5.6 x 5.2 m undercover deck

    For Sale $455,000View Saturday 12th May 10.30-11.00am ljhooker.com.au/Contact Phil Oppenauer 0408 422 864

    LJ Hooker Wollongong 4229 105568 Market Street

    HUGE 4 CAR GARAGE UNDER!

    1

    Brick & tile home in popular cul-de-sac ready for the doer-upper. Originally a 3 brm home (now 2 with sep dining). 600m2 garden allotment. Single carport, potential for garage/storage under.

    For Sale $399,000View Saturday 12th May 12.30-1.00pm ljhooker.com.au/Contact Marnie Oppenauer 0421 039 659

    LJ Hooker Wollongong 4229 105568 Market Street

    A CHANCE TO ADD VALUE!

  • 10 May 2012 7

    All information contained herein is gathered from sources we consider to be reliable. However we cannot guarantee or give any warranty about the information provided and interested parties must solely rely on their own enquiries.

    1

    13 Live/work Apartments Stunning beach views, close to town Walk to Werri beach, town & shops Architecturally designed, staged development DA expires April 2014 - pre-sales potential Plans, Information Memorandum available

    For Sale $1.65 millContact Marnie Beauchamp 0438 289 341

    LJ Hooker Kiama 4232 2888 2/110-112 Terralong Street

    Development Approved Site

    LJ Hooker Kiama4232 2888 2/110-112 Terralong Street

    Direct access to Easts beach Expansive ocean & beach views Designed to suit easy living 4 bedrooms plus study Finest quality kitchen & inclusions Separate lounge & family areas Entertaining balcony with spectacular

    ocean, mountain & beach backdrop Home is less than 3 years old Reduced to sell!

    For SaleOffers above $1,100,000

    ViewSaturday 12:00 - 12:30ljhooker.com.au/VGH82

    ContactCraig Higbid 0404 471 469

    32

    11

    Stunning views as far as the eye can see Walk to 2 beaches - Kendalls & Easts Redevelopment potential -perfect position Relax to the sounds of the Pacific ocean One of Kiamas most sought after locations!

    For Sale Price Guide above $750,000View Sat 11:00 - 11:30 ljhooker.com.au/VEH82Contact Marnie Beauchamp 0438 289 341

    LJ Hooker Kiama 4232 28882/110-112 Terralong Street

    Waterfront reserve - living on the edge

    1

    Stunning vista of activity with beach & sea life Direct beach access, northerly aspect Spacious home, multiple living, lots of light Potential for a granny flat Views from almost every room

    For Sale Guide over $960,000View Sat 1:00 - 1:30 ljhooker.com.au/VTH82Contact Marnie Beauchamp 0438 289 341

    LJ Hooker Kiama 4232 2888 2/110-112 Terralong Street

    Mezmerising views of beach & ocean

    1

    Solid brick home with sunny northerly aspect Quiet street with farmland & ocean views Walking access to nearby Easts beach Spacious layout with large multiple living areas Rumpus downstairs with a huge double garage

    For Sale Price Guide $600,000+View Sat 1:45 - 2:15 ljhooker.com.au/RTH82Contact Marnie Beauchamp 0438 289 341

    LJ Hooker Kiama 4232 28882/110-112 Terralong Street

    Solid home with ocean views!

  • Thinking of selling & want to achieve the best possible return for your very important asset?

    55 Illowra Crescent, PrimbeeA Great Buy

    3 1 1

    3 bedroom home featuring modern kitchen Separate lounge and dining area Modern bathroom, good size bedrooms External laundry, 2nd WC, large backyard, single garage Walking distance to schools, shops & transport.

    Saturday 11.00 - 11.30am

    $290,000

    Joshua Kersten 0419 991 500

    R&H Wollongong 4229 9600

    View Price

    Agent

    rhw.com.au

    R&H Wollongong 4229 9600

    Only $189,000 eachExceptional Value - Only 1 Left Vacant / level block of land available now Approx 581.74m2 with 13m frontage North facing Close proximity to the beach & Lake Illawarra Walk to schools, shops & transport Dont miss this superb opportunity

    rhw.com.au

    Saturday 11.00 - 11.30am

    Joshua Kersten 0419 991 500

    View

    Agent

    Saturday 12.00 - 12.30pm

    $275,000

    Joshua Kersten 0419 991 500

    1/19 Railway St, North WollongongWell Presented Ground Floor Unit 2 bedroom unit in small block of 4 As new bathroom & kitchen Internal lndry (w fridge, washg machine & dryer) Single car space, walk to Uni & railway Current rental = $260pw on expired lease

    2 1 1

    View

    Price

    Agent

    rhw.com.au

    R&H Wollongong 4229 9600

    Saturday 11.30 - 12.30pm

    Alex Verdi 0416 006 225 Mathew Ivanoff 0419 768 412

    R&H Wollongong 4229 9600

    3 2 2Price offers above $399,000

    View

    Agents

    3 bedroom Torrens Title home Situated on 297m2 parcel of land Huge Double garage with internal access Ensuite to main bedroom, built in Robes in all bedrooms Generous & private courtyard, amazing views + Position

    4/25 Old Saddleback Road, KiamaNeat & Sun Filled Interiors

    rhw.com.au

    Saturday 1.30 - 2.00pm

    17/5/12 Links Seaside @ 6pmAlex Verdi 0416 225 006Joshua Kersten 0419 991 500*Agent Interest declared

    R&H Wollongong 4229 9600

    St Johns Avenue, MangertonEmbracing Style, Substance & LocationPerfect for those who value easy maintenance, lifestyle & opulent design. With a magical sense of seclusion, the expansive home epitomises peace and privacy. Showcasing warm classical interiors inviting indoor/outdoor living with a stunning pool and resort style pool house or guest retreat. Fabulous entertaining alfresco areas plus 180 degree views of the escarpment. Fresh interiors, high ornate ceilings, polished floors, open living /dining & a stunning gourmet kitchen. Beyond is another fabulously large living area with cedar french doors flowing seamlessly to the outdoors.This beautifully presented property will not disappoint the most discerning buyer. Only moments away from all major conveniences. A must See!

    3/4 3/4 3/ 3 2Auction 17/5/12

    View

    Auction

    Agent

    rhw.com.au

    Ask Us How - Outstanding Results - Expert Advice - Peace of Mind

    rhw.com.au

    Price $189,000

    4 Gladstone Avenue, WollongongLarge Iconic Residence

    4 3 1

    A spralling 4 bedroom federation home 2 baths, enclosed verandahs, courtyard & garden Bright & sunny with leadlight windows Beautiful original fittings & dual fireplaces Situated on a large 803m2 parcel Must be seen to be appreciated

    Saturday 1.00 - 1.30pm

    24/5/12 onsite @ 6:00pm

    Lynda Burnside 0411 800 801

    R&H Wollongong 4229 9600

    View Auction

    Agent

    rhw.com.au

  • CITI1

    VICTOR SHALALA 0421 307 664

    *conditions apply

    226 CORRIMAL ST, WOLLONGONG

    JOE CASAROTTO 0400 997 909

    Commercial Space for SaleVTPWRVTPRQJURXQGRRU([FHOOHQWVWUHHWIURQWDJH

    Completion late 2012

    the

    esse

    nce

    of in

    ner c

    ity li

    ving

    ...

    $WFKLVRQ6WUHHW:ROORQJRQJ&%'

    PRICES REDUCED BY $25,000 - $30,000 FOR A LIMITED TIME ONLY

    UNBEATABLE VALUE

    42 SOLD - COMPLETION DECEMBER 2012**

    Residential Apartments for saleEHGVWXG\FDUIURPQRZEHGEDWKFDUIURPQRZ3RO\HXUHWKDQHNLWFKHQVZLWKJUDQLWHEHQFKWRSV(XURSHDQVWDLQOHVVDSSOLDQFHV2XWVWDQGLQJYLHZV3URYHQKLJKUHQWDOUHWXUQLQWKLV&%'ORFDWLRQOnly 10 8 Apartments Remaining6WDPS'XW\&RQFHVVLRQV$SSO\

    Bids from $330,000

    RH Kiama4232 1688

    10 King Street, KiamaLOW RESERVE AUCTION

    * 4 only villas - will be sold at $ low prices* As new modern design - open plan living* Huge tiled balconies + rear courtyards* Quality kitchens & bathrooms* Bidding from $330,000

    First to see will buy.

    ViewSaturday 12.00 - 12.45pm

    AuctionThursday 31st May 2012

    AgentSteve Pryor0408 423 [email protected]

    2 2 2

    rh.com.au/Kiama

    OPEN

    RH Kiama4232 1688

    285 Mount Brandon Road, JerraraYOUR RETREAT FROM THE WORLD

    Set on beautiful 400sqm block with rainforest to one side and a near mountain backdrop. North facing sundrenched home displaying magnificent panoramic views of rolling hills, ocean bays and coastline. A truly magnificent location only 10 minutes approx drive to Kiamas shopping precinct and beaches.

    31st May 2012 7:00pmKiama Showground Pavilion

    ViewSaturday 1:00-1:45pm

    AuctionThursday 31st May 2012 PriceAUCTION

    AgentTerry Rigoni0408 641 [email protected]

    4 2 2

    rh.com.au/Kiama

    OPEN

  • This spacious apartment is located in a sought after luxury complex approximately ten years old. In the heart of Wollongong, with stroll to shops, cafes, restaurants and transport, the location could not be more convenient for retirees or investors.

    Features:-Open plan living room and dining area opening onto a 75sqm outdoor terraceLuxury polyurethane kitchen with stone bench tops and gas stainless steel stoveThree large bedrooms with mirrored built-in wardrobesMaster bedroom with walk-in robe, luxury ensuite and access to an outdoor terraceFull main bathroom, laundry off the kitchenVery private outdoor terrace, partly covered with beautifully terraced gardens Security complex with double lock up garage with elevator access

    VIEW:

    ADDRESS:

    AGENT:

    AGENT:

    Newly renovated three bedroom cottage with potential for dual occupancy, plans and reports available

    Approximately an acre (3662m2) of lush green cleared land, fully fenced sand horse arena and double stable

    Located in private cul-de-sac,100 metres to the train station, 250 metres to Wombarra Beach

    AGENT:

    Neat, single level cottage with renovated bathroom and generous sized bedrooms

    Features r/c air conditioning, central lounge/dining, lots of storage and modern kitchen

    Remote single lock up garage with workshop and an abundance of storage

    AGENT:

    In a rainforest setting, this unique and spacious family home offers ocean views from the living areas, balconies and master bedroom. Very private and tranquil, rear yard with pond and waterfall. Brand new gourmet kitchen with stone benchtops and s/s appliances.

    AGENT:

    Immaculate split level family home located in an exclusive cul-de-sac offering plenty of natural light and scenic escarpment views. Approx 800m to the beach.- Two to three separate living areas, formal & ingormal dining- Master bedroom complete with en-suite, balcony and walk-in robe

    AGENT:

    Perfect entry point into the market for the young family looking for a smart purchase in an area of growth. Quiet neighbourhood close to all amenities. Currently rented at $365 per week.

    AGENT:

    High set double brick 3 storey home with spectacular ocean views

    Huge rumpus, games or snooker room with built-in bar and a second downstairs kitchen

    Terraced backyard with olives, grapes and fruit bearing trees

    AGENT:

    Selection of large living spaces, 5 bedrooms, under floor heating & ducted vacuum

    1860sqm parcel of land, DA Approved Granny Flat High set at end of cul-de-sac, scenic views

    AGENT:

    Sitting quietly at the end of a beautiful tree lined cul-de-sac, right in the heart of everything. Spacious open plan lounge and dining area with reverse

    cycle split system air conditioning. Wheel chair accessible and disable friendly bathroom, 2

    courtyards

  • Dougmal Harcourts Wollongong4229 8255 dougmalwollongong.harcourts.com.au

    Walk to Port swimming pool & enjoy the atmosphere of living in this beach side location, at a realistic price.

    Established brick veneer and tile home, big 741sqm block. 3 double bedrooms, separate lounge, plus big kitchen, dining & family room. Garage storage & utility room, plus outdoor cabana/entertainment area Easily maintained, child friendly rear yard with a purpose built veggie garden.

    OPEN HOME: Saturday 12th May 10- 10.30am

    WEB ID#: harcourts.com.au/nwg4542

    3 1 1

    Greg ChadwickM: 0408 422 644E: [email protected] Harcourts Wollongong 4229 8255

    Port Kembla 144 Military Road $525,000Back to Port

    VIEW AT: dougmalwollongong.harcourts.com.au

    Dougmal Harcourts Albion Park4256 3122 dougmalalbionpark.harcourts.com.au

    AUCT

    ION

    Two separate well located "Torrens Titled" duplex going to auction,the ideal investment opportunity! This quality built property is brand new & ready to be enjoyed... never been lived in, therefore offering stamp duty exemptions. Open floor plan, 4 B/Rs, built-in robes, ensuite, lovely light filled living, 2 contemporary bathrooms + downstairs powder room, must see well appointed kitchen, secure courtyard with grassed area & single lockup garage with internal access.

    OPEN HOME: Saturday 12th May 10.30 - 11.00 am

    Daniel McConnellM: 0405 454 624E: [email protected] Harcourts Albion Park 4256 3122

    Albion Park 61 & 61A Mortlock DriveTwo "Brand New" Duplexes... Sold Separately!!

    VIEW AT: www.dougmalalbionpark.harcourts.com.au

    Extremely tidy brick and tile property, representing great buying power in todays market. Perfectly set on large level block feat 3 B/ Rs, generous master with built in robe, lovely air con open plan living + separate downstairs games/retreat room, smart remodelled three way bathroom, clean well appointed "original" kitchen with meals area. Entertain with covered pergola over looking spacious grassed yard. Oversized lock up garage with internal access. Hurry!!

    VIEW AT: www.dougmalalbionpark.harcourts.com.au

    Daniel McConnellM: 0405 454 624E: [email protected] Harcourts Albion Park 4256 3122

    Farmborough Heights $369,900Buying Power!!

    Budget brick & tile family home tastefully renovated throughout. Size will surprise with formal lounge + separate family room, 4 bedrooms, remodelled kitchen with breakfast bar & well appointed bathroom, all this with fresh dcor throughout & polished timber floors. Outdoors large level yard with covered entertainment area, lockup garage + storage area. Clean tidy 4 bedder at this price... simply wont last!!HURRY FIRST HOME BUYERS...OPEN HOME: by appointmentVIEW AT: www.dougmalalbionpark.harcourts.com.au

    Daniel McConnellM: 0405 454 624E: [email protected] Harcourts Shellharbour 4256 3122

    Barrack Heights 26 Gasnier Road $319,000Budget 4 Bedder...

    NEW

    Completely renovated from top to bottom this property is sure to impress feat 3 B/Rs x 3 BIWs, ultra modern dcor throughout, spacious formal lounge with pleasant outlook & sep family room, must see renovated kitchen & near new large well appointed bathroom that boasts big corner spa bath + lockup garage with storage. Outdoors entertain with covered pergola area flowing off family room all while overlooking tidy grassed yard, fully fenced.OPEN HOME: Saturday 12th May 1.30-2.00 pmVIEW AT: www.harcourts.com.au

    Daniel McConnellM: 0405 454 624E: [email protected] Shellharbour 4256 3122

    Mt Warrigal 2 Armstrong Avenue $349,900Bare Bone Bargain!!

    OPEN

    Tullimbar village at its finest...Truly spectacular throughout with an amazing light filled floor plan and dcor that is sure to "WOW" all. Spacious throughout feat 4 B/Rs, master with balcony, robes and ensuite. Simply must see kitchen completely renovated, 3 spectacular bathrooms, extensive use of feature flooring and large double garage on remote with internal access. Outdoors entertain with covered pergola area overlooking tidy grassed yard. Quality wont be matched!OPEN HOME: Saturday 12th May 11.30 - 12.00pmVIEW AT: www.dougmalalbionpark.harcourts.com.au

    Daniel McConnellM: 0405 454 624E: [email protected] Harcourts Albion Park 4256 3122

    Tullimbar 16 Broughton Avenue $459,000Oozing With Quality!!

    OPEN

  • Dougmal Harcourts Northern Suburbs42848833www.dougmalwoonona.harcourts.com.au

    JUST

    LISTE

    D

    Located in one of Russell Vales sought after Streets. 3 bedroom single level clad and tile home. Formal lounge through to separate meals area of kitchen. Built in robes in each bedroom and modern bathrooms. Combined bathroom / laundry of study area. Covered pergola and lock up garage. Established gardens with loads of room.

    OPEN HOME: Saturday 12/05/1212.00pm-12.45pm

    3 2 1

    Rod FinlayM: 0411 385 833E: [email protected] Harcourts Northern Suburbs 42848833

    Woonona 6 Nimbin Street $480,000-$515,000Over 900 Sq Mtrs Block

    VIEW AT: www.dougmalwoonona.harcourts.com.au

    JUST

    LISTE

    D

    This immaculately presented unit would be a great investment or first home. Spacious Sundrenched North facing open plan living area which leads to own balcony. Modern

    laminate kitchen, floating timber floors. 2 bedrooms, BIW and single bathroom. Under building parking, storage room and only 200m to shopping centre, restaurants and

    cafs.

    OPEN HOME: Saturday 12/05/1212.00pm-12.45pm

    2 1 1

    Colin RobertsM: 0412 188 171E: [email protected] Harcourts Northern Suburbs 42848833

    Woonona 16/18 High Street $285,000Sundrenched, Modern, Views

    VIEW AT: www.dougmalwoonona.harcourts.com.au

    JUST

    LIST

    ED

    2 1 1

    Rod FinlayM: 0411 385 833E: [email protected] Harcourts Northern Suburbs 42848833

    2 bedroom first floor unit towards the rear of the block. Open plan lounge / dining through to a modern kitchen. Built in robe in the main bedroom, modern bathroom. Internal laundry , leafy outlook from the verandah. Single lock up garage , easy walk to shops

    Woonona $250,000-$265,000Central Woonona

    VIEW AT: www.dougmalwoonona.harcourts.com.au

    NEW

    LISTIN

    G

    Must see this free standing townhouse in security complex to appreciate Light filled spacious open plan tiled living, dining area which opens onto large sundrenched

    north facing undercover alfresco/entertainment area Modern polyurethane kitchen with stainless steel appliances 4 double bedrooms, all with B.I.W., 3 seperate bathrooms, ideal for possible home office Double tandem garage, only metres from shops, cafes and resturants

    OPEN HOME: Saturday 12/05/1212.00pm-12.30pm

    4 3 2

    Colin RobertsM: 0412 188 171E: [email protected] Harcourts Northern Suburbs 42848833

    Woonona 1/16 Ball Street $499,000Convenient, Low Maintenance, Lifestyle

    VIEW AT: www.dougmalwoonona.harcourts.com.au

    Located on a level 575 sq mtr block. Brick and tile two bedroom home. Formal lounge, separate dining and modern kitchen. Bathroom with both shower and bath, separate wc. Enclosed north facing rear verandah. Single lock up garage.

    OPEN HOME: Saturday 12/05/12 10.00am-10.30am

    Rod FinlayM: 0411 385 833E: [email protected] Harcourts Northern Suburbs 42848833

    Woonona 18 Athol Street $450,000-$465,000Position + Price

    Entertain, unwind and relax in your own sundrenched yard and sparkling in ground pool.

    Cook up a storm in your new stylish modern kitchen.Plenty of room for the family with 2 completely separate living areas.

    OPEN HOME: Saturday 12/05/12 11.00am-11.30am

    Colin RobertsM: 0412 188 171E: [email protected] Harcourts Northern Suburbs 42848833

    Woonona 16 Pat Geraghty Place $739,000A Sea Side Retreat

  • Dougmal Harcourts Corrimal4286 5999dougmalcorrimal.harcourts.com.au

    A beautifully maintained 2 bedroom brick & tile home, set on a sizable 655sm block in East Corrimal situated only meters from beaches, bicycle track, cafes & transport. This fabulously maintained brick & tile home featured 2 bedrooms with built in robes, 2 living areas one can be easily converted back to 3rd

    OPEN HOME: Saturdays 11.00am-12.00amThursday 17/05/12 5.00pm-5.30pm

    AUCTION: Saturday 02/06/12 11.00am On Site.

    VIEW AT: dougmalcorrimal.harcourts.com.au2 1 2Alysha RobertsM: 0423 043 302E: [email protected] Harcourts Corrimal 4286 5999

    East Corrimal 24 Lake Parade AuctionSeaside Lifestyle

    bedroom. Modern kitchen with huge walk in pantry, neat & tidy bathroom. Sun filled desk,single drive-thru garage with carport at rear, ideal for a boat or caravan. Landscaped level yard with veggie patch really to go. Offers will be considered before auction

    AUCT

    ION

    3 bedroom two storey townhouse Open plan lounge and dining, large kitchen with gas cooking Master bedroom with balcony, built ins and ensuite Second bathroom with both shower and bath,3 wcs Internal garage access, paved rear courtyard , garden area at side OPEN HOME: Saturday 12/05/12

    11.00am-11.30am

    Rod FinlayM: 0411 385 833E: [email protected] Harcourts Corrimal 4286 5999

    Woonona 2/88 Campbell Street $390,000-$420,000Location and Presentation

    Near new ground floor unit in Security Complex Spacious open plan living with polyurethane kitchen, ceasar stone

    bench tops, stainless steel appliances Offers one spacious bedroom with full length BIW and own balcony Security under building parking/single extra wide car space for

    disable access, also including a lift Great rental return of $400.00 per weekOPEN HOME: Satruday 12/05/12 11.00am-11.30am

    Colin RobertsM: 0412 188 171E: [email protected] Harcourts Corrimal 4286 5999

    Wollongong 6/21-25 Beatson Street $359,000Investors Dream - Offers Considered

    PRICE

    REDU

    CED

    This home is a wonderful staring point or even investment. comprising 3 bedrooms with built-in robes, main bedroom featuring a walk-in robe leading into two way bathroom. Also open plan lounge, dining and kitchen with new floating floorboards, with reverse cycle air-conditioning offers year round heating and cooling. Single lock-up garage with internal access, covered outdoor entertaining area. Fully fenced easy care yard, over looking the roof tops to escarpment views.

    Alysha RobertsM: 0423 043 302E: [email protected] Harcourts Corrimal 4286 5999

    Horsley $369,000Much More Than Meets The Eye

    Located on almost 700 square meters of land. 3 bedroom clad and tile home with loads of character. Formal lounge through to meals area and modern kitchen. Master bedroom with walk through robe to shower toilet and

    laundry.Second modern bathroom with shower and bath.

    OPEN HOME: Saturday 12/05/121.00pm-1.30pm

    Rod FinlayM: 0411 385 833E: [email protected] Harcourts Corrimal 4286 5999

    Woonona 10 Hale Street $470,000-$490,000Presentation and Lifestyle - Pool

    This fabulous home needs a new family. It is so neat and sits on a 537m2 block with an enclosed rear yard and a single lock up garage. The 3 bedrooms and separate lounge, dining and kitchen are all you need. Make this your home and stamp your own personality on it, it is located close to schools, shops and transport for your convenience.

    OPEN HOME: Saturday 12/05/1211.00am-11.30am

    Belinda Duncombe M: 0411 384 833E: [email protected] Harcourts Corrimal 4286 5999

    Corrimal 277 Rothery Road $389,000What a Cutie

    This single level, brick, four bedroom home has all the room you will need for your growing family with 3 separate living areas including a rumpus with a built in bar which leads out into the undercover massive entertaining area. The Bonus is the resort style ingound pool, you will think you were on permanent vacation in BALI !

    OPEN HOME: Saturday 12/05/1212.30pm-1.00pm

    Belinda DuncombeM: 0411 384 833E: [email protected] Harcourts Corrimal 4286 5999

    Berkeley 332 Flagstaff Road $399,000PERFECT FAMILY HOME

    This immaculate 2 bedroom unit has had a makeover. With beautiful renovations to the Kitchen and bathroom including a fresh coat of paint throughout. No need to bring the vacuum along as this spacious unit has polished timber floors throughout for easy maintenance, main bedroom features a built in wardrobe. Located in a small and quiet block of 3 with wheelchair access and a carport at the back. OPEN HOME: Saturday 12/05/12

    10.00am-10.30am

    Belinda DuncombeM: 0411 384 833E: [email protected] Harcourts Corrimal 4286 5999

    Corrimal 2/82 Pioneer Road $319,000Ive Had a Facelift

    The owners have run out of steam with this renovation project so it is now a great opportunity for someone with determination and vision to take it over or rebuild and the bonus is, its in an established suburb with large quality brick homes surrounding you. Take advantage and capitalise on this opportunity and either RIP DOWN or RENOVATE this home but dont miss out on the fabulous views.

    Belinda DuncombeM: 0411 384 833E: [email protected] Harcourts Corrimal 4286 5999

    Farmborough Heights $259,000Worst House - Great Street

  • Dougmal Harcourts Oak Flats4256 6666dougmaloakflats.harcourts.com.au

    Recently renovated throughout and within easy walking distance to Stocklands Shellharbour Shopping Centre

    Up to the minute kitchen and bathroom New carpets, blinds and freshly painted Free standing villa with its own courtyard in a small well maintained complex Currently rented for $350 per week

    3 1 1

    Dale WhittakerM: 0414 376 720E: [email protected] Harcourts Oak Flats 4256 6666

    Blackbutt $305,000Investor Special

    VIEW AT: dougmaloakflats.harcourts.com.au

    Expansive residence in a whisper quiet setting, just 2 minutes to Windang Beach Spaciously proportioned with generous doubles & soaring raked ceilings Ideal private family home offering space to move around Stylish timber kitchen with dishwasher, 2 living areas and 2nd toilet Outdoor entertaining area and established lawns & gardens Just 5 minutes to major shops, lakes edge & school. Block size 562.9m2

    4 1 0

    Deb CumminsM: 0412 426 495E: [email protected] Harcourts Oak Flats 4256 6666

    Windang $479,000Architectural Design In Cedar

    VIEW AT: dougmaloakflats.harcourts.com.au

    OPEN

    HOME

    Boasting a lovely timber kitchen, 2 bathrooms and 2 separate living areas Other features include a security system, ceiling fans, built-in robes and a walk-in

    dressing room & ensuite up on the parents private level PLUS an inground swimming pool for those hot summer days Located just a 2 minute walk to shops, doctors and schools & a few minutes drive

    to Shellharbour City Centre. Block size is 556.4m2

    OPEN HOME: Saturday 12 May12.00pm - 12.30pm

    4 2 1

    Deb CumminsM: 0412 426 495E: [email protected] Harcourts Oak Flats 4256 6666

    Mount Warrigal 108 Lake Entrance Road $339,000Value Packed!

    VIEW AT: dougmaloakflats.harcourts.com.au

    Located in a sought after street in Oak Flats 2 separate living areas and combined kitchen/dining area Inground swimming pool and well maintained lawns & gardens Close to shops, schools and public transport Currently rented to great reliable tenants, however vacant possession is available

    3 1 1

    Deb CumminsM: 0412 426 495E: [email protected] Harcourts Oak Flats 4256 6666

    Oak Flats $339,000Spacious Family Home

    VIEW AT: dougmaloakflats.harcourts.com.au

  • Dougmal Harcourts Oak Flats4256 6666dougmaloakflats.harcourts.com.au

    Quiet, but very convenient to all amenities, walk to the shops, doctors & school Sound 3 bedroom brick veneer property with new bathroom, good size living and

    dining area plus a neat sunny kitchen Reverse cycle air conditioning and natural gas heating & hot water Covered deck, a generous sized bike shed/workshop, garage with auto access

    and maintained gardens. Encompassed by a 663.9m2 block

    3 1 1

    Deb CumminsM: 0412 426 495E: [email protected] Harcourts Oak Flats 4256 6666

    Barrack Heights $325,000Quiet Cul-de-sac Location

    VIEW AT: dougmaloakflats.harcourts.com.au

    What a great way to enter the market at an affordable price This neat 3 bedroom property comes to the market place for the first time Renovated bathroom & original kitchen which overlooks a child friendly back yard Auto access to an oversized garage plus second toilet This home was built in the 1960s and is solid as a rock. Block size 588m2 Within walking distance to Warilla Grove Shopping Centre

    OPEN HOME: Saturday 12 May11.00am - 11.30am

    3 1 1

    Deb CumminsM: 0412 426 495E: [email protected] Harcourts Oak Flats 4256 6666

    Lake Illawarra 16 Albert Street $275,000First Time on the Market!

    NEW

    PRICE

    VIEW AT: dougmaloakflats.harcourts.com.au

    Stocklands Shellharbour, schools and Bunnings are all just a short walk Budget priced solid 3 bedroom brick and tile home Light filled living areas that flow out to the rear yard Off street parking and rear yard access Currently rented but would also make an ideal first home

    3 1 0

    Dale WhittakerM: 0414 376 720E: [email protected] Harcourts Oak Flats 4256 6666

    Blackbutt $339,000Leave The Car Parked and Walk...

    VIEW AT: dougmaloakflats.harcourts.com.au

    Looking for somewhere to share with the in-laws? 696.8m2 block with a brick & tile 3 bedroom home, neat bathroom, open lounge and well appointed kitchen

    Detached from the home is an open plan granny flat with kitchen, bathroom & laundry and a detached tandem garage

    Located in a sought after street, just a few minutes stroll to schools, shops, bowling club and bus stop

    4 2 1.5

    Deb CumminsM: 0412 426 495E: [email protected] Harcourts Oak Flats 4256 6666

    Oak Flats $349,000Granny Flat and All!

    VIEW AT: dougmaloakflats.harcourts.com.au

    Completely renovated home in a quiet convenient street Private front courtyard and secure car accommodation Great family home with French doors opening to the yard Large flat block, fully fenced and child friendly Currently rented to an excellent tenant for $365 per week

    3 1 1

    Dale WhittakerM: 0414 376 720E: [email protected] Harcourts Oak Flats 4256 6666

    Albion Park Rail $360,000Its All Been Done!

    VIEW AT: dougmaloakflats.harcourts.com.au

    A rare opportunity to acquire this phenomenal absolute water front property Perfectly suited for those who wish to renovate to their own taste or rebuild and

    capitalise on this majestic pocket of very exclusive and tightly held real estate Outstanding panorama across the Pacific Blue, Shellharbour Beach & Village Perfectly positioned & never to be built out, level walk to amenities including

    Shellharbour Citys mix of vibrant & cosmopolitan dining, entertaining and retail

    2 1 1

    Deb CumminsM: 0412 426 495E: [email protected] Harcourts Oak Flats 4256 6666

    Barrack Point $1,050,000Magnificent Ocean Panorama

    VIEW AT: dougmaloakflats.harcourts.com.au

  • Dougmal Harcourts Kiama4232 1322dougmalkiama.harcourts.com.au

    NEW

    PRICE

    3 1 1

    Andy WhartonM: 0412 638 708E: [email protected] Harcourts Kiama 4232 1322

    This extremely well presented brick and tile home has everything the potential buyer will require. This 3 bedroom home is just moments to Jones Beach and local shops. Featuring a good sized kitchen and living area, double garage, enclosed back yard with storage and workshop. 3 bedrooms with BIW, 1 bathroom / 2 toilets, double garage East facing with ocean glimpses

    OPEN HOME: By AppointmentWEB ID#: NKM3959

    Kiama Downs 79 Kiarama Avenue $465,000A Well Presented Home Close to Shops, Beach, School and Golf

    VIEW AT: dougmalkiama.harcourts.com.au

    OPEN

    4 2 2

    Andy WhartonM: 0412 638 708E: [email protected] Harcourts Kiama 4232 1322

    An almost new four bedroom home in Gerringongs newest estate "Elambra" has all the touches any savvy owner will require, and it is all done for you. This well positioned home is built by Clarendon, with top quality fixtures and fittings, and a low maintenance garden. Three living areas - formal and TV/rumpus room Close to school, shops, Seven Mile Beach and the Boat Harbour

    OPEN HOME: Sat 12/05 11.00-11.30amWEB ID#: NKM3923

    Gerringong 22 Elambra Parade Price Guide $530,000+Lifestyle Choice

    VIEW AT: dougmalkiama.harcourts.com.au

    5 2 1

    Andy WhartonM: 0412 638 708E: [email protected] Harcourts Kiama 4232 1322

    A rare offering at this premier north facing waterfront reserve address, this home offers breathtaking views over two beaches and across the bay to Kiamas most famous natural feature the Blowhole and beyond. 600sqm block with north facing ocean, beach and headland views Minutes to town, shopping, schools, cafes/restaurants and public transport and

    less than 100 metres to Kendalls Beach

    OPEN HOME: By AppointmentWEB ID#: NMK3887

    Kiama 13 Gwinganna Avenue Price by Negotiation over $1,700,000Rare Waterfront Reserve

    VIEW AT: dougmalkiama.harcourts.com.au

    OPEN

    4 2 2

    Susan SpenceM: 0412 271 091E: [email protected] Harcourts Kiama 4232 1322

    Plenty of space, lots of bedrooms and a large block make this single level home great value for money. Wonderfully quiet and beautifully presented. Stylish kitchen with self cleaning oven and new dishwasher Four good sized bedrooms with built-ins, master with ensuite. 748 sqm block overlooking reserve at rear, and walking distance to shops. NBN ready - all cabling connected in house

    OPEN HOME: Sat 12/05 11.30-12.00pmWEB ID#: NKM3955

    Kiama Downs 32 Hughes Crescent Offers above $510,000Spacious level living home with reserve outlook

    VIEW AT: dougmalkiama.harcourts.com.au

    2 1 1

    Susan SpenceM: 0412 271 091E: [email protected] Harcourts Kiama 4232 1322

    This classic 50s house has been Grans home for over 40 years, but now Grans on the move and her house needs a new owner and makeover. The views are stunning and permanent and the site has many possibilities. So if youre handy with a hammer and paintbrush you could bring out the best in the old place or rebuild and take advantage of the aspect and views. 556.4 sq mt block with expansive ocean views

    OPEN HOME: By AppointmentWEB ID#: NKM3937

    Kiama 35 Cathedral Rocks Avenue $450,000Time to sell Grans house!

    VIEW AT: dougmalkiama.harcourts.com.au 4 3 4

    Andy WhartonM: 0412 638 708E: [email protected] Harcourts Kiama 4232 1322

    Beautiful elevated panoramic ocean and town views, this substantial home has an abundance of space and natural light. Wide covered alfresco deck featured at the rear and wide north facing balcony Beautiful top floor master suite with huge ensuite. Plentiful storage and room for four cars in garage or three and a workshop. Gaze over town to the water beyond and walk to town, beach and the harbour.

    OPEN HOME: By AppointmentWEB ID#: NKM3977

    Kiama 24 Belvedere Street $829,000Substantial Home with Unforgettable Views and Close to Town

    VIEW AT: dougmalkiama.harcourts.com.au

    OPEN

    3 2 2

    Susan SpenceM: 0412 271 091E: [email protected] Harcourts Kiama 4232 1322

    How can you resist this ultimate lifestyle property positioned on the banks of the tranquil Werri Lagoon. Spend your days boating and exploring this natural waterfront environment. Entertaining family and friends in your very own cabana. 3 spacious and light filled bedrooms, main with ensuite Open plan areas for formal and casual living, dining and entertaining Lagoon front cabana with jetty

    OPEN HOME: Sat 12/05 1.00-1.30pmWEB ID#: NKM3823

    Werri Beach 113 Renfrew Road $799,000Wonderful Werri

    VIEW AT: dougmalkiama.harcourts.com.au

    OPEN

    3 1.5 2

    Susan SpenceM: 0412 271 091E: [email protected] Harcourts Kiama 4232 1322

    Undoubtedly one of Jamberoos most well known homes; this classic residence effortlessly combines period character and modern additions. Large country style kitchen with modern appliances High ceilings and original stained glass windows throughout Barbecue entertaining area off kitchen and a large 1300sqm block Separate studio and inground pool in an established garden setting

    OPEN HOME: Sat 12/05 11.00-11.30amWEB ID#: NKM3895

    Jamberoo 63 Churchill Street Offers over $750,000Drualla - A Glimpse of the Past

    VIEW AT: dougmalkiama.harcourts.com.au

  • Dougmal Harcourts Dapto4261 3211dougmaldapto.harcourts.com.au

    OPEN

    HOUS

    E

    Main bedroom with new carpet and access to the 3rd bedroom/sunroom, which has a BIW and 2nd bedroom with air conditioning

    Updated kitchen with air conditioner, electric stove and separate dining area Living area with 9 ft ceilings and polished floorboards Original bathroom with shower and separate toilet Outside you will find a single carport, storage shed and undercover area

    OPEN HOME: Saturday 12 May12.00pm - 12.20pm8 Gloucester Cres, Dapto

    WEB ID#: NDP4777

    2 1 1

    Ben JamesM: 0422 244 098E: [email protected] Harcourts Dapto 4261 3211

    Dapto 8 Gloucester Crescent $295,000Great Investment or Starter Home

    VIEW AT: dougmaldapto.harcourts.com.au

    OPEN

    HOUS

    E

    Three great sized bedrooms, all freshly painted and carpeted, two with BIWs Original bathroom with bath, shower and combined toilet Open plan kitchen and dining with new electric cooking facilities & dishwasher Separate living area with new carpet, 9 ft ceilings and air conditioning Fully enclosed patio area, shed, plus single detached garage

    OPEN HOME: Saturday 12 May10.40am - 11.00am57 Byamee Street, Dapto

    WEB ID#: NDP4775

    3 1 1

    Ben JamesM: 0422 244 098E: [email protected] Harcourts Dapto 4261 3211

    Dapto 57 Byamee Street $325,000Sitting Flat, Sitting Pretty

    VIEW AT: dougmaldapto.harcourts.com.au

    OPEN

    HOUS

    E

    3 1 1

    Michael GarsideM: 0414 490 595 E: [email protected] Harcourts Dapto 4261 3211

    3 bedrooms, main with timber floors, second and third carpeted and 2 with BIWs Modern kitchen, only renovated this year and combined meals area Renovated bathroom tiled to ceiling with bath, shower and separate toilet Large lounge living area with air conditioning and a great outlook Fantastic timber deck at the back which overlooks the inground pool and fully

    fenced yard, brilliant for the kids

    OPEN HOME: Saturday 12 May10.00am - 10.20am30 Huntley Road, Dapto

    WEB ID#: NDP4786

    Dapto 30 Huntley Road $359,000Rural feel, City convenience

    VIEW AT: dougmaldapto.harcourts.com.au

    OPEN

    HOUS

    E

    3 1 1

    Michael GarsideM: 0414 490 595E: [email protected] Harcourts Dapto 4261 3211

    Three bedrooms with built in robes, main and second with air conditioning Kitchen with laminate floating floors, underbench oven and gas cooktop Open plan dining area off the kitchen with access to the outdoor entertaining area Living area with 2 year old carpet, r/c air conditioning plus a gas heating point Low maintenance yard with undercover pergola area Internal access to the single garage

    OPEN HOME: Saturday 12 May11.00am - 11.20am1 Yeldah Drive, Horsley

    WEB ID#: NDP4773

    Horsley 1 Yeldah Drive $359,000Nothing Compares to this beauty

    VIEW AT: dougmaldapto.harcourts.com.au

    Main and second bedroom both with air conditioners, main bedroom with built in robe and all with new carpet and venetians

    Brand new kitchen with meals area, pantry and electric stove Large living area with combustion fire place and air conditioner Detached garage, one and a half cars in width and 2 cars long plus

    a garden shed and carport, there is loads of storage spaceOPEN HOME: Saturday 12 May

    11.20am - 11.40amVIEW AT: harcourts.com.au/ndp4769

    Ben JamesM: 0422 244 098E: [email protected] Harcourts Dapto 4261 3211

    Koonawarra 76 Fowlers Road Offers Above $299,000Neat and complete

    OPEN

    HOUS

    E

    Main bedroom with built in robe, two rooms with ceiling fans Central kitchen with fridge and microwave space, plenty of storage

    and gas stove plus meals area off kitchen Great sized front living plus second living off kitchen with a/c and

    back yard access. Bamboo flooring throughout Entertain family and friends in the outdoor undercover areaOPEN HOME: Saturday 12 May

    11.00am - 11.20amVIEW AT: harcourts.com.au/ndp4684

    Michael GarsideM: 0414 490 595E: [email protected] Harcourts Dapto 4261 3211

    Horsley 7 Yeldah Drive $385,000Low Maintenance Horsley Delight

    OPEN

    HOUS

    E

    663m2 land Quiet estate surrounded by luscious modern homes Less than 10 minutes walk to Lake Illawarra Few minutes drive to local schools and shops Real value at a real price

    VIEW AT: harcourts.com.au/ndp4686

    Ben JamesM: 0422 244 098E: [email protected] Harcourts Dapto 4261 3211

    Koonawarra 153 Wyndarra Way $145,000LAND AHOY!

    Main bedroom and second with built in robes, third bedroom with shutter

    Modern kitchen with stainless steel electric appliances, pantry and soft close draws and doors

    Bathroom tiled to the ceiling with bath, shower and separate toilet Open plan living and dining with timber floating floors

    VIEW AT: harcourts.com.au/ndp4658

    Michael GarsideM: 0414 490 595E: [email protected] Harcourts Dapto 4261 3211

    West Wollongong $355,000Look at this beauty, Its all been done

  • 18 10 May 2012

    Guide

    View

    Details

    For Sale

    View

    Details

    scholtensproperty.com4225 7010 SCHOLTENS

    P R O P E R T Y

    Media Video Tour & Floorplan Online

    Media Video Tour &Floorplan OnlineSat 12.30-1.00pm, Wed 5.30-6.00pm

    Above $800,000

    RELAX AND ENJOY GLENVIEW AUCTION ON SITE 26 MAY 2.00PM

    Jeff Scholtens 0412 423 223 Vicki Buys 0412 132 735

    BALGOWNIE 4 2

    By appointment

    New Listing Set on a beautiful and very private 1000sqm landscaped block 1HDUQHZJRXUPHWNLWFKHQZLWKDWWDFKHGGLQLQJRZVWRDUHOD[HGIRUPDOOLYLQJDUHDA huge deck with an all weather under cover area for uninterrupted entertaining Huge work shop/garage accommodating at least 4 vehicles plus ample storage

    Offers above $640,000

    TRULY REMARKABLE HOME

    MOUNT PLEASANT

    New Listing - Impressive family residence in one of most sought after streetsEnormous amount of quality separate formal and informal living areasEntertainment deck overlooking solar heated inground pool and landscaped block([HFXWLYHVW\OHIDPLO\KRPHZLWKLQPLQXWHVWRWKH%DOJRZQLH9LOODJHOLIHVW\OH

    31 Wellington Drive 4-5 2 4 4

    Jeff Scholtens 0412 423 223 Vicki Buys 0412 132 735

    Suite 5, 61 Market St Wollongong Scholtens Property Pty. Ltd. Trading as Scholtens Property ABN 49 055 099 431

    ITS TIME TO SECUREYOUR FUTURE

  • www.colliers.com.au

    Accelerating success.

    23 2 1

    www.colliers.com.au

    Simon Kersten0419 333 53302 4222 7222

    14-18 Auburn Street, Wollongong

    Auction Friday 18 May at 11:00amVenue 101 Keira Street, Wollongongwww.colliers.com.au/500231533

    AUCTION

    Approximately 2,156m of vacant land ideally situated in the Wollongong CBD on the corner of Auburn & Dean Streets and adjoining Wollongong railway station. The site is zoned B3 Commercial Core under Wollongong LEP 2009, and allows for a multitude of uses including commercial, residential, retail and mixed use. Site dimensions are approximately 39 x 54m.

    Fantastic Prime CBD Development Site

    Accelerating success.

    This vacant site has an area of approximately 2,156m Conveniently located in the heart of the CBD and adjoining Wollongong railway station Zoned B3 Commercial Core with a height restriction of 60m A multitude of potential uses - highly flexible zoning Allowable F.S.R. of up to 6:1 depending on usage (S.T.C.A.)

    FOR SALEPrice $1,070,000

    Inspect By appointment

    Online colliers.com.au/110436649

    Contact Simon Kersten 0419 333 533

    [email protected]

    Office 101 Keira Street

    Wollongong 02 4222 7222

    On top of the world in the centre of it allThis exclusive Penthouse sits atop the quality Ocean View Building with North and South Views. The Cavernous living area and generously proportioned master suite face north and both open out onto the 86m terrace. A designer kitchen with 3-4 separate living spaces is the main feature of the unit. The Ocean View complex features expansive common areas which include a huge swimming pool and large rooftop BBQ area which would easily cater for 100 guests. Located amongst the regions newest residential precinct it is ideally located to all amenities, just a stones throw from the beaches and CBD. Quality penthouse, 184m internal area plus 102m of balconies Sunny northerly aspect plus southerly views as well Complex features pool and entertaining space 2 bathrooms, internal laundry and 2 car spaces Practically new inside only 2 years old

    WOLLONGONG 75/60-62 Harbour Street

    10 May 2012 19

  • LAND YOURSELF A DEAL TODAY

    Limited release of 15 lakeside land lots

    Affordable prices starting from $215,000

    Buy now and settle on your purchase in 2013*

    Closest release to Lake Illawarra Foreshore

    Only 15 minutes from Wollongong & Shellharbour

    Come and make natures playground your new address

    LAKE ILLAWARRA

    HAYWARDS BAY

    SHELLHARBOUR SHOPPING CENTRE

    ALBION PARK

    Visit our Land Sales Centre Call Greg Pollard on 4261 3333 or 0408 424 474LAND SALES INFORMATION CENTRE. 27 RIVERSIDE CRESCENT, HAYWARDS BAY.

    *Disclaimer: 5% deposit. Actual settlement date may vary but will be 30 days after the registration of the land. Other terms & conditions may apply.

  • 4261 3333www.prddapto.com.au Sell Smarter

    Koonawarra, 9 Inala AvenueOnly 200 metres from the Lake foreshore and on an elevated 663m2 block soaking in some amazing lake views makes this 3 bedroom brick home a fantastic buy. Investors can expect $300pw.

    Lakeside Living

    3 BED 1 BATH 1 CAR

    VIEW Saturday, 12:30 - 1:00pmPRICE $275,000 - $295,000CONTACT Tracey McDonald 0404 033 533 [email protected]

    From time to time an opportunity presents itself that is to hard to refuse and the chance to live the rural dream in comfort and style are right here for the taking. Walk inside and feel the atmosphere of open plan living. Prepare feasts in the gourmet kitchen or soak up sun in the sunroom whilst overlooking the solar heated in-ground pool. Of course there is room for a pony or horse on the 9000m2 near level block and landscaped gardens complete the external picture. For the man of the house, the shed will provide the room for all the toys or bits and bobs. Featuring everything you would expect and more, this property offers a unique chance to immerse yourself in the rural dream.

    Yallah, 9 Larkins Lane 4 BED 2 BATH 7 CAR

    VIEW Saturday, 10:00 - 10:30am

    AUCTION 19 May 2012 at 11am Onsite

    CONTACT Jeremy Tillman 0418 244 601 [email protected]

    Rural OasisBerkeley, 5 Short Street

    2 BED 1 BATH 2 CAR

    Located just around the corner from the Lake Illawarra foreshore and boat ramp this well cared for cottage with garage on a huge level 1413m2 block offers a rare opportunity to invest in the future. Lots of this size and location are rarely offered and with a variety of residential uses possible including townhouse or villa unit development a 2 lot subdivision or just a great homesite this property is deserving of your consideration. With the existing cottage assuring immediate rental income the huge development potential of this property it makes the perfect allround investment.

    VIEW Saturday 11:00 - 11:30am or by appointment

    AUCTION 2nd June 2012 at 11am On site

    CONTACT Greg Pollard 0408 424 474 [email protected]

    Can You See The Potential?

    AUCT

    ION

    AUCT

    ION

    VIEW Saturday 11:00 - 11:30am, or by appointment

    AUCTION 2nd June 2012 at 1:00pm On site

    CONTACT Jeremy Tillman 0418 244 601 [email protected]

    Here is an opportunity for any investor or larger family to increase their portfolio. Simply put, this parcel of land is 714m2, right in the heart of Dapto. Improvements include two solid villas under the one roof. Both have three bedrooms and two bathrooms along with a single garage with internal access. The current market value rent for both properties is $740/week approx. Whether you are looking to house the extended family or simply to increase your portfolio, this property is certainly worth a look.

    Dapto, 14 Unara Road

    Reap The RewardsT 6 BED 2 BATH 2 CAR

    AUCT

    ION

    AUCT

    ION

    1 WEE

    K

    TO G

    O1 W

    EEK

    TO G

    O

    Kanahooka, 14 Dimond AvenueClose to schools, shops and freeway access and with that welcome home feeling, this home has all the bells & whistles and nothing to do but move straight on in. Add this one to your list to view.

    Look At The Value!

    3 BED 1 BATH 2 CAR

    VIEW Saturday, 12:00 - 12:30pmPRICE $355,000CONTACT Greg Pollard 0408 424 474 [email protected]

  • Huxley & Partnersr e a l e s t a t e

    The Green Team

    Ph. (02) 4286 5555 112A Railway Street, Corrimal View all these properties online at www.huxleyrealestate.com.au

    Keiraville $785,00036a William Street Ultra modern, spacious four B/R home, main w ensuite Extra study room or library, plus separate work station High ceilings, ducted air conditioning, timber fl oorsTony Sloane 0409 299 407

    4 3 2

    OPEN SAT 12:30-1:00

    Keiraville $629,00022 Gooyong Street Spacious modernised four bedroom brick home Three living areas plus dining & large rumpus rooms Low maintenance grounds with large alfresco diningTony Sloane 0409 299 407

    4 2 1.5Gwynneville $839,0006 Gwynne Street Large 4 bedroom cottage with oversize double garage Open plan living & dining areas, undercover patio Situated on over 1000m2 block, close to UniversityTony Sloane 0409 299 407

    4 2 2

    Corrimal $350-360,0001/22 The Avenue Good sized urban terrace home with three bedrooms Garage, balcony, large courtyard and extra parking Small complex, close to schools, pools & shopsTony Quin 0414 428 401

    3 1 1

    OPEN SAT 9:30-10:00

    Corrimal From $289,0001-10/20 Jones Place As new, totally refurbished two & three B/R apartments Beautiful kitchens & bathrooms, spacious living areas Buy under construction,delay settlement and SAVE!Tony Quin 0414 428 401

    2,3 1 1

    OPEN SAT 9:00-9:30

    Fairy Meadow $540,00018 Lombard Avenue Unique home on good wide land parcel of 645sqm 2 carports, 3 garages, A/C, backing onto lovely reserve Walk through to local shops & CBDTony Quin 0414 428 401

    2 43/4

    Woonona $245,0003/133B Campbell Street Very neat two bedroom home unit in great location Good living areas, balcony and lock up garage Great fi rst home or solid investmentTony Quin 0414 428 401

    1 12

    OPEN SAT 10:15-11:00

    Keiraville $750-800,0008 Keira Mine Road Large double brick tri level fi ve bedroom home Open plan kitchen, dining & formal dining room Outdoor entertainment area w mesh enclosed roomTony Sloane 0409 299 407

    5 4 3

    Woonona Offers Over $200,0005 Russell Street Comes with new r/o/w driveway Suit extra duplex/shop/commercial rooms Site plans available, workshop/shed at rearTony Quin 0414 428 401

    Tarrawanna $588,00021 Bertram Close Stylish Federation Masterston Home 2 living areas, access to outdoor living, inground pool Extra room for boat or van, tranquil livingTony Quin 0414 428 401

    4 2 2

    Fairy Meadow $449,00060 Lombard Avenue Older style two level home in popular location 3/4 bedrooms, 2 bathrooms - can be double living Rumpus room, A/C, balconies, low maintenance yardTony Quin 0414 428 401

    2 13/4

    NEW

    Keiraville $749,00021 Gooyong Street Solid two storey four bedroom brick & tiled home Large living & entertainment areas, 1400m2 block Potential to subdivide or develop, close to UniversityTony Sloane 0409 299 407

    4 2 4

    NEW

    Keiraville $539,0001 Gooyong Street Modernised cottage amid tranquil garden setting Open plan living, high ceilings, polished fl oorboards Undercover entertainment deck overlooking yardTony Sloane 0409 299 407

    4 2 1

    OPEN SAT 11:00-12:00NEW

    Woonona14 Elizabeth Underwood Close Prestigious family home located in Pioneer Beach Estate Spacious formal and family living, 870sqm garden block Outdoor covered entertainment area, cul de sac streetTony Quin 0414 428 401

    $790,000

    Parks and beach a stones throw from this home Easy walk to schools, shops, train station and surf Inspect today and let your beachside lifestyle begin

    4 2 2

    OPEN SAT 11:00-12:00

    Corrimal $320,0003/33 Underwood Street Spacious townhouse with ensuite to master bedroom Study large sunny balcony and private courtyard Open plan living, easy walk to local shops & transportTony Quin 0414 428 401

    2 12

    Corrimal $369,0003/8 Wilford Street Beautifully presented single storey villa Sunny north aspect, double garage, large courtyard Impressive gardens, easy access to shops & transportTony Quin 0414 428 401

    3 1 2Woonona $585,00060 Tulip Way Beautiful Magnolia Garden Estate Huge free standing home set on 526m2 level block Two living areas, private tennis court and poolTony Quin 0414 428 401

    4 2 1

    Fairy Meadow $215,0009/192-198 Princes Highway Top fl oor two bedroom unit with open plan living Internal laundry, balcony, under building carspace Close to shops, schools, University & free bus serviceTony Sloane 0409 299 407

    2 1 1

    OPEN SAT 10:00-10:30

    Fairy Meadow $225-295,000 214 Princes Highway Chose between one/two bed units Int. laundry, s/steel appliances, security parking, lifts On site building manager & close to all amenities Tony Quin 0414 428 401

    1,2 1,2 1

  • 10 May 2012 23

    2 1 22 1 1

    2 1 2

    NEW PRICE

  • 24 10 May 2012

    OConnor

  • PRIC

    E GUI

    DE

    ABOV

    E $95

    0,000

    Man

    gert

    on

    Owner Loves The stunning gourmet kitchen with adjoining formal dining room Cosy fireplace perfect for winter and the tranquility of the area Solar heated pool for those early and late season swims

    Inspect: Sat 12 May 11:00-11:40amSale: On Site Sat 19 May 11:40amContact: Jason Capelo 0424 372 722 - [email protected]

    Ted Hanson 0418 421 281 - [email protected]

    20 Elizabeth StreetAuction

    4

    3

    2

    Plus Upstairs area used as a kids retreat and media room Balcony and BBQ areas great for entertaining Within close proximity to schools and shops with easy access to the freeway

    Wol

    long

    ong

    Owner Loves Walking to North Beach for breakfast and a swim Stunning escarpment views and sunsets The convenient location - within walking distance to restaurants, shops & transport

    Inspect: Sat 12 May 2:00-2:40pmSale: $319,000Contact: Jason Capelo 0424 372 722 [email protected]

    6/14 Keira StreetNew! $319,000

    2

    1

    1

    Plus Located in a small security block Brand new kitchen and carpet Separate living and dining areas

    Owner Loves The open plan living area & modern kitchen Low maintenance property

    5 Badgery StreetNew Price! $379,000

    3

    1

    1

    Alb

    ion

    Par

    k

    Plus Fully fenced property complete with security gate Public transport & shops close by

    Inspect: Sat 12 May 11:00-11:40amDanny ONeill 0416 089 884 - [email protected]

    Owner Loves Quiet, private location & the large courtyard Main bedroom with ensuite & balcony

    6/7 Robsons Road $399,000

    3

    2

    2

    Kei

    ravi

    lle

    Plus Close to Uni, ideal investment Single lock up garage with extra car space

    Inspect: Sat 12 May 1:00-1:40pmDanny ONeill 0416 089 884 - [email protected]

    Owner Loves We love the tranquility of this private estate The vast views from the balcony

    21 Robwald AveNew Price! $579,000

    4

    3

    2

    Co

    nis

    ton

    Plus Main bedroom with ensuite and WIR Large double remote garage & solar system

    Inspect: Sat 12 May 1:00-1:40pmJason Capelo 0424 372 722 - [email protected]

    Owner Loves The sunny back deck great to relax and unwind Fabulous views over Lake Illawarra

    32 Gallop StreetNew Price! $285,000

    3

    1

    1

    Ber

    kele

    y

    Plus Close to schools, public transport & shops Perfect for the first home buyer or investor

    Inspect: Sat 12 May 12:00-12:40pmJason Capelo 0424 372 722 - [email protected]

  • Coastside

    45 Princes Hwy, Dapto4262 2055 coastsidefn.com.au

    Shop 4/20-26 Addison St, Shellharbour4295 5033

    Perfect For Any SituationNestled in a quiet street, this 3 bedroom home is packed with features! With built in wardrobes, back to base alarm system, reverse cycle air-conditioning, a covered outdoor entertaining area, an easy care yard, and a remote control garage with internal access. Within walking distance to Dapto CBD, local corner shops, public transport and schools, this house is an excellent first home, a perfect size down-grade or a outstanding investment opportunity.

    OPEN SAT 12.00-12.30PM

    3 1 1

    Contact Matthew Hutchinson 0423 507 488

    OPEN

    HOUS

    ENEW

    LISTING

    HORSLEY 16 Jenail Pl $369,000

    Light filled interiors, large proportions and private outdoor areas combine to create a first class residence with a commanding street presence. This grand 4 bedroom family home, complete with 4 bathrooms and 2 kitchens has been designed to embrace easy care living, while also being able to enjoy all the luxuries in life. With flowing open plan living, quality appliances and ducted air on the inside and fabulous outdoor entertainment area overlooking a heated concrete in-ground pool on the outside.

    OPEN SAT 1.00-1.30PM4 4 2

    Contact Maria Field 0411 306 323

    OPE

    N

    HOUS

    E

    HAYWARDS BAY 16 Bayview Ave $685,000

    Grand Manor

    Cool Classy & ImpressiveShowcasing exquisitely presented interiors and embraced by manicured garden grounds, this sylish modern design is sure to be enjoyed for generations. With free flowing interiors that effortlessly open onto a private alf