WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert for Detection of MTB and Rifampin Resistance David Warshauer, PhD, D(ABMM) Deputy Director, Communicable.

WISCONSIN STATE LABORATORY OF HYGIENEWISCONSIN STATE LABORATORY OF HYGIENE

GeneXpert for Detection of MTB and Rifampin

Resistance

David Warshauer, PhD, D(ABMM)

Deputy Director, Communicable DiseasesWisconsin State Laboratory of Hygiene

1


HEALTHYPEOPLE

20102020


14-14

Reduce TAT for laboratory Dx

Target: 2 days for 75%

[21 days // ’96]

U.S. Department of Health and Human Services, January 2000


Percentage of Culture-Confirmed Pulmonary TB Cases Detected by NAAT

in Wisconsin (2005-2010)

2005 2006 2007 2008 2009 2010 (June)30

35

40

45

50

55

60

65

70


FDA-Cleared Molecular TB TestsFDA-Approved TB Molecular Assays

for Respiratory Specimens

Amplified M. tb Direct Test® (MTD): Gen-Probe, Inc.

Cepheid GeneXpert ®


Nucleic Acid Amplification Tests

• Commercial tests available outside US

• BD ProbeTec™ MTB Direct Detection• COBAS® Amplicor® MTB Test• COBAS® TaqMan® MTB Test• Hain Genotype® Mycobacteria Series• Innogenetics INNO-LIPATM

• Laboratory Developed Tests• Off-label use of FDA-approved

tests


7

Courtesy Angela Starks, CDC


Use of NAAT by US Public Health Laboratories in 2008 – Starks et al.

[CDC]

104,425 suspect TB patients

92,877 – not tested 88%

12,548 – tested 12%

NAR2010 – P 77

5,855 from Florida


GeneXpert System

Cepheid, Sunnyvale, CA

RT-PCR, < 2 hours

Potential for point of care testing


GeneXpert MTB/RIF Assay

• Automated commercial system for identification of M. tuberculosis complex and detection of rifampin resistance

• Decontamination, digestion, DNA extraction, amplification, and detection in same cartridge

• Integrated positive control assures that a negative result is not due to NAA inhibitors in the specimen

• Results in ~2 hours• Minimal hands on manipulation- technically simple• Platform is random access

10


GeneXpert

• Target: rpoB gene• Nested PCR and molecular beacon

technology• Same segment of the rpoB gene is used

for detection of both M. tb complex and rifampin resistance

• PCR amplifies a small region relevant for rifampin resistance; uses 5 probes to assess for mutations


12


GGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTG TCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTG

507

rpoB

533* ** * * *** **** * *

81 base pair core region* * *** ** ****

*** ****

InsertionTTC

InsertionTTCATG

DeletionCCATTC

DeletionGGCACC

DelAAC

DeletionCAGAAC

DeletionGACCAG

DeletionAATTCATGG

DeletionGAACAA

Genetics of Rifampin Resistance in M. tuberculosis

Adapted from Ramaswamy & Musser. 1998. Tubercule Lung Dis 79:3

13


M. Tb Complex PCR for All


finddiadnostics.org


Example of Rif-Sensitive Profile – 5 probes are positive

MTB/Rif Assay design

Molecular Beacon

Target

Hybrid

Each probe is labeled with a different fluorophore, permitting simultaneous detection of the presence of wild type.

The MTB assay target is the 81 bp region (RRDR) of the rpoB gene.

SPC

16


17

Challenges to Implementing NAAT Guidelines

• MTD: $30/test• Cepheid: $78/test (includes equipment & service [lease or cash]

& kit)

Gen-Probe® MTD Cepheid® MTB/RIF

Reagents2 controls3 patients $240 3 inhib ctrl

3 patients $234

Labor ($20/hr) 2 hrs $ 40 10 min $ 3

Direct costs per patient result

$ 93 $ 79

Courtesy Ken Jost, Texas SPHL


Cepheid

• Limit of detection – 131 CFU/ml• M. tuberculosis viability – minus 8 log• 107 clinical specimens/suspicion of TB –

Vietnam– 100% - 29/29 AFB + / Culture +– 84.6% - 33/39AFB- /solid Culture +– 71.7% - 38/53AFB- / solid & broth Culture

Helb et al. JCM 48:229-237 (2010)


CepheidBoehme et al NEJM

• Assessed Xpert MTB/RIF in 1730 patients– Peru– Azerbaijan– South Africa– India

• Both suspected drug-sensitive and multidrug-resistant pulmonary TBBoehme, C.C. et al. NEJM 363: 1006-1015, 2010


Boehme et al

• Among AFB smear pos/culture pos patients– Single Direct MTB/RIF identified 98.2%

(551/561)• Among AFB smear neg/culture pos

– 72.5% (124/171) – Addition of a second MTB/RIF increased sens to

85.1%– Addition of a third increased sens to 90.2%

• Specificity > 98.1%


Rifampin ResistanceBoehme et al

• Detection of rifampin resistance

– Sensitivity of 99.1% (209/211)

– Specificity of 100% (506)


Xpert Detection of Mtb in Pulmonary TB

22


Rifampin Resistance Detection in Pulmonary TB

23

Chang, K. Journal of Infection (2012) pp 1-9


Expert Performance in HIV Coinfected Population

24



Xpert Performance Breakdown

25



2009 CDC Recommendations for use of NAAT

• “NAAT should be performed on at least one respiratory specimen from each patient with signs and symptoms of pulmonary TB for whom a diagnosis of TB is being considered but has not yet been established, and for whom the test result would alter case management or TB control activities”

• NAAT as standard practice

MMWR, 2009, 58:7-10


CDC Algorithm

• Collect at least one respiratory specimen, preferably the first, for NAAT

• Collect additional specimens for smear and culture

• Must interpret NAAT results in correlation with the AFB smear results


First Respiratory Specimen

Smear NegativeSmear Positive

NAATNAAT

Positive:Presumed TB,

Pending cultureresults

Negative

Use clinical judgment todetermine whether to begin therapy while

awaiting culture results and determine if

additional diagnostic testing is needed.

If a second specimen is smear positive,NAAT negative. the patient is presumed tohave an infection with non-tuberculousmycobacteria, pending culture results,

Consider testing another specimen (not to exceed a total of two).

NAAT Positive: A patient can bepresumed to have tuberculosis,pending culture results, if twospecimens are NAA positive.

Positive Negative

Consider testing another specimen (not to exceed a total of two).

Inhibitors Detected:Test result is of no

diagnostic help.Consider testing secondspecimen (not to exceed

a total of two).

Use clinical judgment todetermine whether to begin therapy while

awaiting culture results and determine if

additional diagnostic testing is needed.

Use clinical judgmentto determine whetherto begin therapy while

awaiting results ofculture and otherdiagnostic tests.

Currently availableNAA tests are not

sufficiently sensitiveto exclude the

diagnosis of TB inAFB smear negativepatients suspected

of having TB.


Who should be tested?

• CDC recommends NAAT on first sputum of all patients SUSPECTED of TB for whom the test result would alter case management or TB control activities– NAAT should NOT be ordered routinely when

clinical suspicion of TB is low.

• Definition of a “suspect” case can vary among clinicians

• Clinicians, TB programs, and laboratorians must collaborate to develop criteria/definition for patients to be tested


Wisconsin criteria for NAAT

• Signs and symptoms• Risk factors• Patient in airborne isolation • Reported to local health

department as a suspect case

• At WSLH all initial smear positive respiratory specimens automatically tested with NAAT


NAAT for release of patients suspected of pulmonary TB from

Isolation• CDC Expert panel

recommendations– Sputum that is NAAT negative and 2

additional sputums that are AFB smear negative.• Collected at 8-24 hour intervals, at least one

of which is an early morning specimen

– Should not be used when suspicion for TB is high enough to start TB medications.• Clinical response, usually 4-7 days treatment,

and 3 smear negative sputums

31


Summary

• Advantages of NAAT– More rapid diagnosis– Initiation of earlier treatment– Cost savings with reduced patient

isolation– Faster reporting to TB Programs– Fewer transmissions


GeneXpert

• Will make NAAT more widely available to suspect TB patients– Earlier diagnosis– Approach 2020 goal

• Will provide rapid detection of rifampin resistance and possible MDR-TB cases– Caveat---In population with low

prevalence of rifampin resistance, predictive value will be poor (approx 56%) 33


GeneXpert

• NAAT is a supplemental test– Does not replace AFB smear and culture– Smear needed for interpretation– Culture still the “Gold Standard” for TB

diagnosis• In a low TB prevalence

population, most smear positive specimens will be NTMs

34


Research Needs for Future Advancements

• Studies to develop, evaluate, and select the most effective and efficient NAAT and culture algorithms

• Develop better tests for non-respiratory specimens

• Develop tests with improved performance and ease-of-use

• Develop tests that will enhance the diagnosis of TB in children

• Develop multiplex assays that can detect M. avium complex, M. kansasii and other NTM

• Develop tests to detect resistance to both first and second line drugs

• Develop tests that can be used in resource limited countries. Requires ease of use and low cost.


Thank You

WISCONSIN STATE LABORATORY OF HYGIENE GeneXpert for Detection of MTB and Rifampin Resistance David Warshauer, PhD, D(ABMM) Deputy Director, Communicable.

Documents

cdc slide

florida slide

cepheid genexpert slide

laboratory dx target

texas sphl slide

point of care testing

rifampin resistance

tb complex pcr