Feb 22, 2016
DNADeoxyribonucleic Acid
DNA
• A type of Nucleic Acid• Genetic material in chromosomes.• Monomer made of:– Phosphate– Sugar (Deoxyribose)– Nitrogen Base
• Monomer= Nucleotide
DNA: Nitrogen Bases
• Nitrogen Bases are the “steps” of the DNA “Ladder”
• Adenine == Thymine (A-T)• Cytosine == Guanine (C-G)• Held together by Hydrogen Bonds
DNA: You Try
DNA: History
• 1950’s Rosalind Franklin & Maurice Wilkens– Xray photography– Spiral structure
DNA: History
• 1950’s Watson & Crick– DNA consists of a
double helix.– Two strands that are
complements of each other.
– Heredity is based on this chemical molecule!
Warm upWhat are the two sets of complimentary base pairs?
What does complimentary mean?
The Functions of DNA
• Replication– Occurs during
interphase.– Split your model
and make two replicated strands!
DNA Replication
Watson and Crick thought that one side of the DNA served as a template for the other side to be built.
The DNA separates. This is caused by an enzyme called the DNA Helicases.
The DNA untwists by breaking the Hydrogen bonds that hold the two strand together.
DNA Replication
DNA polymerase moves along each strand of DNA and adds the missing nucteotides.
The place where the DNA separate is called the replication fork . Two new
DNA strands are formed.
DNA Replication
Once all of the nucleotides are in place, the DNA polymerases are told to stop and detach.
The two pieces of DNA are EXACT.
The DNA polymerase can proofread the DNA to make sure that it matched the nucleotides correctly. It can go back and fix its mistakes. Mistakes happen about every 1 billion nucleotides.
The Language of DNA
• Sets of 3 nitrogen bases is a “word” called a codon.• Each segment of DNA that makes a protein
is called a gene.
ATCCGTACTAACGTACATTGC C0D0N
GENE
The Functions of DNA
• Protein Synthesis • One gene codes for one protein
DNA --> mRNA --> Protein
Transcription Translation
How Proteins are Made
• DNA can not leave the nucleus.• Messenger is needed to carry the
information to the ribosome where the proteins are made.
Ribonucleic Acid
• A nucleic acid.• Single strand• Sugar = Ribose• Nitrogen bases:
Cytosine == GuanineAdenine == Uracil
• Types –mRNA, tRNA, rRNA
Transcription
• The synthesis of mRNA using DNA as the template.
• DNA = T T C A T C
• mRNA= A A G U A G
Let’s Practice: DNA to RNA
DNA RNA1. GGC2. GTA3. TAT4. CCA5. AAA
DO NOW:
1.What is the first step of protein synthesis?
2.Where does the first step occur in a cell?
3.Transcribe the DNA into RNA below.DNA– TAC GTA CGT
RNA -
How to Read a Codon Sheet
Start Codon
Stop
Codon
Stop
Translation: Let’s Try!
• The process of building a protein at a ribosome where the mRNA determines the sequence of amino acids in the protein.
• mRNA= A A G U A G
• Amino Acids/Codons= Lysine, Stop Codon
Translation
• The ribosome reads the mRNA sequence and translates it into the amino acid sequence of the protein.
• The ribosome starts at the sequence AUG, then reads three nucleotides at a time.
• Each 3 nucleotide codon specifies a particular amino acid.
• The stop codons (UAA, UAG, UGA) tell the ribosome that the protein is complete.
Mutations
Mutation: Any change in the nucleotide sequence of DNA.
Warm Up
Transcribe and Translate this DNA Sequence – Healthy Person
TAC-CAA-GTA-GAC-CTC-CTT-CTC-GTG-CAT-CCT-GTG-ATC
Transcribe and Translate this DNA Sequence – Afflicted PersonTAC-CAA-GTA-GAC-CAC-CTT-CTC-GTG-CAT-CCT-GTG-ATC
Mutation Types
Point Mutation (Base Substitution) Replacement of one nitrogen base for another.
Mutation Types Silent Mutation: The change in the nitrogen base makes no difference in the coded amino acid.
Mutation Example• Sickle Cell Anemia
Sickle cell anemia is the most common inherited blood disorder in the United States.
• SCA is genetic disease caused by a point mutation in the hemoglobin beta gene.