WET LAB: DNA Barcoding: From Samples to Sequences PowerPoint slides to accompany Using Bioinformatics : Genetic Research Chowning, J., Kovarik, D., Porter,

WET LAB: DNA Barcoding: From Samples to Sequences

PowerPoint slides to accompany

Using Bioinformatics: Genetic Research

Chowning, J., Kovarik, D., Porter, S., Grisworld, J., Spitze, J., Farris, C., K. Petersen, and T. Caraballo.  Using Bioinformatics: Genetic Research.  Published Online October 2012. figshare. http://dx.doi.org/10.6084/m9.figshare.936568

How DNA Sequence Data is Obtained for Genetic Research

Genetic Data

…TTCACCAACAGGCCCACA…

Extract DNA from Cells

Sequence DNA

CompareDNA

Sequences to One Another

Obtain Samples: Blood , Saliva, Hair Follicles, Feathers, Scales

TTCAACAACAGGCCCACTTCACCAACAGGCCCACTTCATCAACAGGCCCAC

GOALS:• Identify the organism from which the DNA was obtained.• Compare DNA sequences to each other.

Image Source: Wikimedia Commons

• Obtain samples• Purify the DNA• Copy your gene• Make sure you copied

your gene• Obtain DNA sequence

data

• Aquarium, zoo, grocery• Lab 1: DNA Purification• Lab 2: Polymerase Chain

Reaction • Lab 3: Agarose Gel

Electrophoresis• Lab 4: PCR Purification and

DNA Sequencing

From Samples to Sequences

DNA Purification Overview1. Break open the cells.

2. Separate the DNA from the rest of the cell debris.

3. Remove DNA from the spin column and suspend the DNA in buffer for future use.

• Chop tissues and add detergents (disrupt cell membranes), proteinase K, and heat.

• Small “Spin Columns” contain DNA-binding material with small holes.

• Columns bind DNA, other cellular debris washes through column.

• “Elute” the DNA, or remove it from the column.

DNA Purification Using “Spin Columns”

1. Chop up tissues and break open the cells with detergents.

2. Separate the DNA from the rest of the cell debris using spin column and centrifugation.

3. Suspend the DNA in buffer for future use.

1. Tissues Chopped and Broken Open with Detergents

2.Spin Column

3.DNA in Buffer

DNA Purification Overview1. Break open the cells.

2. Separate the DNA from the rest of the cell debris.

3. Remove DNA from the spin column and suspend the DNA in buffer for future use.

• Chop tissues and add detergents (disrupt cell membranes), proteinase K, and heat.

• Small “Spin Columns” contain DNA-binding material with small holes.

• Columns bind DNA, other cellular debris washes through column.

• “Elute” the DNA, or remove it from the column.

Lab 2:Copying the DNA Barcoding

Gene Using Polymerase Chain Reaction (PCR)

1. Obtain samples.2. Extract the DNA.3. Copy your gene.4. Make sure you copied your gene.5. Obtain DNA sequence data.

• Obtain samples• Purify the DNA• Copy your gene• Make sure you copied

your gene• Obtain DNA sequence

data

• Aquarium, zoo, grocery• Lab 1: DNA Purification• Lab 2: Polymerase Chain

Reaction • Lab 3: Agarose Gel

Electrophoresis• Lab 4: PCR Purification and

DNA Sequencing

From Samples to Sequences

The Power of PCRNumber of PCR Cycles (n) Copies of DNA (2n)

0 11 22 43 84 165 326 647 1288 2569 512

10 102420 1,048,57630 1,072,741,824

PCR Ingredients

1. DNA “template” Your purified DNA sample

2. Taq Polymerase Heat-stable DNA polymerase

3. Deoxynucleotides (dNTPs) Building blocks of DNA

4. Primers Small pieces of DNA bind to your gene

5. Buffer and water Maintain pH of reaction

PCR Tube & Bead

1.7 ml Microfuge Tube

Genetic Researchers Developed Primers for DNA Barcoding

Pool COI-2: mammals, fish and insects

Pool COI-3: amphibians, reptiles and mammals

Credit: Ivanova et al. 2007. Universal primer cocktails for fish barcoding. Mol Ecol Notes.

LAB 3:DID YOUR PCR WORK?

Analyzing PCR Results with Agarose Gel Electrophoresis

1. Obtain samples.2. Extract the DNA.3. Copy your gene4. Make sure you copied your gene.5. Obtain DNA sequence data.

• Obtain samples• Purify the DNA• Copy your gene• Make sure you copied

your gene• Obtain DNA sequence

data

• Aquarium, zoo, grocery• Lab 1: DNA Purification• Lab 2: Polymerase Chain

Reaction • Lab 3: Agarose Gel

Electrophoresis• Lab 4: PCR Purification and

DNA Sequencing

From Samples to Sequences

Agarose Gel ElectrophoresisMolecular Weight

Standard (DNA of Known Sizes)

1 2 3 4 5 6 7 8 9 10

Samples of DNA

2000 bp

1000 bp750 bp

Lanes:

5000 bp

Agarose Gel Electrophoresis

1. Make the agarose gel.

2. Prepare your sample.

3. Load your sample on the gel.

4. Run the gel.

5. Visualize the gel.

Agarose Gel Electrophoresis

1. Make the agarose gel.

2. Prepare your sample.

3. Load your sample on the gel.

4. Run the gel.

5. Visualize the gel.

Teeth in comb make wells

Tape or gaskets at top and bottom of mold

Gel mold

Agarose melted in buffer to pour in mold

Agarose Gel Electrophoresis

1. Make the agarose gel.

2. Prepare your sample.

3. Load your sample on the gel.

4. Run the gel.

5. Visualize the gel.

• 10 l of DNA• Loading Buffer

– 6X concentrated– Adds blue color– Usually contains

glycerol (helps samples “sink” into wells”)

Agarose Gel Electrophoresis

1. Make the agarose gel.

2. Prepare your sample.

3. Load your sample on the gel.

4. Run the gel.

5. Visualize the gel.

Top: Positive Electrode

Bottom: Negative Electrode

Samples in blue dye loaded into wells to top of gel

Agarose Gel Electrophoresis

1. Make the agarose gel.

2. Prepare your sample.

3. Load your sample on the gel.

4. Run the gel.

5. Visualize the gel.

Power Supply

Gel Box & Gel

ElectrodesRed = PositiveBlack = Negative

Voltage/Amps

Agarose Gel Electrophoresis

1. Make the agarose gel.

2. Prepare your sample.

3. Load your sample on the gel.

4. Run the gel.

5. Visualize the gel. Separating pieces of DNA based on size.

1 2 3 4 5 6

Molecular Weight Standard

1000 bp

750 bp

500 bp

60 ng DNA

25 ng DNA

25 ng DNA

Size Amount

Agarose Gel Electrophoresis

1. Make the agarose gel.

2. Prepare your sample.

3. Load your sample on the gel.

4. Run the gel.

5. Visualize the gel.

Ethidium Bromide & UV Light

Fast Blast™ Stain & Visible (White) Light

Preparation of PCR Samples for DNA Sequencing

1. Obtain samples.2. Extract the DNA.3. Copy your gene.4. Make sure you copied your gene.5. Obtain DNA sequence data.

• Obtain samples• Purify the DNA• Copy your gene• Make sure you copied

your gene• Obtain DNA sequence

data

• Aquarium, zoo, grocery• Lab 1: DNA Purification• Lab 2: Polymerase Chain

Reaction • Lab 3: Agarose Gel

Electrophoresis• Lab 4: PCR Purification

and DNA Sequencing

From Samples to Sequences

Sanger Method of DNA Sequencing1. DNA “template”Your purified PCR sample

2. Taq polymeraseHeat stable DNA polymerase

3. Deoxynucleotides (dNTPs) and Dideoxynucleotides (ddNTPs)

Building blocks of DNA. The ddNTPs stop the reaction at random points.

4. PrimersSpecific for your gene of interest

5. Buffer and water

Image Source: Enzo at Polish language Wikipedia, Wikimedia Commons.

PCR Purification1. Mix the PCR product with a

DNA Binding Buffer.

2. Separate the PCR product from the rest of the PCR reaction using a spin column.

3. Elute PCR from the spin column.

1. Mix

2. Bind & Wash

3. Elute