Virologic, antigenic and genet characterization of chicken a and development of a new serol method その他(別言語等) のタイトル 鶏貧血ウイルスのウイルス学的,抗原学的および遺 伝学的特徴づけと新しい血清学的検査法の開発 著者(英) Trinh Quang Dai 学位名 博士(畜産衛生学) 学位授与機関 帯広畜産大学 学位授与年度 2015 学位授与番号 10105甲第66号 URL http://id.nii.ac.jp/1588/00001382/
124
Embed
Virologic, antigenic and genetic characterization of ...
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Virologic, antigenic and geneticcharacterization of chicken anemia virus (CAV)and development of a new serologic diagnosticmethod
1) Virus neutralization test was performed using the α–neutralization procedure described in the Materials and methods; 2) Genetic clusters were shown in Fig. 1.3a; 3) Amino acid profiles were shown in Fig. 1.3b; 4) NI: non-identified.
39
Fig. 1.1a. Viral protein expression kinetics in CAV A2/76–infected MSB1 cells.
Immunofluorescent antibody tests were conducted to detect antigens using semi-purified
mAbs (MoCAV/F2, F8, F11, E6) at 3 µg/ml and a rabbit serum anti–VP1 peptide (1:200).
Mouse normal ascitic fluid was used as a negative control (not shown). Cell nuclei were
counterstained with DAPI. Infected cells were collected at 12, 24, 36, and 60 hpi and used
as antigens. Scale bar = 10 µm.
MoCAV/F2
MoCAV/F11
MoCAV/E6
Anti-VP1 peptide
MoCAV/F8
DAPI
12 hpi 24 hpi 36 hpi 60 hpi
40
Fig. 1.1b. Co–staining of A2/76–infected MSB1 cells with mAbs. The infected cells were
stained with ascitic fluids containing a neutralizing mAb (MoCAV/F11) (1:100) and a non–
neutralizing mAb (MoCAV/E6) (1:100), and then with IgG isotype–specific secondary
antibodies labeled with rhodamine for MoCAV/F11, and with FITC for MoCAV/E6.
Infected cells collected at 36 hpi were used as antigens. Cell nuclei were counterstained
with DAPI. The fluorescent signals were observed under the confocal microscope.
MoCAV/F11 Merge
MoCAV/E6 DAPI
41
Fig
. 1.
1c.
Imm
unop
reci
pita
tion
ana
lysi
s of
A2
/76
-infe
cte
d M
SB
1 ce
lls.
The
inf
ecte
d or
uni
nfec
ted
cel
l ly
sate
s co
llect
ed
at
48
hpi w
ere
bio
tin-la
bele
d an
d im
mun
opre
cip
itate
d w
ith m
Abs
aga
inst
CAV
and
aga
inst
influ
enz
a A
vir
us n
ucle
opro
tein
(N
P).
The
imm
uno
pre
cipi
tate
d sa
mpl
es
we
re a
naly
zed
by S
DS
-PA
GE
, an
d th
en
the
bio
tin-l
abe
led
prot
ein
s w
ere
tra
nsf
err
ed
from
a g
el t
o
a n
itroc
ellu
lose
me
mb
rane
. B
iotin
-la
bele
d vi
ral
pro
tein
s w
ere
de
tect
ed
by a
str
ept
avi
din-
hors
era
dish
con
juga
te a
nd v
isua
lize
d
with
the
ch
emilu
min
esc
ent
sub
stra
te.
M:
mol
ecul
ar-
we
ight
sta
nda
rd.
Se
mi-p
urifi
ed
mA
bs
F2
(MoC
AV/F
2),
F8
(M
oCAV
/F8)
,
F11
(M
oCAV
/F11
), E
6 (M
oCAV
/E6)
, a
nd
NP
(ne
gativ
e c
ont
rol)
we
re u
sed
to i
mm
unop
reci
pita
te v
iral
prot
ein
s in
inf
ecte
d
cells; F2 M
SB1, F8 M
SB1, F11 M
SB1, E
6 M
SB
1,
and
NP
MS
B1
indi
cate
the
tre
atm
ent
of
unin
fe
cte
d ce
lls w
ith m
Abs
desc
ribe
d a
bove
.
42
MoC
AV/F
2
MoC
AV/F
8
MoC
AV/F
11
Ant
i-V
P1
pept
ide
VP
1-ce
lls
Moc
k-ce
lls
Nor
mal
Asc
itic
fluid
Fig
1.1
d. R
ea
ctiv
ity o
f ne
utra
lizin
g m
Abs
with
re
comb
ina
nt
VP
1 pr
ote
ins e
xpre
sse
d in
CO
S7
cells
. T
he f
ull
-le
ngth
of
the
VP
1
gene
wa
s cl
one
d in
to p
cDN
A3.
1 (+
) ve
ctor
. T
he c
onst
ruct
ed
pcD
NA
3.1
(+)-
VP
1 p
lasm
ids
we
re t
rans
fect
ed
int
o C
OS
7 ce
lls.
IFA
T w
ere
con
duct
ed
usin
g th
e V
P1
exp
ress
ed
cells
with
aci
tic f
luid
s co
ntai
nin
g m
Abs
(M
oC
AV/F
2, F
8, F
11)
(1:
100)
and
ant
i-
VP
1 p
ept
ide
ant
ibod
y (1
:200
) a
t 36
h p
ost
tra
nsfe
ctio
n. T
he m
Ab
MoC
AV/E
6 d
id n
ot r
ea
ct i
n t
he I
FAT
(d
ata
not
sho
wn)
.
Mou
se n
orm
al a
sciti
c flu
id w
as
use
d a
s a
ne
gativ
e c
ont
rol.
Mo
ck c
ells
tha
t w
ere
tra
nsfe
cte
d w
ith p
cDN
A3.
1 (+
) ve
ctor
we
re
als
o us
ed
as
nega
tive
con
trol
. Sca
le b
ar
= 1
0 µ
m.
43
Fig. 1.2. Blocking immunofluorescent antibody tests. Blocking tests were conducted
using semi-purified mAbs (MoCAV/F2, F8, F11 at 5 µg/ml, or E6 at 200 µg/ml) as
competitors and mAbs directly labeled with R-phycoerythrin fluorescein. Infected cells
collected at 36 hpi were used as antigens. Scale bar = 10 µm.
44
Fig. 1.3a. Phylogenic analysis of the complete deduced amino acid sequences of the CAV VP1 protein. (▲) indicated the CAV strains neutralized by MoCAV/F11 (G1/74, KY/80, AO/77, 26P4, A2/76, A1/76, CAA 82–2, G7/91, IBA/94, and NI/92); (■) indicated the CAV strains that did not neutralized by MoCAV/F11 (G5/79, G6/79, NI/77, and HY/80). (●) indicated the current Japanese CAV isolate (HK1/13). Sequences from GenBank are indicated with the country name followed by accession number. The phylogenetic tree was constructed using the maximum likelihood method based on the Poisson correction model for amino acids in MEGA5 software, supported by 500 bootstrap replicates. The scale bar shows the number of base substitutions per site. Three major clusters were identified and designated as clusters I, II, and III.
45
Fig. 1.3b. Comparison of the amino acid residues of VP1 of CAV strains in clusters I, II,
and III. Alignment was conducted with Clustal W. Numbering (70–150) was based on the
Prior to evaluating the specificity of b–LAT, nonspecific agglutination of mAb–beads
by the serum samples in the absence of CAV antigens was examined. Of the 152 undiluted
serum samples tested, 6 sera (3.9%) from SPF chicken showed nonspecific agglutination of
mAb–beads (Table 2.2); however, nonspecific reactions were completely eliminated upon
2–fold dilutions of the serum samples in PBS. Therefore, 2–fold dilutions of the sera were
employed in subsequent experiments.
All the serum samples from SPF chickens and the sera containing antibodies to AIV,
NDV, IBDV, and MDV showed negative results in b–LAT, while 5 chicken antisera to CAV
showed positive results (Table 2.2). In addition, b–LAT with the negative antigens prepared
from the uninfected cells showed negative results for chicken antisera to CAV (data not
shown).
Comparison of b–LAT with VNT and IFAT
To evaluate the usefulness of b–LAT in the detection of antibodies to CAV, a
comparison was made between b–LAT, VNT, and IFAT using sera from 94 layer breeder
chicken (Table 2.3a).
The total incidence of antibody to CAV, as determined using the 3 tests, was found to
be 78.7% (VNT), 72.3% (b–LAT), and 55.3% (IFAT). The incidence of antibody to CAV
54
was not significantly different between b–LAT and VNT, but showed statistically
significant differences between b–LAT and IFAT (P < 0.05).
Antibodies to CAV were detected in serum samples from flock 1 by the 3 tests in all
the chickens at 52 weeks of age, while the incidence of CAV antibody using IFAT (31.5%)
was significantly lower as compared to that using VNT (100%) and b–LAT (89.4%) in 63–
week–old chickens (P < 0.05). Similarly, in 48–week–old chickens of flock 4, the incidence
of antibody to CAV using IFAT (50%) was found to be significantly lower as compared to
that using VNT (100%) and b–LAT (77.7%) tests (P < 0.05).
The results of VNT and b–LAT tests showed 93.6% agreement (Kappa value = 0.82;
Table 2.3b). The sensitivity of b–LAT in comparison with VNT was 91.8% (95%
confidence interval [CI]: 83.4%–96.2%). In contrast, the results of IFAT and b–LAT
showed 78.7% agreement (Kappa value = 0.55; Table 2.3c). The sensitivity of IFAT in
comparison with b–LAT was 76.4% (95% CI: 65.1%–84.9%).
In contrast, the results of VNT and IFAT showed 76.5% agreement (Kappa value =
0.50; data not shown). The sensitivity of IFAT in comparison with VNT was 70.2% (95%
CI: 59.0%–79.4%; data not shown).
Use of b–LAT for the serological examination of breeder chicken flocks with CAV–
induced diseases among their progeny
As shown in Tables 2.1 and 2.4, in Farm 1 (flocks A and B), CAV vaccination was not
performed, and the CAV–induced disease was recorded among the progeny of these
breeder chickens at the age of approximately 240 (flock A) and 218 (flock B) days. Each
10 serum samples collected from breeder flocks A (103 days old) and B (116 and 180 days
old) prior to the incidence of CAV–induced disease among their progeny were all found to
55
be negative for CAV antibodies using b–LAT (Table 2.4). However, seroconversion to
CAV−positive was detected in each 10 serum samples collected from flocks A and B when
the chickens were examined at 270 days old (flock A) and 259 days old (flock B) after
CAV vertical transmission to their progeny ceased. The positive results obtained by b–LAT
were supported by IFAT analysis that indicated the high antibody incidence (higher than
70%) as shown in Table 2.4.
The serum samples of chickens inoculated with CAV vaccines at 70 days old in flock
C of Farm 2 were collected at 240 and 481 days old after the vertical transmission of CAV
to their progeny ceased (Tables 2.1 and 2.4). The results showed that the serum samples
were positive for antibodies to CAV by both b–LAT and IFAT.
2.4. Discussion
VNT is known to be the most specific, sensitive, and reliable serological test (Otaki et
al., 1991; Yuasa et al., 1983b) for the detection of antibodies to CAV. However, the test is
laborious and time–consuming, requiring as many as 7–9 passages of cells for completion
(Schat and van Santen, 2008). In contrast, IFAT is not as sensitive as VNT for the detection
of antibodies in older chickens (Imai et al., 1993) and showed nonspecific staining,
particularly with the use of a lower dilution of the serum (Otaki et al., 1991). Therefore,
well–trained observers are required for differentiating specific results from nonspecific
ones. In addition, both VNT and IFAT are unsuitable for testing a large number of serum
samples. ELISA has a distinct advantage in this aspect (Lamichhane et al., 1992; Tannock
et al., 2003; Todd et al., 1990b, 1999); however, ELISA is also laborious and time–
consuming both for setting–up and for completion. Commercial ELISA kits are available
for the detection of antibodies to CAV, albeit not in Japan; however, instances of false–
56
positive or false–negative results have been reported (Michalski et al., 1996; Tannock et
al., 2003). All these tests require specialized equipment or facilities.
In the present study, b–LAT was developed for the detection of antibodies to CAV in
order to overcome the drawbacks of the currently available serological tests. This test is
based on the principle that serum (antibody) from CAV–infected chicken blocks the
binding of CAV antigens to mAb–beads. The b–LAT test does not require specialized
equipment, and appears to be advantageous in terms of simplicity and speed as compared
to IFAT, VNT, or ELISA. The results of b–LAT are obtained within minutes. Therefore, b–
LAT is readily utilizable under field conditions.
Nonspecific reactions, often observed in serological tests performed for detecting
antibodies in sera, are likely to lead to erroneous diagnoses. In this study, a very low
incidence of nonspecific agglutination of mAb–beads in the absence of CAV antigens was
observed with the use of undiluted sera from SPF chicken. However, nonspecific
agglutination disappeared when 2–fold dilution of the chicken sera was used (Table 2.2). In
addition, nonspecific reaction and cross–reactivity were not observed upon analysis of sera
from SPF chicken and sera including antibodies to AIV, NDV, IBDV, or MDV using b–
LAT, with positive results obtained only with antisera to CAV. These results indicate the
high specificity of b–LAT for the detection of antibodies to CAV in chicken serum.
VNT and b–LAT showed significantly higher sensitivity for the detection of antibodies
to CAV as compared to that by IFAT, although this difference in sensitivity was observed
only with older chickens (Table 2.3a). The results of b–LAT and VNT were in good
agreement (93.6%) with a Kappa value of 0.82 (Table 2.3b), which could be weighted into
the category of almost perfect agreement (Kappa = 0.81–0.99; Viera and Garrett (2005)).
Because a neutralizing mAb was employed in b–LAT, the antibody detected in serum
57
samples by the test likely corresponds to the neutralizing antibody found in the sera of
CAV–infected chickens. Moderate agreement was observed between the results of b–LAT
and IFAT (Kappa value = 0.55; Table 2.3c).
The vertical transmission of CAV from breeder flocks to their progeny has been
known to play a major role in CAV infections in young chicks. Antibody–negative breeders
could be infected with CAV by horizontal transmission or the semen of infected cocks
during the laying period (Chettle et al., 1989; Hoop, 1993; Yuasa et al., 1987). Vertical
transmission of CAV was observed 8–14 days following the infection of hens under
experimental conditions (Hoop, 1992; Yuasa and Yoshida, 1983). In the present study, the
applicability of b–LAT in the diagnosis of field CAV cases was evaluated. CAV antibodies
were not detectable in sera collected from breeder chicken of flocks A and B in Farm 1
prior to the occurrence of CAV–induced diseases (Table 2.4); this observation also
indicates good health management programs in the farm. After the occurrence of CAV–
induced disease, the results in b–LAT clearly showed the seroconversion of tested breeder
chickens to CAV–positive, which was also supported by IFAT results. This finding
demonstrates the suitability of b–LAT for serological diagnosis in the field.
CAV vaccination of breeder flocks has been successfully employed for the prevention
of vertical transmission of the virus to progeny chicks (Schat and van Santen, 2008).
Although breeder chickens of Farm 2 were vaccinated at the age of 70 days, severe CAV–
induced diseases in their progeny resulted from the vertical transmission of the virus from
these breeders. This observation raises the question of why progeny chicks from the
vaccinated breeders remained susceptible to CAV infection. Two different scenarios, such
as antigenic mismatching of the vaccine strain to CAV isolate or failure of vaccination
procedure, could explain this situation. First, the antigenicity of the CAV strain that
58
infected the breeder chickens could have been different from that of the vaccine strain;
however, the reactivity of the CAV strain (HK1/13) isolated from the diseased chicks was
not different from the polyclonal antibody raised against the A2/76 strain (data not shown),
and amino acid properties of the strain (GenBank accession no. KJ126838) were
comparable with those of the other reported strains (Trinh et al., 2015). It has been reported
that antigenic differences were not observed among CAV isolates using chicken polyclonal
antibodies (McNulty et al., 1990a; Yuasa and Imai, 1986). Second, the vaccine was not
adequately inoculated using the route that the vaccine company recommends (personal
communication). Therefore, the incidence of CAV–associated diseases among the progeny
of the vaccinated breeders was most likely due to the failure of vaccination procedures.
In conclusion, it is emphasized that serological monitoring of breeder flocks for CAV
infection is important prior to the laying period in order to protect chicks from vertical
transmission of CAV and for ensuring the CAV–free status of SPF chicken flocks. The
results of b–LAT developed in the present study were in almost complete agreement
(93.6%, Kappa value = 0.82) with those of VNT, known to be the most specific and
sensitive test for the detection of antibodies to CAV, and moreover, could be obtained
within 5 min. Thus, the simple, rapid, highly specific, and sensitive b–LAT technique is
expected to have a potentially high application in CAV serology.
2.5. Summary
A b–LAT developed in this study was evaluated for the detection of antibodies against
CAV in chickens. Polystyrene latex beads were coupled with a neutralizing mAb to CAV
(mAb–beads), and when mixed with antigens prepared from the lysate of MSB1 cells
infected with CAV resulted in agglutination. A short pre–incubation of CAV antigens with
59
CAV–specific antiserum inhibited the agglutination of mAb–beads. The test results were
obtained within 5 min. The specificity of b–LAT was evaluated using sera from SPF
chickens and sera containing antibodies to AIV, NDV, IBDVs, and MDV; nonspecific
agglutination and cross–reactivity with antibodies to unrelated viruses were not observed.
The examination of 94 serum samples collected from commercial breeder chickens of
various ages (17–63 weeks) revealed good agreement (93.6%, Kappa value = 0.82)
between b–LAT and a VNT, known to be most sensitive and specific in the detection of
antibodies to CAV. These results indicate that b–LAT, a simple and rapid test, is a useful
and reliable tool in CAV serology.
60
Table 2.1. Field chicken serum samples used in this study
Serum samples Remarks
Source Age at sampling
No. of samples
Sera from 4 breeder farms without CAV problems in Japan
Flock 1 19, 52 and 63
weeks1) 10, 19,
19
No outbreak of CAV−induced diseases in the progeny of breeders
Flock 2 25 weeks 18
Flock 3 17 weeks 10
Flock 4 48 weeks 18
Sera from 2 breeder farms with CAV problems in Japan
Farm 1
Flock A 103 and 270
days 10 each
The outbreak in the progeny of breeders at 240 days of age
Flock B 116, 180 and
259 days 10 each
The outbreak in the progeny of breeders at 218 days of age
Farm 2
Flock C2)
240 and
481 days 10 each
Vaccination in breeders at 70 days of age Sampling after the outbreak in the progeny3)
1) Sera were periodically collected from the same individual chickens of Flock 1.
Detailed information about the flocks was described previously (Imai et al., 1993). 2) Flock C contained 3 groups of chickens with different ages (196, 448, and 476 days), and
sampling was conducted in 2 age groups except the oldest age group after CAV-induced
disease ceased. 3) It was not identified which age group was responsible for vertical transmission to the progeny.
61
Table 2.2. Evaluation of the specificity of b–LAT
Origin of serum No. of serum
samples
Non–specific agglutination 1) No. of antibody–
positive serum samples Dilution of serum
1:1 1:22)
SPF chicken serum 107 6 0 0
Chicken antiserum to AIV 10 0 0 0
Chicken antiserum to NDV 15 0 0 0
Chicken antiserum to IBDV 5 0 0 0
Chicken antiserum to CAV 5 0 0 5
Positive chicken serum to MDV3)
10 0 0 0
1) PBS was used instead of CAV antigens; 2) Dilution in PBS; 3) The serum samples were
collected from breeder chickens vaccinated with MDV vaccine.
62
Table 2.3a. Comparison of the incidence of CAV antibody in sera from field chicken using VNT, IFAT, and b–LAT
Flock 4 (48 weeks old) 18/18 (100.0) a 9/18 (50.0) b 14/18 (77.7)a
Total 74/94 (78.7%) a5) 52/94 (55.3%) b 68/94 (72.3%) a 1) and 2) data from the report previously described (Imai et al., 1993) 3) No. of positives/no. of sera examined 4) Data within flocks followed by a different superscript letter were significantly different
(P < 0.05) 5) Data of the total incidence of CAV antibody followed by a different superscript letter were significantly different (P < 0.05)
63
Table 2.3b. Agreement in antibody detection between b–LAT and VNT
VNT b–LAT No. of serum
samples Agreement (%) Kappa value
+1) + 68
93.6 0.82 −2) − 20
+ − 6
− + 0
Total 94 1) +: Positive result; 2) −: Negative result
64
Table 2.3c. Agreement in antibody detection between b–LAT and IFAT
IFAT b–LAT No. of serum
samples
Agreement (%)
Kappa value
+1) + 50
78.7 0.55 −2) − 24
+ − 2
− + 18
Total 94 1) +: Positive result; 2) −: Negative result
65
Table 2.4. Detection of CAV antibodies in breeder chicken flocks with the outbreak of CAV−
induced diseases
Farm Chicken flocks1)
(Age at serum collection)
Vaccination
Antibody detection
Serum collection time
before or after the outbreak of
CAV−induced diseases b–LAT IFAT
1
Flock A (103 days) No 0/102) nt3) Before
(270 days) 10/10 7/10 After
Flock B (116 days) 0/10 nt Before
(180 days) 0/10 nt Before
(259 days) 10/10 10/10 After
2 Flock C
(240 and 481 days)
Yes
(70 days old) 20/20 20/20 After
1) CAV–induced diseases were observed in the progeny of the breeder chickens at the age of approximately 240 (Flock A) and 218 (Flock B) days. Flock C contained 3 groups of chickens with different ages (196, 448, and 476 days), and sampling was conducted in 2 age groups except the oldest age group after CAV-induced disease ceased as shown in Table. However, it was unidentified which age group was responsible for CAV vertical transmission. 2) No. of positives/ no. of sera examined 3) Not tested.
66
Chapter III
Isolation and preliminary characterization of chicken anemia virus
circulating in Vietnam
3.1. Introduction
It has been believed that there is no difference in antigenicity among CAV isolates,
suggesting that a single serotype was present among them (McNulty et al., 1990a; Yuasa
and Imai, 1986). However, the USA isolate CAIV–7 showed the antigenicity distinct from
a CAV representative Del–ros strain despite of its CAV–like pathogenic and
physicochemical characteristics (Spackman et al., 2002a and 2002b). Therefore, new
serotypes or subtypes of CAV that are present in the field might not be excluded.
In addition, Zhang et al. (2012) reported that a virus isolated from the human fecal
sample in China is likely to be originated from infected chickens because the sequence
identity seen between this isolate and CAV isolated from chicken meat ranged from 97.0%
to 99.7% in the genes coding 3 viral proteins (VP1, VP2 and VP3) of CAV. This suggests
that CAV might be transmitted to humans through consumption of infected chicken meat or
chicken products; however, human health under threat of CAV infection remains unclear.
Therefore, continuously monitoring of CAV infection is not only important for protection
of infection in chickens, but also useful to obtain information related to public health.
Vietnam is a developing country based on agriculture, in which livestock production
contributes about 26.3% of agricultural GDP (Vietnam general statistic office, 2013). With
increasing the rearing of animals, 315 million poultry, 26.2 million pigs and 7.7 million
cattle at the present time, the livestock products have been serving largely consumer
67
demand. However, the growth of livestock production has also caused the prevalence of
many infectious diseases including zoonotic and food–borne ones throughout the country.
In the recent years, several serious animal infectious diseases such as highly
pathogenic avian influenza or foot–and–mouth disease are considered as the major losses
for both livestock industrial sectors and small–scale stakeholders in Vietnam. Although
CAV is an economically important pathogen worldwide in poultry industry, there is almost
no information related to this topic in Vietnam. The isolation of CAV and detection of
antibody to the virus have not been described, as far as I know. However, CAV vaccination
is being conducted in some breeder farms. Therefore, there is the need to reveal actual
situation of CAV in poultry flocks in Vietnam, if any, which would help to devise a
suitable control strategy to prevent losses in poultry industry.
In this study, I describe the presence of CAV in chicken flocks and LBMs in Hanoi
and surrounding provinces. I attempted to isolate CAV, detect viral genes, and detect
antibodies to the virus from chicken samples. To the best of my knowledge, this is the first
description of the presence of CAV circulation in Vietnam.
3.2. Materials and methods
Samples
Antisera to CAV strains, A2/76, NI/77 and G6/79, produced in SPF chickens were
kindly provided by the NIAH, Japan.
Sera collected from field chickens were kindly provided by NIVR in Hanoi, Vietnam.
Seventy−four sera were collected from 16 flocks with 4–6–week–old chickens in the Hanoi
and Hanam Provinces in 2013. Sera were also collected from 237 chickens with older than
8 weeks old from 4 LBMs in Hanoi in 2013 (Table 3.1).
68
A total of 51 samples of spleen or liver were collected from chickens with younger
than 6 weeks old (Table 3.2), and 21 of which were collected from unknown diseased
chickens during 4 months from September to December, 2013, and were sent to the
DABACO Veterinary Diagnosis Centre (DVDC) Corporation in Bacninh Province. The
thirty tissue samples were collected from healthy broiler chickens of 4 farms located in
Hanam, Hanoi, Hungyen, and Vinhphuc Provinces in December, 2013. In each flock farm,
2–4 chickens were randomly selected for sampling. All of samples were collected from
chickens that originated from non–CAV vaccinated breeder chickens.
Tissue samples were homogenated in virus transfer medium, which contains
Dulbecco's modified Eagle's medium (Nissui Pharmaceutical Co., Ltd) including penicillin
G (final concentration of 1000 U/mL), streptomycin (1 mg/mL), gentamycin (100 µg/mL),
and amphotericin B (10 µg/mL), to prepare 10% homogenates. The homogenates were
stored at −20°C until use.
b–LAT
A b–LAT was conducted as described in chapter II to detect CAV antibody in chickens.
In brief, a mixture containing 5 µl of CAV antigens and an equal volume of Vietnamese
field chicken serum was incubated at room temperature for 15 min. Subsequently, 5 µl of
mAb–beads was mixed on a plastic surface with an equal volume of the mixture of CAV
antigens and chicken serum. The resulting mixture was then spread as a circle with a
diameter of approximately 1 cm, followed by gentle agitation for 5 min. The results were
scored as antibody–positive (no agglutination of mAb–beads) or negative (agglutination of
mAb–beads).
69
Virus isolation
Virus isolation was conducted in MSB1 cells as described (Yuasa et al., 1983a).
Briefly, 0.5 ml of MSB1 cells (2x105 cells/ml) was inoculated with 0.1 ml of a 10% liver or
spleen homogenate in a 24 well−plate. The inoculated cells were subcultured every 2−3
days for 10 passages, in which 0.1 ml of the cell suspension was transferred to a new well
including 0.5 ml of GM. The cultures showing red color (no cell growth) due to CPE were
regarded as CAV–positive (Yuasa, 1983). The isolation of CAV was verified using PCR
and IFAT as described below.
Virus titration
The virus titer of the CAV isolates were determined in MSB1 cells by a microtest
method (Imai and Yuasa, 1990) as described in the subsection of Cell culture in Materials
and methods of chapter I. Briefly, 20 µl of a 10–fold serially diluted virus solution was
added to wells of a 96–well microplate containing 200 µl MSB1 cells (2 × 105 cells/ml) in
GM. The inoculated cells were passaged every 3 days. The wells without virus growth
were determined after 8 passages. The cultures showing red color (no cell growth) due to
CPE were regarded as CAV–positive (Yuasa, 1983). Virus titers were quantified as the
TCID50 by the Behrens–Kärber method (Behrens and Kärber, 1934).
IFAT
IFAT (Yuasa et al., 1985) was used to confirm CAV isolation in MSB1 cells inoculated
with the homogenates as described above. In brief, MSB1 cells (1x106 cells/ml) were
inoculated with the supernatant of the MSB1 cells showing CPE. After 36 hpi, the infected
cells were harvested by centrifugation at a low speed, and were smeared on a microscope
70
slide, dried, and fixed with cold acetone for 10 min. The slides containing CAV–infected
cells were incubated with antisera to A2/76 at the dilution of 1:40, and then with FITC–
conjugated rabbit anti–chicken IgG (Rockland, Gilbertsville, PA) at 37ºC for 30 min each.
Observation was conducted under a fluorescence microscope (Biorevo BZ–9000, Keyence)
for the measurement of fluorescent signal.
VNT
VNT was performed according to the alpha–neutralization procedure (Imai and Yuasa,
1990). Briefly, 10–fold stepwise dilutions of CAV were mixed with chicken antiserum to
CAV (1:100) or GM (virus control), and then the mixtures were incubated overnight at
4°C. Afterward, 20 µl of each mixture was inoculated to each of 4 wells with 200 µl of
MSB1 cells (2 × 105 cells/ml). The inoculated cells were passaged every 3 days. The virus
titer of the mixture was determined as described above, and the neutralizing index was
calculated based on the differences of virus titers (log10 TCID50) between the mixtures with
chicken antiserum and the virus control.
Antisera to CAV isolated in Japan, A2/76, NI/77 and G6/79, were kindly provided by
NIAH.
DNA extraction, PCR and real–time PCR
DNA was extracted from 10% liver or spleen homogenates, or CAV–infected MSB1
cell culture fluids using a QIAamp DNA Mini kit (QIAGEN) in accordance with the
manufacture’s instructions. Extracted DNA was stored at ̶ 20℃ until use.
The extracted DNAs were examined for CAV DNA using PCR with partial VP1 gene
specific primers, CAV–954F: 5’–TCGGAAGAGACAGCGGTATCG–3’ and CAV–1246R:
71
5’–AGACCCGTCCGCAATCAACTC–3’(a product size of 292–bp). PCR amplification
was carried out using a TaKaRa Ex Taq kit (Takara Bio Inc.) using the following cycling
profile: initial denaturation of 94°C for 5 min, followed by 35 cycles of denaturation,
annealing and extension at 94°C for 30 sec, 50°C for 30 sec and 72°C for 1 min,
respectively, and the final extension was carried out at 72°C for 10 min. The PCR products
were then analyzed by 2% agarose gel electrophoresis and imaged under the UV.
Real−time PCR for detection of CAV VP2 gene using a commercial kit (The
PrimerDesign™ Kit for Chicken anemia virus, Genesig) was used to confirm the presence
of CAV DNA in samples.
Amplification of coding regions of CAV genes
The positive viral DNAs were amplified to obtain the complete nucleotide sequence of
CAV by two pairs of primers, CQ1F/R and CQ2F/R (Zhang et al., 2013). PCR
amplification was carried out in a 20 µl volume using a TaKaRa Ex Taq kit using the
following cycling profile: initial denaturation of 94°C for 5 min, followed by 35 cycles of
denaturation, annealing and extension at 94°C for 30 sec, 58°C for 30 sec and 72°C for 2
min 30 sec, respectively, and the final extension was carried out at 72°C for 10 min. PCR
products including 1,778 and 831 bp fragments were purified using a GENECLEAN® II
Kit (MP Biomedicals). The purified DNAs were then used as template for nucleotide
sequencing.
Nucleotide sequencing and phylogenetic analysis
Nucleotide sequences of Vietnamese CAV-positive DNAs were determined by using a
BigDye Terminator v3.1 cycle sequencing kit according to the manufacture’s instruction
72
(Life Technologies). Nucleotide sequencing was performed using Applied Biosystems
3500 Genetic Analyzer (Life Technologies).
Nucleotide sequences obtained in this study were analyzed using GENETYX ver. 10
software (GENETYX Corp., Tokyo, Japan) and compared with other sequences available
in GenBank using the BLAST program. The nucleotides and translated aa sequences were
aligned by Clustal W (Thomson et al, 1994). Phylogenetic trees were constructed using the
Maximum likelihood method and bootstrap analysis (500 replicates) using MEGA6
(Tamura et al., 2013).
3.3. Results
Serological surveillance of CAV infection in chickens
To examine the prevalence of CAV in Vietnam, 311 serum samples randomly collected
from 4–6–week–old chickens from 16 flocks located in Hanoi and Hanam Provinces, and
from chickens of older than 8 weeks of age from 4 LBMs in Hanoi, were analyzed by b–
LAT (Table 3.1).
Only 2.7% (2/74) of the serum samples from 4–6–week–old chickens and 70.4%
(167/237) of the samples from chickens of older than 8 weeks age were positive for
antibody to CAV. Totally, 54.3% (169/311) of chicken serum samples were positive for
antibody to CAV. In b–LAT, 4.5% (14/311) of chicken serum samples showed unclear
agglutination, which was regarded as “suspected case (result)”.
Detection of CAV genes
In PCR, 10 DNA samples obtained from the 51 tissue samples showed the positive
result for CAV genes (19.6%). These 10 positive cases included the 5 chicken samples
73
provided by DVDC in Bacninh Province (sample nos. BN1, BN2, BN5, BN11, and BN16),
which was recorded as unknown disease cases, and the remaining 5 samples (sample nos.
HN1, VP7, VP8, VP9, and VP10) from healthy chickens in 2 different provinces, Hanoi
and Vinhphuc (Table 3.2). However, PCR for the 4 DNA samples originated from DVDC
showed unclear results because weak bands of PCR products were observed in the stained
gel. These samples were confirmed to be positive for CAV genes by real–time PCR (data
not shown).
Isolation of CAV
The 3 homogenates, sample nos. VP7, VP8, and VP9 positive for CAV genes, were
applied to virus isolation using MSB1 cells. As the result, the 2 isolates were successfully
obtained and were designated as VP8/13 and VP9/13. The CAV isolation was confirmed
by PCR and IFAT (data not shown), and then these isolates were applied to virological
characterization. I failed to isolate CAV from the sample no. VP7, although attempts to
isolate CAV from this homogenate were repeated twice.
Both isolates grew well in MSB1 cells with the titers ranging from 7.0 to 7.25
TCID50/ml. Cross−VNT was conducted to examine antigenicity of the Vietnamese isolates
in comparison with that of the reference CAV strains (A2/76, NI/77, and G6/79). The
neutralizing index of CAV antisera against VP8/13 and VP9/13 ranged from 4.5–5.0
(Table 3.3).
Genetic and phylogenetic analysis
The full–length nucleotide sequences (1,823 bp) of the coding region for VP1 (1,350
bp), VP2 (651 bp), and VP3 (366 bp) genes of 6 out of the 10 PCR positive samples were
74
obtained by direct sequencing. These sequences contained no insertions or deletions.
Sequence information was deposited in GenBank under the accession numbers from
KP780287 to KP780292 (Table 3.4).
Genetic analysis of the 6 Vietnamese CAV gene sequences showed 96.21 % to
100.0 % in homology. The lowest nucleotide identity (96.21%) was observed between the
nucleotide sequences of VP7 and VP8 or VP9, and the highest nucleotide identity (100.0%)
was between BN1 and HN1, and VP8 and VP9. Among the 6 sequences, BN1, HN1, VP8,
and VP9 share the highest nucleotide identities with the Taiwanese CAV gene sequence,
isolate 7 (Accession number KJ728818), while VP7 and VP10 were most closely related to
the Taiwanese CAV gene sequence, isolate 18 (Accession number KJ728827) (Table 3.4).
Alignment of the aa sequence of VP1, which encodes the capsid protein, of the 6
Vietnamese CAV sequences with other sequences available in GenBank database was
conducted. The 12 aa positions (22, 75, 97, 125, 139, 144, 287, 290, 370, 376, 394, 413),
which are the most variable aas between CAV VP1 sequences, were detected in these 6
Vietnamese sequences without any specific aa difference in comparison with those of the
reported sequences. The VP1 aa sequences of BN1, HN1, VP8, and VP9 possessed a V75,
M97, K139, E144 aa profile, whilst VP7 and VP10 had a distinguished aa profile of I75,
L97, Q139, Q144. All the 6 sequences contained Q at position 394 (Q394). In addition, all
of the Vietnamese CAVs have aa profiles that are different from the profile of vaccine
strains of 26P4, Cux-1, and Del–ros (Table 3.5).
Phylogenetic analysis of the full–length gene of the coding regions of Vietnamese
CAVs indicated that the Vietnamese sequences were separated into 2 distinct genotypes.
The 4 Vietnamese sequences, BN1, HN1, VP8, and VP9, fell into Genotype III, and
formed a subgroup with the isolates from Taiwan (isolates 7 and 13) and China (GD–J–
75
12). On the other hand, the 2 sequences, VP7 and VP10, were classified within Genotype II
with the other isolates reported in different geographic areas including Asia, North and
South America, and Oceania (Fig. 3.1).
3.4. Discussion
It has been reported that CAV causes economic losses in poultry industry in many
countries (McNulty, 1991). Therefore, revealing the prevalence of CAV in the field is
important for creating effective prophylactic strategy to minimize the risk of CAV infection
for poultry industry. In Vietnam, information about the prevalence of CAV has not been
reported. However, in several large scales of breeder chicken farms, vaccination is being
currently conducted in order to prevent vertical transmission. In this study, we first
demonstrated the presence of CAV in Vietnam by serological, virological and genetical
analysis.
The evidence of CAV infection was shown during a small serological survey with
chicken sera collected from LBMs and field flocks, using the b–LAT described in chapter
II. In the field chicken flock conditions, natural CAV infection usually occurs in chickens
due to horizontal transmission after maternal antibodies diminished around 2 to 4 weeks of
age, and seroconversion in most of the infected chickens needs several weeks (McNulty et
al., 1988; von Bülow, 1988). The present result showed that only a small number of serum
samples (2 of 74) collected from 4 to 6 weeks old chickens in the field were positive in b–
LAT (Table 3.1), which may indicate the early phase exposures to CAV in the flocks. In
contrast, most of serum samples collected from older than 8 weeks old chickens gathered
in LBMs possessed antibodies. It was suggested that CAV transmission among field
chickens in Vietnam appears to occur in a similar way to that in other countries.
76
Furthermore, circulation of CAV in Vietnam was also demonstrated either by the detection
of viral DNA or by virus isolation from chicken tissue samples in 3 out of the 5 examined
provinces (Bacninh, Hanoi, Vinhphuc). These results confirmed the findings obtained by
antibody detection; however, not all of the samples obtained within flock were positive for
CAV gene (data not shown). Since 4–6 weeks old chickens were exposed to CAV when
maternal antibody disappeared, probably by around 3 to 4 weeks of age; therefore, the
number of CAV DNA present in most of the samples of those chickens might be under the
limit of detection.
Investigation on the antigenicity of CAVs isolated in Japan and the U.K. by cross−
IFAT or VNT with chicken antisera to CAV showed no antigenic differences among them
(McNulty et al., 1990a; Yuasa and Imai, 1986). However, immunofluorescent staining with
mAbs demonstrated antigenic differences between some isolates which were
indistinguishable using antisera (McNulty et al., 1990b). In addition, an evidence of a
second serotype of CAV was provided in USA. The isolate CIAV–7 possessed CAV
characteristics such as a small size, high resistance to chemical agents, and inducing
similar syndrome with CAV in chickens (Spackman et al., 2002a and 2002b). However,
the diseases induced by this strain were much milder compared with the reference CAV
strain. Cross–reactivity of chicken antisera and genetic similarity between the reference
and CIAV–7 strains were not found. Thus, the presence of the second serotype of CAV has
not been generally accepted. In the present study, we characterized the first CAVs isolated
from chickens in Vietnam. No antigenic difference among the isolates in Vietnam and
Japan was recognized by VNT with antisera to the reference CAV strains (Table 3.3). This
result would imply that CAV belongs to a single serotype irrespective of geographic
origins.
77
On the other hand, the correlation between the VP1 aa substitutions and growth of
CAV in cell cultures was reported, in which CAVs with the aa Q139 and Q144 profile
poorly grew in cell cultures (Renshaw et al., 1996). However, other research groups
observed a good growth of the strains with the same aa profile tested (Connor et al., 1991;
Krapez et al., 2006). The reason of this discrepancy seen in virus growth of CAV is
unclear. In the present study, I failed to isolate CAV with the aa Q139 and Q144 profile,
while the other 2 CAVs with the aa K139 and E144 profile were successfully isolated in
cell cultures.
Yamaguchi et al. (2001) reported that Q394 of VP1 aa sequence was considered as a
major determinant of viral pathogenicity of CAV, since change of VP1 aa position 394
from Q to H reduced pathogenicity. All of the 6 CAV VP1 aa sequences identified in
Vietnam showed different aa profiles from that of the attenuated vaccine strains (26P4,
Cux-1, Del-ros) as shown in Table 3.5, but the all had Q394. Therefore, the Vietnamese
CAVs may be virulent. Animal study is needed to evaluate the virulence of Vietnamese
CAV strains in chickens.
Genetic analysis of the entire coding region of VP1, VP2, and VP3 genes of the 6
Vietnamese CAV strains revealed high homology (higher than 96%) among them. The
Vietnamese CAVs shared the highest nucleotide identity (higher than 99%) with the
Taiwanese CAVs (Table 3.4). In phylogenetic analysis of these sequences and other CAV
sequences available in GenBank, the presence of 3 genotypes was observed. While
genotype I consists of the sequences of CAVs originated from Australia, genotypes II and
III include the sequences that have a worldwide distribution. Six CAV gene sequences
obtained from Vietnamese chickens were classified into genotypes II and III, indicating the
genetic diversity of CAV circulating in Vietnam. The 4 CAV gene sequences belonging to
78
genotype III were originated from the chickens in 3 different provinces, while the other 2
sequences that were fallen into genotype II were found only in Vinhphuc Province. These
results may suggest that genotype III CAV is widespread in chicken flocks in Vietnam.
However, due to the limited sample size available in the current study, further systematic
surveillances of CAV in chicken flocks may be needed to fully understand the exact
distribution of CAV and its genotypes in Vietnam.
In conclusion, this study provided the first demonstration of the presence of CAV in
Vietnam by the detection of CAV antibodies, and CAV genes, and isolation of virus in
field samples. The circulation of virus was confirmed in 3 out of 4 provinces examined.
There was no difference in the antigenicity of Vietnamese isolates in comparison to that of
the reference CAV strains. Molecular charactization of revealed Vietnamese CAV
sequences fell into 2 different genotypes of CAV, which are the most widely distributed
throughout the world. These results emphasized that CAV is circulating and might be
affecting poultry industry in Vietnam; however, further study is needed to provide actual
data to describe how CAV affects Vietnamese chickens.
3.5. Summary
CAV is a ubiquitous and economical important pathogen causing severe anemia in
young chicks. Although CAV has been detected in many countries with poultry industry,
there has been no information about CAV in Vietnam. In this study, the first detection and
characterization of CAV in chickens in Vietnam was described. CAV antibody was detected
in 70.4% of the samples from chickens of older than 8 weeks age, and that of 2.7% in the
samples from chickens of 4–6 weeks of age. CAV genes were detected in 10 out of the 51
tissue samples from chickens in 4 different provinces in Northern Vietnam by PCR. Result
79
of VNT with antisera to the reference CAV strains showed no antigenic differences
between the 2 Vietnamese isolates that were obtained from MSB1 cells inoculated with
homogenate of tissue samples. The full coding region of 3 viral proteins, VP1, VP2 and
VP3 (1,823 bp) of the 6 CAVs was sequenced and characterized. Phylogenetic analysis
revealed that Vietnamese CAVs were classified into 2 distinct genotypes II and III showing
worldwide distribution. In addition, amino acid profile of all Vietnamese CAVs contains
Q394 that was reportedly associated with virulence.
80
Table 3.1. Detection of CAV antibodies in the field chickens using b–LAT
Location
(Province)
Serum samples from
Age (weeks)
No. of samples
No. of antibody positive samples (%)
Positive Suspected1)
Hanoi and Hanam
Chicken flock
4–6 74 2 (2.7) 0 (0.0)
Hanoi LBM 2) > 8 237 167 (70.4) 14 (5.9)
Total 311 169 (54.3) 14 (4.5) 1) Suspected: Samples showed unclear agglutination in b–LAT. 2) LBM: Live bird market
81
Table 3.2. Detection of CAV genes in tissue samples collected from the field chickens by PCR
VP10 1,823 KP780292 Taiwan/isolate 18 99.34 KJ728827 1) BN1 is from a chicken with unknown diseases and others from healthy chickens. 2) The full–length coding regions of CAV genes were compared.
84
Table 3.5. Amino acid profile of VP1 of Vietnamese CAVs
Sequences Genotypes Amino acid position in VP11)
22 75 97 125 139 144 287 290 370 376 394 413
Germany/M55918/CUX1 III H V M I K D A A S L Q A
Netherland/D10068/26P42) III . . . . . E T . . . . .
USA/AF313470/Del–Ros III . . . . . E S . G . . S
Germany/M81223/Cux1 III . . . . . . . . . . . .
China/KF224934/GD–J–12 III . . . L . E S . G I . S
China/JQ690762/Human III . . . . Q Q . . . . . .
Japan/AB031296/A2 III . . . . . E S . G . . .
Japan/E51057/Att–CAV III . . . L . E S . G I H S
Malaysia/AF390038/3–1 III . . . . . E D . . . . .
Taiwan/KJ728823/isolate 13 III . . . L . E S . G I . S
Taiwan/KJ728818/isolate 7 III . . . L . E S . G I . S
USA/L14767/CIA–1 III N I L . Q Q . . . . . .
Vietnam/KP780287/BN13) III . . . L . E S . G I . S
Vietnam/KP780288/HN1 III . . . L . E S . G I . S
Vietnam/KP780290/VP8 III . . . L . E S . G I . S
Vietnam/KP780291/VP9 III . . . L . E S . G I . S
Australia/EF683159/3711 I . . . . . E S . G . . S
Australia/AF227982/CAU269/7 I . . . . . E T . R . . S
Vietnam/KP780289/VP7 II Q I L . Q Q . . . . . .
Vietnam/KP780292/VP10 II Q I L . Q Q . . . . . .
Australia/U65414/704 II . I L . Q Q T P . . . .
Chile/JQ308214/CL52 II . I L . Q Q T P T . . .
Japan/AB119448/G6 II . I L . Q Q T P . . . .
Malaysia/AF285882/SMSC–1 II . I L . Q Q T P . . . .
Taiwan/KJ728827/isolate 18 II Q I L . Q Q . . . . . .
USA/AF311900/98D06073 II Q I L . Q Q . . . . . .
1) Position was based on the amino acid sequence of the VP1 of Cux-1 strain (accession no. M55918, Noteborn et al. (1991)); 2) The vaccine strains were in bold; 3) The Vietnamese CAV sequences obtained in this study were underlined.
85
Fig. 3.1. Phylogenetic tree of the full–length gene of coding region (1,823 bp) of the Vietnamese
CAVs’ VP1, VP2, and VP3 protein compared to the sequences available in GenBank. Sequences
from GenBank are indicated with the country name followed by accession number. The
phylogenetic tree was constructed using the maximum likelihood method (500 bootstrap replicates)
and MEGA6 software. Number at each branch point indicate bootstrap values ≥50% in the
bootstrap interior branch test. The Vietnamese CAVs are marked with closed squares (■). Three
major genotypes were identified and designated as genotype I, II, and III.
86
General discussion
CAV was first reported in chickens in Japan in 1979 (Yuasa et al., 1979), and then the
presence of CAV has been confirmed in chickens in most countries with poultry industry.
CAV can be transmitted vertically from the parents to their progeny or horizontally by
contact exposure with infected chickens or fomites contaminated with the virus. Although
vertical transmission with CAV is known to cause severe clinical diseases in young chicks,
CAV may also cause subclinical infection related to immunosuppression in older chickens.
Both clinical and subclinical infections may cause direct or indirect economic losses in
poultry industry (McNulty, 1991). Even SPF chicken flocks reared under very strict
hygienic conditions have reportedly become infected with CAV (Cardona et al., 2000a;
Goryo et al., 1985; McNulty et al., 1989; Yuasa et al., 1985). Consequently, the eggs from
the flocks infected with CAV are no longer SPF. Australia, Europe, and USA do not accept
these eggs for production of vaccines for human use for such as measles and mumps
vaccines (Schat and van Santen, 2008). However, since CAV has a widespread distribution
and high resistance to inactivation, reduced virus exposure requires a well-established
biosecurity system and/or effective vaccination. Therefore, there is a need to understand
biological properties of CAV and interaction between virus and hosts, which will enable us
to have appropriate strategies such as a suitable biosecurity system, effective vaccines and
vaccination procedures, or sensitive diagnostic kits for control and prevention of this
disease.
It is known that there are 3 viral proteins of CAV, VP1, VP2 and VP3. Of which, VP1
is the only capsid protein that is crucial for producing neutralizing antibodies against CAV
in chickens (Schat and van Santen, 2008; Todd et al., 1990a); therefore, VP1 is the target to
87
study pathogenicity and antigenicity of CAV, and to use as immunogen of subunit vaccine,
or to develop diagnostic kits. However, there are many questions remaining unclear related
to the appearance time of VP1 in infected MSB1 cells, or neutralizing epitopes on VP1. In
the present study, I studied about neutralizing epitopes on VP1 by using neutralizing mAb
strategy. As the results, 3 neutralizing mAbs were found to be specific to VP1 protein by
using IP and recombinant VP1 protein expressed in mammalian cells. The mAbs could
detect the VP1 synthesized in the infected MSB1 cells as early as 12 day post viral
inoculation. This is the novel finding in contrast to the previous report in which VP1 was
first detectable at 30 hpi (Douglas et al., 1995). This is also the first demonstration of
neutralizing epitopes located on VP1. Sequence analysis of the 3 escape mutants
established from the neutralizing mAbs revealed mutations in different parts of VP1, aas
T89+A90, E144, and I261. However, the similarity in the reactivity of MoCAV/F2 and
MoCAV/F8 to the infected MSB1 cells in blocking IFAT, and to their corresponding escape
mutants (EsCAV/F2 and F8) in IFAT and VNT may suggest the existence of a single
epitope recognized by the 2 mAbs. Therefore, my study indicated that VP1 has at least 2
different neutralizing epitopes that have not been reported previously, to the best of my
knowledge. Mapping the of neutralizing epitopes might be very important in the light of
attempts for future to obtain insight for CAV biology, or to prepare polypeptides, or
recombinant proteins for research or development of new diagnostic kits. It is also
important to provide neutralizing epitope sites for development of subunit vaccine, or DNA
vaccine, since current commercial live vaccines for CAV can not be applied to breeder
chickens during a laying pariod.
As with epitope mapping, the application of mAbs was also considerably useful in the
virological research field with antigenic variation and epidemiology (McCullough and
88
Spier, 2009). In the current study, the CAV strains evaluated could be differentiated into 2
distinct antigenic groups by one mAb (MoCAV/F11), which could be associated with
specific aa profiles at position I75, L97, Q139, and Q144 of VP1. However, in this study, I
only examined the CAV strains originated from Japanese chickens, and 1 vaccine strain
(26P4, Netherland). Thus, additional analysis with other strains from different geographic
areas is necessary to confirm the presence of different antigenic groups of CAV which is
known to be a single serotype. Further study is needed to understand the antigenic
properties of these antigenic groups, which could be important for vaccination against
CAV.
Scott et al. (1999) stated that 5 out of the 6 clones possessed aa change at position 89
(T89A) with other 5 aa changes in VP1 showed the reduction of pathogenicity in chickens
compared to the clones without aa change at position 89. Further investigation of aa T89
with chimeric approach confirmed that aa change T89A combining with other aa changes
in VP1 caused virus attenuation (Todd et al., 2002). In addition, aa Q394 in VP1 was
considered as a major determinant of pathogenicity (Yamaguchi et al., 2001). Chowdhury
et al. (2003) reported that their isolates which received 60 and 120 passages in MSB 1 cells
showed a significant reduction of pathogenicity in chickens compared to the low passage
ones; however, these highly passaged isolates showed several aa changes different from
T89 and Q394. Therefore, alternative aa changes occurring during CAV passages in cell
cultures might result in virus attenuation. In this study, since EsCAV/F2 possessed the
deletion of 2 aa T89A90 in VP1, it should be evaluated whether EsCAV/F2 shows lower or
no pathogenicity to chickens in pathogenicity test using chickens.
In the field, serological monitoring of breeder flocks for CAV infection is quite
important prior to the laying period in order to protect chicks from vertical transmission of
89
CAV and to ensure the CAV–free status of SPF chicken flocks. For detection of CAV
antibody in chicken sera, there are several established serological tests (VNT, IFAT, or
ELISA); however, they still have some limits in use or are not available in several
countries, for instance, commercial ELISA kits are not available in Japan. In addition, it is
well–known that applications of mAbs have increased the accuracy and rapidity of
diagnostic tests. The increase of efficiency of diagnostic could result in more effective
treatment results, or appropriate control and prevention strategies. For those reasons, I
developed the blocking latex agglutination test, b–LAT, using the neutralizing mAb
(MoCAV/F11), which might be good for field application. The results of b–LAT obtained
in the present study were in almost complete agreement with those of VNT, known to be
the most specific and sensitive test for the detection of antibodies to CAV (Otaki et al.,
1991; Yuasa et al., 1983b), and moreover, the result could be obtained within 15 minutes.
Since there is only one serotype present among CAV isolates (McNulty et al., 1990a; Yuasa
and Imai, 1986), the b-LAT can be used to detect CAV antibody in chickens with either
CAV infection or vaccination. However, the b-LAT as well as other current serological tests
cannot differentiate CAV natural infection from vaccination. Thus, the simple, rapid, highly
specific, and sensitive b–LAT technique is expected to have a potentially high application
in CAV serology.
In Vietnam, there has been no report on the circulation of CAV in chicken flocks,
although vaccination is being applied in several breeder farms with large–scale of poultry.
The b–LAT was used to detect CAV antibodies in field sera from Vietnamese chickens. The
result of antibodies detection showed the high prevalence of CAV infection in Vietnamese
chickens. These results may reflect the potential field application of the test. Indeed, I
confirmed the results of b–LAT (the presence of CAV in Vietnamese chickens) using virus