digital.csic.esdigital.csic.es/bitstream/10261/135679/1/TSGP4... · Web viewThe mature native TSGP4 is not immunogenic when it is inoculated to host with tick saliva during feeding,

1

Title:

TSGP4 from Ornithodoros moubata: molecular cloning, phylogenetic analisys and

vaccine efficacy of a new member of the lipocalin clade of cysteinyl leukotriene

scavengers.

Authors:

Manzano-Román, R., Díaz-Martín, V., Oleaga, A., Obolo-Mvoulouga, P., Pérez-Sánchez,

R.

Author’s affiliations:

Parasitología Animal, Instituto de Recursos Naturales y Agrobiología de Salamanca

(IRNASA, CSIC), Cordel de Merinas, 40-52, 37008 Salamanca, Spain.

Author’s e-mail address:

[email protected]; [email protected];

[email protected]; [email protected];

[email protected]

* Corresponding author:

Ricardo Pérez-Sánchez

Parasitología Animal, IRNASA, CSIC,

Cordel de Merinas, 40-52, 37008 Salamanca, Spain.

Tel.: +34 923219606;

fax: +34 923219609.

e-mail address: [email protected]

2

Abstract

Recently obtained evidence indicated that an orthologue of the O. savignyi

TSGP4 salivary lipocalin was present in the saliva of O. moubata. TSGP4 is known to act

as a cysteinyl leukotrienes scavenger helping in the prevention of inflammation and

oedema at the tick bite site. Since this function seems to be crucial for successful tick

feeding, the novel O. moubata TSGP4 turned into a potential vaccine target. The

purposes of the current work were: (i) to clone and characterize the O. moubata TSGP4

and, (ii) to produce it as recombinant to evaluate its protective efficacy as vaccine

antigen. The results of these experiments indicated that the O. moubata TSGP4 shows

high sequence and structural identity with the O. savignyi orthologue suggesting

identical function in the physiology of the tick-host relationship. The mature native

TSGP4 is not immunogenic when it is inoculated to host with tick saliva during feeding,

but host vaccination with the recombinant protein TSGP4 in Freund’s adjuvants

induced strong humoral immune responses that recognized both the recombinant and

native TSGP4 and protected the host with a 14.1% efficacy. So, the O. moubata TSGP4

can be considered a silent salivary antigen; however, in the light of the current results,

its inclusion in the current repertory of protective antigens to be targeted by anti-tick

vaccines could be controversial.

Key words

Ornithodoros moubata; lipocalin; TSGP4; recombinant antigens; vaccines

3

Highlights

Novel O. moubata TSGP4 salivary lipocalin was cloned and characterized.

OmTSGP4 belongs to the clade of cysteinyl leukotrienes scavenger in soft ticks.

Native OmTSGP4 is not immunogenic by natural tick-host contact.

Vaccination with recombinant OmTSGP4 induces strong responses but low

protection.

OmTSGP4 is a salivary silent antigen.

4

1. Introduction

Ticks are blood-feeding ectoparasites that transmit many pathogens of medical

and veterinary importance (de la Fuente et al., 2008; Jones et al., 2008). Ticks can be

divided into two main families, the soft (Argasidae) and hard (Ixodidae) ticks, which

differ in a range of biological characteristics (Sonenshine et al., 2002; Vial, 2009).

Among argasids, the African Ornithodoros moubata is important because it

transmits severe pathogens such as the African swine fever virus (Sánchez-Vizcaíno et

al., 2015) and the spirochete Borrelia duttoni, which is the causative agent of East

African human relapsing fever (Cutler, 2010). The accurate localization and elimination

of the O. moubata populations inhabiting synanthropic environments would facilitate

the control and prevention of these diseases.

Anti-tick vaccines have proved to be a feasible, cost-effective and

environmental-friendly method for the control of tick infestations (de la Fuente, 2012;

Guerrero et al., 2012). Recent investigations to identify protective antigens from O.

moubata have identified some promising vaccine candidates, but currently an effective

vaccine against this species is still lacking, so searching for new and more effective

protective antigens is still required (Díaz-Martín et al., 2015a, 2015b).

During feeding, ticks inject into their hosts a complex array of salivary proteins

with anti-haemostatic, anti-inflammatory and immunomodulatory properties which

defeat the host defence responses allowing tick engorgement (Chmelar et al., 2012;

Wikel, 2013). Among these proteins, the lipocalin family is one of the most prominent

in terms of family members and protein abundance (Mans et al., 2008a, 2008b).

Lipocalins are small proteins ubiquitous in nature, whose main function is the

transportation of small molecules. The amino acid sequences of lipocalins may greatly

diverge, but their three-dimensional structure is strongly conserved and consists of an

eight-stranded anti-parallel β-barrel closed off at one end by an N-terminal helix and

stabilized by a C-terminal α-helix that packs against the side of the barrel (Skerra,

2000).

In the saliva of soft ticks, the lipocalin family is by far the most relevant in terms

of numbers of family members as well as in protein expression levels (Oleaga et al.,

2007; Francischetti et al., 2008a; Mans and Ribeiro, 2008a; Díaz-Martín et al., 2013).

Concerning their functions, the soft tick salivary lipocalins have been classified into

5

three major functional classes that, in turn, match to three well defined clades (Mans

and Ribeiro, 2008b).

One is the clade of biogenic amine scavengers, which function as inhibitors of

inflammation by scavenging histamine and serotonin from the tick feeding site.

Representative members of this clade are the TSGP1 of Ornithodoros savignyi and its

orthologue of O. moubata, as well as the monomine and monotonin of Argas

monolakensis (Mans et al., 2008a; Díaz-Martín et al., 2011).

The moubatin clade comprises several lipocalins playing more diverse

functions. Its best characterized members are the moubatin and the complement

pathway inhibitor (OmCI) from O. moubata, as well as the TSGP2 and TSGP3 from O.

savignyi. Moubatin and TSGP3 inhibit platelet aggregation by scavenging of

thromboxane A2 (TXA2); moubatin, TSGP2, TSPG3 and OmCI bind leukotriene B4 (LTB4),

which implicates them in modulation of neutrophil function; and TSGP2, TSGP3 and

OmCI bind to the C5 complement component blocking its activation (Roversi et al.,

2007; Mans and Ribeiro, 2008a; Barrat-Due et al., 2011; Roversi et al., 2013).

Finally, the clade of cysteinyl leukotriene scavengers is the most recently

defined and comprises up to eight salivary lipocalins. Two of them, the TSGP4 from O.

savignyi and the AM-33 from Argas monolakensis, have been functionally

characterized demonstrating that both bind cysteinyl leukotrienes LTC4, LTD4 and LTE4

with high affinity (Mans and Ribeiro, 2008b). Cysteinyl leukotrienes are potent

inflammatory mediators that increase endothelial permeability leading to edema,

which result in occlusion of blood vessels and decreased blood availability, and to

accumulation of a serous-rich and erythrocyte-depleted fluid in the feeding cavity that

renders blood meal less efficient. Hence, blocking cysteinyl leukotrienes function at the

tick bite site would prevent oedematous inflammatory reactions, which seems to be

crucial for successful tick feeding (Mans and Ribeiro, 2008b).

Recently, random sequencing of a cDNA library from the salivary glands of O.

moubata identified a cDNA fragment coding for a TSGP4 orthologue (Manzano-Román

et al., 2012), and significant amounts of TSGP4 protein were found in a proteomics

analysis of the saliva of adult O. moubata ticks (Díaz-Martín et al., 2013). The presence

of this TSGP4 ortholog in the saliva of O. moubata suggests that it might play an

6

important anti-inflammatory function for tick feeding, turning it into a potential

vaccine target.

Thus, our objectives in the present work were: (i) to clone, sequence, and

characterize the O. moubata TSGP4, including the comparison of its predicted

secondary and three dimensional structures to those of the O. savignyi TSGP4; and (ii)

to produce an O. moubata TSGP4 recombinant to evaluate its immunogenicity and

protective efficacy as vaccine antigen. Additionally, the antigenicity and diagnostic

performance of the recombinant TSGP4 were also evaluated and compared to those of

the rOmTSGP1 antigen (Díaz-Martín et al., 2011), which is the reference antigen

currently used in ELISA tests for the serological surveillance and localization of O.

moubata populations (Ravaomanana et al., 2011; Jori et al., 2013; Quembo et al.,

2015).

2. Material and methods.

2.1. Parasite material.

The O. moubata ticks used in this study came from a colony currently

maintained at the laboratory of Animal Parasitology (IRNASA, CSIC, Spain). This colony

was established from specimens submitted from the Institute for Animal Health

(Pirbright, Surrey, UK). The ticks are fed regularly on rabbits and kept in a culture

chamber at 28ºC, with 85% relative humidity and a 12 h light-dark cycle.

Tick saliva and salivary gland extracts (SGE) were obtained from adult ticks as

described previously (Díaz-Martín et al., 2013). Protein concentrations in SGE and

saliva samples were measured with the Bradford assay (Bio-Rad) and samples were

stored at −20ºC.

Total RNA from the salivary glands of unfed adult ticks (10 males + 10 females)

was purified using the NucleoSpin RNA II kit (Macherey-Nagel), following the

manufacturer’s instructions, and preserved at −80ºC.

2.2. Amplification of the complete cDNA coding sequence of OmTSGP4.

A recombinant plasmid (pANT_GST-TSGP4) containing an incomplete cDNA

fragment (lacking the 5’-end) of the coding sequence of TSGP4 was identified by

7

random sequencing from a salivary gland cDNA expression library constructed

previously (Manzano-Román et al., 2012).

The missing sequence was first obtained by 5’-RACE from total RNA of salivary

glands using the First Choice RLM-RACE kit (Life Technologies) according to the

manufacturer’s instructions and a primer set designed ad hoc: GSP1-TSGP4 (outer

primer) (5’-ACGTAGGGCGTTTCTGCTACA) and GSP2-TSGP4 (inner primer) (5’-

CCCACAGTTCGCATTTGTCTT). The 5’-RACE product was purified from agarose gel,

cloned into the pSC-A sequencing vector (Agilent) and sequenced following standard

procedures described elsewhere (Díaz-Martín et al., 2011).

Once its 5’-end sequence was known, the complete cDNA coding sequence of

TSGP4 was amplified from total RNA with primers TSGP4_F (5’-

ATGGACTGCAAGCTTGTCGC) and TSGP4_R (5’-CTACGAAGGAACTCTGCAATCTG). For

this, total RNA from salivary glands was subjected to reverse transcription using the 1 st

Strand cDNA Synthesis Kit for RT-PCR (Roche). One microliter of the resulting cDNA

was then amplified using the above-indicated primer set. PCR was performed in 35

cycles of 94ºC for 15 s, 60ºC for 30 s, and 72ºC for 40 s, with a final extension step at

72ºC for 7 min. The PCR product was purified, cloned into pSC-A and its sequence was

confirmed following standard procedures.

2.3. Bioinformatic analyses of the OmTSGP4 protein.

The complete nucleotide sequence coding for TSGP4 was uploaded into

GenBank, and the corresponding amino acid sequence was used to identify possible

orthologues from the non-redundant Genbank protein sequence database by BLASTP

analysis. Retrieved sequences with E-values lower than 10-10 were aligned with

ClustalW. Based on this alignment, neighbour-joining analysis was performed using the

Mega6 package (Tamura et al., 2013). Gaps were treated as pairwise deletions, amino

acid distances were calculated using Poisson model, and branch supports were

estimated using bootstraps analysis (10,000 bootstraps).

For prediction and comparison of secondary structures and three-dimensional

(3D) modelling, the amino acid sequences of O. moubata and O. savignyi TSGP4s were

8

submitted to the Phyre2 server (Kelley and Sternberg, 2009). The resulting 3D models

were visualized using the Pymol package (DeLano, 2002).

The amino acid sequence of the O. moubata TSGP4 was subjected to additional

bioinformatic analyses to assess its primary structure

(http://www.cbs.dtu.dk/services/SignalP; http://www.cbs.dtu.dk/services/TMHMM-

2.0/;), hydrophobicity (http://gpi.unibe.ch/ and http://web.expasy.org/protscale/), and

post-translational modifications (http://www.cbs.dtu.dk/services/NetNGlyc;

http://www.cbs.dtu.dk/services/NetOGlyc;).

2.4. Expression and purification of the recombinant protein rOmTSGP4.

A mature version of OmTSGP4 cDNA lacking its predicted signal peptide (see

results section) was constructed. The mature sequence was amplified from the pSC-A-

OmTSGP4 construction using primers tTSGP4KpnI_F (5’-

TTCGGTACCGCAGACGTGTGGAACGTCATC) and TSGP4KpnI_R (5´-

TTCGGTACCCTACGAAGGAACTCTGCAATCTG). These primers included KpnI adapters

(underlined) and 5’ additional nucleotides to assist in the restriction digestion and sub-

cloning of the amplified cDNA in the pQE-30 expression vector (Qiagen). PCR was

carried out in 35 cycles of 94ºC for 15 s, 60ºC for 30 s, and 72ºC for 40 s, with a final

extension step at 72ºC for 7 min. The PCR product was purified, digested and cloned

into the pQE-30 vector following standard procedures (Díaz-Martín et al., 2011).

The pQE-30-tTSGP4 recombinant plasmid was transformed into the Escherichia

coli M15 cells (Qiagen) and protein expression was induced with 1 mM IPTG. The

recombinant protein (rOmTSGP4) was expressed fully insoluble. Thus, it was

solubilized with 8 M urea, purified by nickel affinity chromatography in denaturing

conditions, and dialyzed against phosphate-buffered saline (PBS), pH 7.4, for 24 h at

4ºC according to the procedure described by Díaz-Martín et al. (2011). The

concentration of the protein was measured using the DC Protein assay kit (Bio-Rad)

and its purity was checked by SDS-PAGE.

2.5. Sera and ELISA protocol for evaluation of the diagnostic performance of

rOmTSGP4.

9

A panel of 39 well defined porcine sera were used to test the antigenicity and

diagnostic performance of the rOmTSGP4 in ELISA. These sera came from previous

studies (Baranda et al., 2000) and consisted of 18 sera obtained from pigs

experimentally infested with different developmental stages of O. moubata (positive

sera) as well as 21 sera from experimental naïve pigs that have never been into contact

to O. moubata (negative sera).

The diagnostic performance of rOmTSGP4 was compared to that of the O.

moubata SGE and rOmTSGP1, which are the antigens used for the serological

surveillance of O. moubata (Ravaomanana et al., 2011; Jori et al., 2013; Quembo et al.,

2015).

With this purpose, we applied the ELISA protocol described by Díaz-Martín et

al. (2011). Briefly, ELISA plates were coated overnight at 4°C with the corresponding

antigen (500 ng of SGE, 100 ng of rOmTSGP1 and 100, 200, 400 and 600 ng of

rOmTSGP4) in 100 µl/well of carbonate buffer (pH 9.6), and post-coated with 200

µl/well of 1% BSA in PBS.

Porcine sera were incubated in duplicate wells (100 µl/well) at 1/300 dilution in

0.05% Tween-20 in PBS (TPBS), and peroxidase-labelled anti-pig IgG (Sigma) was

incubated at 1/10,000 dilution in TPBS. Incubations were done for 1 h at 37°C.

Orthophenylene-diamine was used as substrate and, after stopping the reaction with

3N sulphuric acid, the optical density (OD) was read at 492 nm in the Multiskan Go

ELISA reader (Thermo Scientific).

2.6. Vaccine trial.

The rOmTSGP4 recombinant protein was administered to a group of three

rabbits (New Zealand white) in Freund’s adjuvant. An additional group of rabbits was

treated with the adjuvant alone and used as control. Each animal was vaccinated at 15-

day intervals with three doses of 200 µg of protein per dose administered

subcutaneously. The first dose was administered emulsified in Freund’s complete

adjuvant (FCA); the second in Freund’s incomplete adjuvant (FIA), and the third dose

with no adjuvant.

Rabbits were bled immediately before the administration of the first dose (pre-

immune sera) and at seven days after the third one, immediately before tick

10

infestation (immune sera). Blood samples were allowed to clot and sera were removed

and stored at −80ºC. In the immune sera, the antibody titres to rOmTSGP4 were tested

by ELISA and their reactivity to rOmTSGP4 and O. moubata saliva was tested by

Western blot following standard procedures (García-Varas et al., 2010; Manzano-

Román et al., 2015).

At seven days after the third antigen dose, all rabbits were infested with 15

females, 25 males and 50 nymphs-2 of O. moubata per rabbit. The parasites were

allowed to feed on the rabbits for a maximum of 1 h after which they were removed

from the animals. The degree of protection was determined by measuring the amount

of blood ingested (difference in tick weight before feeding and 24 h after feeding), the

oviposition (number of eggs per female) and fertility (number of nymphs-1 per female)

rates, the moulting rates of immature stages and the mortality rates of all

developmental stages.

The values obtained for the parasites fed on the animals from each group were

summarized as means ± standard deviations. Statistical differences between the

vaccinated and control group were assessed by one-way ANOVA followed by Dunnett’s

t-test. Values of p < 0.05 were considered significant.

Vaccine efficacy (E) was calculated as E = 100 (1-S × F), where S and F

respectively represent the reduction in female survival and fertility in ticks fed on

vaccinated rabbits as compared to those fed on control rabbits.

All animal manipulations were performed according to the rules from the

ethical and animal welfare committee of the institution where the experiments were

conducted (IRNASA, CSIC), following the corresponding EU rules and regulations.

3. Results.

3.1. Amplification, cloning and sequencing of the OmTSGP4 cDNA.

Amplification of O. moubata TSGP4 cDNA by RT-PCR resulted in a cDNA

molecule of 534 nucleotides encoding a protein of 177 amino acids, with a theoretical

molecular weight and pI of 19,029 Da and 5.49, respectively. This sequence was

submitted to GenBank and received accession number KC908108.

11

The translated protein showed a predicted signal peptide comprising its 20

amino terminal residues and four potential O-glycosylation sites on serines 55 and 81

and threonines 82 and 84. The protein sequence lacked transmembrane helices and

glycosyl-phosphatidyl inositol anchors.

3.2. Phylogenetic analysis of OmTSGP4.

BLASTP analysis of the non-redundant Genbank protein database using the

sequence of OmTSGP4 retrieved 10 soft tick lipocalins with E-values below 10-10. These

included the 8 lipocalins from A. monolakensis, O. parkeri and O. savignyi that

constituted the TSGP4/AM-33 clade of cysteinyl leukotriene scavengers as defined by

Mans and Ribeiro (2008b). The other 2 lipocalins retrieved were the own O. moubata

TSGP4 and an additional salivary lipocalin from the sialome of O. coriaceus

(Francischetti et al., 2008b) that was not previously included in the TSGP4/AM-33

clade.

Phylogenetic analysis of these ten TSGP4-related proteins indicated that all of

them grouped within two major clades, each one corresponding to a different genus

(Ornithodoros or Argas) and containing a number of genus specific proteins (Fig. 1).

3.3. Molecular modelling of the O. moubata and O. savignyi TSGP4s.

Sequences of O. moubata and O. savignyi TSGP4 were submitted to the Phyre2

server (Kelley and Sternberg, 2009), and for both proteins, models were obtained

based on the structures of the O. moubata OmCI in complex with ricinoleic2 acid

(Roversi et al., 2007). The estimated precision of each model was 100%.

Both proteins were aligned to each other showing 60% sequence identity (Fig.

2). The conserved residues are distributed in discrete clusters along the sequence and

mostly correspond to regions predicted to be involved in secondary structure

formation. The O. moubata TSGP4 also conserves the six cysteine residues that

correspond to the unique disulphide bond pattern previously proposed for the

members of TSGP4/AM-33 clade (Mans et al., 2003; Mans and Ribeiro, 2008b).

The predicted three dimensional models were similar for both proteins and

showed the characteristic tertiary structure of lipocalins: an eight-stranded anti-

12

parallel β-barrel and a C-terminal α-helix that packs against the side of the barrel (Fig.

3A).

Hydrophobicity plots based on the Kyte & Doolittle scale were obtained for

both proteins, which showed similar profiles and hydrophobic residues distributions

along their sequences (Fig. 3B). This indicates that the O. moubata TSGP4 would have a

binding cavity hydrophobic in character with polar residues occurring at the periphery

of the binding pocket, similar to that described for the O. savignyi TSGP4 (Mans and

Ribeiro, 2008b).

3.4. Expression and purification of the rOmTSGP4 protein.

The mature version of the OmTSGP4 cDNA was subcloned into the pQE-30

vector and transformed into M15 E. coli cells. After induction of expression, the

hexahistidine-tagged recombinant protein was purified under denaturing conditions (8

M urea) using nickel affinity chromatography. The purified protein (2.7 mg per liter of

culture) migrated as a strong band of around 20 kDa in reducing SDS-PAGE, close to

the predicted molecular mass of the his-tagged recombinant polypeptide (18,258 Da)

(Fig. 4).

3.5. Comparative performance of rOmTSGP4, rOmTSGP1 and SGE in ELISA.

The sensitivity as diagnostic antigen of increasing amounts of rOmTSGP4 (from

100 to 600 ng) was compared to 500 ng of SGE and 100 ng of rOmTSGP1. As expected,

SGE and rOmTSGP1 showed high reactivity with the positive reference sera (mean ODs

1.22 ± 0.21 and 1.09 ± 0.21, respectively) and low reactivity with the negative

reference sera (mean ODs 0.17 ± 0.06 and 0.18 ± 0.04, respectively), showing their

usual good discriminatory capacity between both types of sera (Fig. 5).

By contrast, the rOmTSGP4 antigen was not recognized by the positive sera,

which showed a mean reactivity to this antigen as low as that of the negative sera. The

increase in the amount of coating rOmTSGP4 from 100 ng to 600 ng per well just

increased background reactivity without improving discrimination between positive

and negative sera (Fig. 5).

3.6. Protective value of rOmTSGP4 against O. moubata.

13

The rOmTSGP4 recombinant was used as antigen for the vaccination of rabbits.

The sera from all the vaccinated animals reached anti-rOmTSGP4 IgG antibody titres

higher than 1/12,800 (not shown) and reacted specifically with both the rOmTSGP4

and the native TSGP4 in the O. moubata saliva (Fig. 6).

On the rOmTSGP4, these sera revealed a strong band of the expected size (20

kDa) and some additional weaker bands close to 44 and 66 kDa, suggesting some

degree of oligomerization of the recombinant. On the saliva, the anti rOmTSGP4 sera

revealed only one band, slightly lower in size than the monomeric rOmTSGP4, which

corresponded to the secreted mature form of native TSGP4. This protein lacks the 20

amino acid-long signal peptide, which would accounti for its lower size as compared to

the His-tagged monomeric rOmTSGP4. On the other hand, neither the preimmune sera

nor the sera from rabbits immunized by natural contact (obtained by Manzano-Román

et al., 2015) reacted with the rOmTSGP4 or the mature native TSGP4 in the saliva (Fig.

6).

The protective effect of vaccination was assessed by infesting each rabbit with

15 females, 25 males and 50 nymphs-3. No differences were observed between the

vaccinated and control group in the feeding time for any developmental stage or in the

moulting rate of nymphs-3 (not shown).

The protection achieved consisted of small decreases in the feeding,

reproduction and survival of the ticks fed on vaccinated animals as compared to the

ticks fed on controls, and only the increase in the nymphs-3 mortality was significant

(Table 1).

A vaccine efficacy (E) for rOmTSGP4 of 14.1% was calculated from the

decreases in female survival and fertility, since these parameters determine the size of

the next tick generation and hence the evolution of the tick population.

4. Discussion.

An effective vaccine against O. moubata would be of help in the elimination of

this tick from synanthropic environments, thus improving the prevention and control

of African swine fever and human tick-borne relapsing fever in endemic areas.

Targeting salivary exposed antigens as vaccine candidates is interesting since

14

subsequent tick infestations of immunized animals will likely trigger anamnestic

antibody responses and serve as booster shots, making re-vaccination of the host

unnecessary (Radulovic et al., 2014). Conversely, salivary exposed antigens may have

been protected from recognition by the host immune system along the co-evolution of

the tick-host interaction, rendering them little or no immunogenic (Brake and Pérez de

León, 2012; Chmelar et al., 2016a). Actually, this seems to be the case for most

components of the O. moubata saliva (Díaz-Martín et al., 2013).

Despite this, it has been observed that vaccination with O. moubata salivary

anti-haemostatic/anti-inflammatory antigens formulated in oil-based adjuvants

(Freund’s and Montanide) favours antigen immunogenicity and provides protective

responses, which are boosted after natural contact of vaccinated animals and ticks,

demonstrating that these molecules are suitable targets for anti-tick vaccines (Díaz-

Martín et al., 2015a, 2015b).

Previous evidence suggested that the TSGP4 lipocalin could be one of these

salivary targets. The TSGP4 protein was first identified in O. savignyi by Mans et al.

(2001, 2003) and subsequently it was functionally characterized as a cysteinyl

leukotrienes scavenger (Mans and Ribeiro, 2008b). The finding of significant amounts

of a TSGP4 orthologue in the saliva of O. moubata (up to 4.4% of the salivary protein

mass; Díaz-Martín et al., 2013) suggested that prevention of the cysteinyl leukotrienes-

mediated inflammation and edema should be important for the feeding of this tick too,

hence turning the O. moubata TSGP4 into a potential vaccine target.

Moreover, O. moubata TSGP4 was not recognized in two dimensional (2D)-

western blots by the sera from pigs bitten by this tick (Oleaga et al., 2007), indicating

that it is not immunogenic through natural tick-host contact. Thus, TSGP4 would not

be evolutionarily protected from a vaccine-induced immune response and it would

likely perform as a silent salivary antigen (Kotsyfakis et al., 2008; Chmelar et al.,

2016a). Silent salivary antigens are considered very interesting targets for anti-tick

vaccines (Parizi et al., 2012; Moreno-Cid et al., 2013; Wikel et al., 2013; Diaz-Martín et

al., 2015a).

To test the above hypotheses, we first cloned and characterized this protein,

obtaining a complete cDNA sequence that was confirmed to represent the O. moubata

TSGP4 molecule. Phylogenetic analysis of the amino acid sequence of OmTSGP4

15

confirmed that this is an orthologue of the O. savignyi TSGP4, and that it belongs to

the cysteinyl leukotriene scavengers’ clade of the soft tick lipocalins defined by Mans

and Ribeiro (2008b). These results also indicate that the ten TSGP4/AM33-related

sequences analysed can be grouped in two genus-specific clades for Ornithodoros and

Argas, respectively. As already stated by other authors, this indicates that the two

clades form an orthologous group (i.e. monophyletic) and that, after divergence of the

two genera, gene duplication events and subsequent mutations with divergent

evolution would have led to a number of paralogous proteins (Mans et al., 2008b;

Mans and Ribeiro, 2008b, Dai et al., 2012; Chmelar et al., 2016b).

Our results also show that O. moubata TSGP4 displays high sequence identity

with its orthologue in O. savignyi, and that both TSGP4s conserve the same secondary

and tertiary structures, including the disulfide bond pattern and the hydrophobic

character of the binding pocket inside the lipocalin β-barrel. From these results it may

be inferred that O. moubata TSGP4 would play a similar biological function to that of

O. savignyi TSGP4 as cysteinyl leukotriene scavenger, preventing oedematous

inflammatory reactions at the tick bite site. Nevertheless, experimental confirmation of

this predicted function by the appropriate binding assays remains to be obtained.

After producing a recombinant form of the mature TSGP4 (rOmTSGP4), we first

used it to assess the antigenicity of the native TSGP4. For this, we analyzed the

reactivity of the rOmTSGP4 to a panel of 39 well-defined sera -obtained from naïve

pigs and from pigs bitten by O. moubata- and compared it to the reactivity of the

reference antigens, SGE and rOmTSGP1.

The results of this experiment showed that the rOmTSGP4 did not detect anti-

TSGP4 specific IgG antibodies in the sera of any infested pig, indicating that the native

mature TSGP4 inoculated with saliva during natural tick-host contact does not induce

the synthesis of specific antibodies. In other words, the TSGP4 is not immunogenic

when exposed to the host immune system by natural way, as already anticipated by

the results of Oleaga et al. (2007), thus meeting the first condition to be considered as

a silent antigen. Moreover, these results exclude the use of rOmTSGP4 as diagnostic

antigen for the serological surveillance and localization of O. moubata populations.

After that, we evaluated the usefulness of the TSGP4 as vaccine target. With

this purpose, we first demonstrated a strong immunogenicity for rOmTSGP4 when

16

administered it to rabbits in Freund’s adjuvant. In this way, TSGP4 induced the

synthesis of high titres of specific antibodies that recognized both the recombinant

protein and the native mature TSGP4 present in saliva (Fig. 6), hence meeting the

second condition to be considered as a silent antigen. By contrast, the sera of naturally

infested rabbits did not recognize the recombinant nor the native protein, confirming

that the native TSGP4 inoculated with saliva during natural tick-host contact is not

immunogenic.

This discrepancy in the immunogenic potential between a native tick salivary protein

and its recombinant form has already been described (namely, for the SialoL2 from

Ixodes scapularis; Kotsyfakis et al., 2008) and can have several causes including low

molecular weight and post-translational modifications of the native antigen, time-

limited exposure of a single antigen, and low antigen concentration due to the

presence of several members of the same protein family in tick saliva displaying the

same function but not antigenicity (Chmelar et al., 2016a). Regarding the lack of

immunogenicity of the O. moubata TSGP4 through natural contact, it does not seem to

be a matter of low concentration, since it reaches up to 4.4% of the total salivary

protein mass. Instead, it might be a case of masking by the highly antigenic TSGP1,

whose enormous proportion in saliva (more than 95% of the total salivary protein

mass) could have prevented recognition of TSGP4 by the host immune system.

Regarding the protective effect of the anti-TSGP4 response on the ticks, it was

rather limited, so that any interpretation should be taken with cautioun. This effect

mainly consisted of reductions in tick feeding performance, which would suggest that

TSGP4 would be acting as an anti-inflammatory agent to facilitate tick feeding. The fact

that qualitatively similar results were observed in vaccination experiments with other

O. moubata salivary anti-haemostatic and anti-inflammatory antigens (Diaz-Martín et

al., 2015b) lend support to this interpretation. The reduction in ingested blood, and

consequently in nutrient availability, seemed to be reflected in subsequent reductions

in female oviposition and fertility, although these reductions were non-significant.

Additionally, the anti-TSGP4 response induced slight reductions in the survival

rate of all the tick developmental stages, which were significant only for nymphs-3.

Thus, it is tempting to speculate that ticks fed on vaccinated rabbits could have

ingested a higher proportion of immune cells -and its toxic products- with the serous-

17

rich, erythrocyte-depleted fluid that would have accumulated in the feeding cavity as a

result of impairing the TSGP4 anti-inflammatory function.

The resulting 14.1% vaccine efficacy of TSGP4 in this tick challenge can be

considered low, which would reduce the utility of TSGP4 as vaccine candidate.

However, this efficacy was inside the range of that achieved with other silent salivary

antigens of O. moubata, for which it was further demonstrated that tick saliva

inoculated during subsequent tick infestations enhanced the vaccine-induced

protective immune response (Díaz-Martín et al., 2015b). Thus, it could be anticipated

the same boosting effect of the native TSGP4 inoculated with saliva during subsequent

tick infestations on the anti-TSGP4 vaccine-induced protective immune response.

Unfortunately, secondary tick challenges were not performed in the current work, so

this issue is still awaiting experimental demonstration.

It could be also expected that the joint use of TSGP4 and other salivary antigens

targeting redundant tick anti-defensive mechanisms would increase vaccine efficacy

(Imamura et al., 2008; Willadsen, 2008), as already observed for several

antihaemostatics and anti-inflammatory salivary antigens such as phospholipase A2,

apyrase and mougrin (Díaz-Martín et al., 2015b).

Conclusions

A new member of the lipocalin clade of cysteinyl leukotriene scavenger in soft

ticks, the O. moubata TSGP4, was cloned and characterized. OmTSGP4 shows high

sequence and structural identity with the O. savignyi orthologue suggesting identical

function in the physiology of the tick-host relationship. The mature native TSGP4

inoculated to host with tick saliva during feeding is not immunogenic, precluding its

use as diagnostic antigen for the serological surveillance of O. moubata. By contrast,

host vaccination with the recombinant protein (rOmTSGP4) in Freund’s induced strong

humoral immune responses, which recognized both the recombinant and native TSGP4

and provided some degree of protection against the tick, although it was not

significant. Thus, the O. moubata TSGP4 can be considered a silent salivary antigen;

however, in the light of the current results, its inclusion in the current repertory of

protective antigens to be targeted by anti-tick vaccines could be controversial.

18

Acknowledgements

We thank the financial support provided by the Spanish Ministry of Science and

Innovation (Grant no. AGL2010-18164) and Ministry of Economy and Competitivity

(Grant no. AGL2013-42745-P).

References

Baranda, J.A., Pérez-Sánchez, R., Oleaga-Pérez, A., Manzano, R., Encinas-Grandes, A.,

2000. Purification, N-terminal sequencing and reactivity of the major antigens of

Ornithodoros erraticus and O. moubata. Vet. Parasitol. 87, 193-206.

Barratt-Due, A., Thorgersen, E.B., Lindstad, J.K., Pharo, A., Lissina, O., Lambris, J.D.,

Nunn, M.A., Mollnes, T.E., 2011. Ornithodoros moubata complement inhibitor is an

equally effective C5 inhibitor in pigs and humans. J. Immunol 187, 4913-4919.Brake,

D.K., Pérez de León, A.A., 2012. Immunoregulation of bovine macrophages

byfactors in the salivary glands of Rhipicephalus microplus. Parasit. Vectors 5, 38.

Chmelar, J., Calvo, E., Pedra, J.H., Francischetti, I.M., Kotsyfakis, M., 2012. Tick salivary

secretion as a source of antihemostatics. J. Proteomics 75, 3842-3854.

Chmelar, J., Kotal, J., Kopecky, J., Pedra, J.H.F., Kotsyfakis, M., 2016a. All for one and

one for all on the tick-host battlefield. Trends in Parasitology 32, 368-377.

Chmelar, J., Kotal, J., Karim, S., Kopacek, P., Francischetti, I.M.B., Pedra, J.H.F.,

Kotsyfakis, M., 2016b. Sialomes and Mialomes: A systems-biology view of tick

tissues and tick-host interactions. Trends in Parasitology 32, 242-254.

Cutler, S.J., 2010. Relapsing fever – a forgotten disease revealed. J. Appl. Microbiol.

108, 1115-1122.

Dai, S.X., Zang, A.D., Huang, J.F. 2012. Evolution, expansion and expression of the

Kunitz/BPTI gene family associated with long-term blood feeding in Ixodes

scapularis. BMC Evol. Biol. 12, 4

de la Fuente, J., 2012. Vaccines for vector control: exciting possibilities for the future.

Vet. J. 194, 139–140.

de la Fuente, J., Estrada-Peña, A., Venzal, J.M., Kocan, K.M., Sonenshine, D.E., 2008.

Overview: Ticks as vectors of pathogens that cause disease in humans and animals.

Front. Bioscience 13, 6938-6946.

19

DeLano, W.L., 2002. The PyMOL Molecular Graphics System. DeLano Scientific, Palo

Alto, CA, USA.

Díaz-Martín, V., Manzano-Román, R., Siles-Lucas, M., Oleaga, A., Pérez-Sánchez, R.,

2011. Cloning, characterization and diagnostic performance of the salivary lipocalina

protein TSGP1 from Ornithodoros moubata. Vet. Parasitol. 178, 163-172.

Díaz-Martín, V., Manzano-Román, R., Valero, L., Oleaga, A., Encinas-Grandes, A., Pérez-

Sánchez, R., 2013. An insight into the proteome of the saliva of the argasid tick

Ornithodoros moubata reveals important differences in saliva protein composition

between the sexes. J. Proteomics 80, 216-35.

Díaz-Martín, V., Manzano-Román, R., Obolo-Mvoulouga, P., Oleaga, A., Pérez-Sánchez,

R., 2015a. Development of vaccines against Ornithodoros soft ticks: an update. Tick

Tick Borne Dis. 6, 211–220.

Díaz-Martín, V., Manzano-Román, R., Oleaga, A., Pérez-Sánchez, R., 2015b. New

salivary anti-haemostatics containing protective epitopes from Ornithodoros

moubata ticks: Assessment of their individual and combined vaccine efficacy.

Veterinary Parasitology 212: 336–349

Francischetti, I.M., Mans, B.J., Meng, Z., Gudderra, N., Veenstra, T.D., Pham, V.M.,

Ribeiro, J.M., 2008a. An insight into the sialome of the soft tick, Ornithodorus

parkeri. Insect Biochemistry and Molecular Biology 38, 1-21.

Francischetti, I.M., Meng, Z., Mans, B.J., Gudderra, N., Hall, M., Veenstra, T.D., Pham,

V.M., Kotsyfakis, M., Ribeiro, J.M., 2008b. An insight into the salivary transcriptome

and proteome of the soft tick and vector of epizootic bovine abortion, Ornithodoros

coriaceus. Journal of Proteomics 71, 493-512.

García-Varas, S., Manzano-Román, R., Fernández-Soto, P., Encinas-Grandes, A., Oleaga,

A., Pérez-Sánchez, R., 2010. Purification and characterisation of a P-selectin-binding

molecule from the salivary glands of Ornithodoros moubata that induces protective

anti-tick immune responses in pigs. Int. J. Parasitol. 40, 313-326.

Guerrero, F., Miller, R.J., Pérez de León, A. 2012. Cattle tick vaccines: many candidates

antigens, but will a commercial product emerge?. Int. J. Parasitol. 42, 421-424.

Imamura, S., Konnai, S., Vaz Ida, S., Yamada, S., Nakajima, C., Ito, Y., Tajima, T., Yasuda,

J., Simuunza, M., Onuma, M., Ohashi, K., 2008. Effects of anti-tick cocktail vaccine

against Rhipicephalus appendiculatus. Jpn. J. Vet. Res. 56, 85–98.

20

Jori, F., Vial, L., Penrith, M.L., Pérez-Sánchez, R., Etter, E., Albina, E., Michaud, V. And

Roger, F. 2013. Review of the sylvatic cycle of African swine fever in Sub-Saharan

Africa and the Indian Ocean. Virus Research, 173: 212-227.

Jones, K.E., Patel, N.G., Levy, M.A., Storeygard, A., Balk, D., Gittleman, J.L., et al. Global

trends in emerging infectious diseases. Nature 451, 990-994.

Kelley, L.A., Sternberg, M.J.E., 2009. Protein structure prediction on the web: a case

study using the phyre server. Nat. Protoc. 4, 363–371.

Kotsyfakis, M., Anderson, J.M., Andersen, J.F., Calvo, E., Francischetti, I.M., Mather,

T.N., Valenzuela, J.G., Ribeiro, J.M., 2008. Cutting edge: Immunity against a "silent"

salivary antigen of the Lyme vector Ixodes scapularis impairs its ability to feed. J.

Immunol. 181, 5209-5212.

Mans, B.J., Ribeiro, J.M.C., 2008a. Function, mechanism and evolution of the

moubatin-clade of soft tick lipocalins. Insect Biochem. Mol. Biol. 38, 841-852

Mans, B.J., Ribeiro, J.M., 2008b. A novel group of peptide leukotriene scavengers in

soft ticks. Insect Biochem. Mol. Biol. 38, 862–870

Mans, B.J., Venter, J.D., Vrey, P.J., Louw, A.I., Neitz, A.W., 2001. Identification of

putative proteins involved in granule biogenesis of tick salivary glands.

Electrophoresis 22, 1739–1746.

Mans, B.J., Louw, A.I., Neitz, A.W., 2003. The major tick salivary gland proteins and

toxins from the soft tick, Ornithodoros savignyi, are part of the tick Lipocalin family:

implications for the origins of tick toxicoses. Mol. Biol. Evol. 20, 1158–1167.

Mans, B.J., Ribeiro, J.W., Andersen, J.A., 2008a. Structure, function and evolution of

biogenic amine-binding proteins in soft ticks. J. Biol. Chem. 283, 18721–18733.

Mans, B.J., Andersen, J.F., Francischetti, I.M., Valenzuela, J.G., Schwan, T.G., Pham,

V.M., Garfield, M.K., Hammer, C.H., Ribeiro, J.M., 2008b. Comparative sialomics

between hard and soft ticks: implications for the evolution of blood-feeding

behavior. Insect Biochemistry and Molecular Biology 38, 42-58.

Manzano-Román, R., Díaz-Martín, V., González-González, M., Matarraz, S., Álvarez-

Prado, A.F., LaBaer, J., Orfao, A., Pérez-Sánchez, R., Fuentes, M., 2012. Self-

assembled protein arrays from an Ornithodoros moubata salivary gland expression

library. J. Proteome Res. 11, 5972-5982.

21

Manzano-Román, R., Díaz-Martín, V., Oleaga, A., Pérez-Sánchez, R., 2015. Identification

of protective linear B-cell epitopes on the subolesin/akirin orthologues of

Ornithodoros spp. soft ticks. Vaccine 33, 1046-55.

Moreno-Cid, J.A., Pérez de la Lastra, J.M., Villar, M., Jiménez, M., Pinal, R., Estrada-

Peña, A., Molina, R., Lucientes, J., Gortázar, C., de la Fuente, J., 2013. Control of

multiple arthropod vector infestations with subolesin/akirin vaccines. Vaccine 31,

1187–1196.

Oleaga, A., Escudero-Población, A., Camafeita, E., Pérez-Sánchez, R., 2007. A proteomic

approach to the identification of salivary proteins from the argasid ticks

Ornithodoros moubata and Ornithodoros erraticus. Insect Biochem. Mol. Biol. 37,

1149-1159.

Parizi, L.F., Utiumi, K.U., Imamura, S., Onuma, M-, Ohashi, K-, Masuda, A. 2011. Cross

immunity with Haemaphysalis longicornis glutathione S-transferase reduces an

experimental Rhipicephalus (Boophilus) microplus infestation. Exp. Parasitol. 127,

113–118.

Quembo, C.J., Jori, F, Pérez-Sánchez, R., Heath, L.; Vosloo, W. 2015. Investigation into

the epidemiology of African swine fever virus at the wildlife –domestic interface of

the Gorongosa National Park, Central Mozambique. Transboundary and Emerging

Diseases, DOI: 10.1111/tbed.12289.

Radulovic, Z.M., Kim, T.K., Porter, L.M., Sze, S.H., Lewis, L., Mulenga, A., 2014. A 24–48

h fed Amblyomma americanum tick saliva immuno-proteome. BMC Genom. 15,

518.

Ravaonamana, J.; Jori, F.; Vial, L.; Blanco, E.; Pérez-Sánchez, R.; Michaud, V.; Roger, F.

2011. Assessment of interactions between African swine fever virus, bushpigs

(Potamochoerus larvatus), Ornithodoros ticks and domestic pigs in north-western

Madagascar. Transboundary and Emerging Diseases, 58: 247-254.

Roversi, P., Lissina, O., Johnson, S., Ahmat, N., Paesen, G.C., Ploss, K., Boland, W.,

Nunn, M.A., Lea, S.M., 2007. The structure of OMCI, a novel lipocalin inhibitor of the

complement system. J. Mol. Biol. 369, 784–793.

Roversi, P., Ryffel, B., Togbe, D., Maillet, I., Teixeira, M., Ahmat, N., Paesen, G.C.,

Lissina, O., Boland, W., Ploss, K., Caesar, J.J., Leonhartsberger, S., Lea, S.M., Nunn,

M.A., 2013. Bifunctional lipocalin ameliorates murine immune complex-induced

22

acute lung injury. J. Biol Chem. 288, 18789-18802. Sánchez-Vizcaíno, J.M., Mur, L.,

Gomez-Villamandos, J. C., Carrasco, L. 2015. An Update on the Epidemiology and

Pathology of African Swine Fever. J. Comp. Path. 152, 9e21.

Skerra, A., 2000. Lipocalins as a scaffold. Biochim. Biophys. Acta 1482, 337-350.

Sonenshine, D.E., Lange, R.S., Nicholson, W.L., 2002. Ticks (Ixodidae). In: Müllen,

G.,Durden, L. (Eds.), Medical and Veterinary Entomology. Academic Press,

London,pp. 518–558.

Tamura K., Stecher G., Peterson D., Filipski A., and Kumar S. 2013. MEGA6: Molecular

Evolutionary Genetics Analysis version 6.0. Molecular Biology and Evolution, 30:

2725-2729.

Vial, L., 2009. Biological and ecological characteristics of soft ticks (Ixodida: Argasidae)

and their impact for predicting tick and associated disease distribution. Parasite 16,

191–202.

Wikel, S., 2013. Ticks and tick-borne pathogens at the cutaneous interface: host

defenses, tick countermeasures, and a suitable environment for pathogen

establishment. Front. Microbiol. 4, 337.

Willadsen, P. 2008. Antigen cocktails: valid hypothesis or unsubstantiated hope?

Trends Parasitol. 24, 164-167.

23

Figure captions.

Figure 1. Neighbour-joining analysis of the TSGP4-related soft tick lipocalins. Lipocalins

were retrieved from the GeneBank non-redundant database by BLASTP analysis of

TSGP4. Sequences showing an E-value lower than 10-10 were selected for ClustalW

alignment and phylogenetic analysis. Evolutionary distances were computed using the

Poisson correction method. Branch support values (10,000 bootstraps) for nodes are

indicated. Genbank accession numbers are included in brackets. Right column

indicates the percentages of sequence identity between OmTSGP4 and its

orthologues.

Figure 2. Alignment of Ornithodoros moubata and O. savignyi TSGP4s. The conserved

amino acids are labelled with asterisks, the conservative and semi-conservative

substitutions are labelled with two and one point, respectively. Secondary structures

were obtained from structure models obtained from Phyre2 server based on the

structures of the OmCI (Roversi et al., 2007). SignalP sequences are underlined.

Predicted α-helices and β-strands are indicated in red and blue colors, respectively.

Conserved cysteine residues are highlighted in grey boxes and proposed disulfide

bonds are indicated with lines.

Figure 3. A. 3D-models of O. moubata and O. savignyi TSGP4 orthologues (green and

blue, respectively). Left images show cartoon models of the lipocalin β-barrel viewed

from the side. Right images show the same structures viewed from the top of the β-

barrel looking down into the binding cavity. B. Kyte & Doolittle hydrophobicity plots for

the O. moubata and O. savignyi TSGP4 orthologues.

Figure 4. Expression and purification of recombinant OmTSGP4 (arrow). Coomassie

blue-stained 12% SDS-PAGE gels showing the supernatants (S) and pellets (P) from cell

lysates before (- IPTG) and after (+ IPTG) the induction of protein expression with IPTG,

and the supernatant and pellet after cell lysate pellet solubilisation with 8M urea.

Rightmost lane shows the purified recombinant OmTSGP4.

24

Figure 5. Reactivity in ELISA (mean OD ± SD at 492 nm) of positive (n=18) and negative

(n=21) reference porcine sera to the different O. moubata antigens and antigen

amounts tested.

Figure 6. Western blot showing the antigenic bands recognized on the recombinant O.

moubata TSGP4 and the O. moubata saliva by a pool of preimmune rabbit sera (n=3),

pooled anti-rOmTSGP4 rabbit sera (n=3), and pooled sera from rabbits bitten by O.

moubata (anti-bites) (n=3). The anti-rOmTSGP4 sera recognized both the recombinant

and the native TSGP4 protein secreted to saliva (arrow). By contrast, the anti-bites sera

did not recognize the recombinant nor the native TSGP4 in saliva.