VEGF isoforms and receptors expression throughout acute acetaminophen-induced liver injury and regeneration

Arch Toxicol (2007) 81:729–741

ORGAN TOXICITY AND MECHANISMS

VEGF isoforms and receptors expression throughout acute acetaminophen-induced liver injury and regeneration

Vasilios P. Papastefanou · Evangelos Bozas · Michael G. Mykoniatis · Agni Grypioti · Stavros Garyfallidis · Christos S. Bartsocas · Polyxeni Nicolopoulou-Stamati

Received: 16 November 2006 / Accepted: 28 February 2007 / Published online: 13 April 2007© Springer-Verlag 2007

Abstract Acetaminophen (APAP) is a widely-used anal-gesic and a known hepatotoxic agent. Vascular endothelialgrowth factor (VEGF) is a growth factor with multiplefunctional roles. VEGF plays an important role in angio-genesis and hepatic regeneration. The aim of this study wasto determine the expression of VEGF isoforms and itsreceptors throughout liver regeneration after the adminis-tration of a toxic dose of APAP in rats. Ten groups of adultmale rats received a dose of 3.5 g/kg b.w. of APAP per os.The rats were killed post administration at 0–288 h. Bloodand liver tissue were extracted. Determination of serumtransaminases and alkaline phophatase activities was per-formed. Liver injury and regeneration were assessed withhematoxylin-eosin specimens, morphometric analysis,hepatic thymidine kinase assay and Ki-67 expression.Reverse transcription-polymerase chain reaction andimmunohistochemical methods were used for assessmentof VEGF isoforms and receptors diVerential expression.High activities of aspartate aminotransferase were observed

at 24 and 36 h with another peak of activity at 192 h postadministration. Alanine aminotransferase was highest at36 h. Alkaline phophatase was increased post 24 h beinghigher at 72,192 and 240 h. Centrilobular necrosis wasobserved at 48–72 h and thorough restoration of the livermicroarchitecture was observed at 288 h. Liver regenera-tion lasted from 24–192 h according to the results from thy-midine kinase activity and Ki-67 expression. VEGF andVEGF receptor-2 m-RNA levels presented with a three-peak pattern of expression at 12–24, 72–96 and 192–240 hpost administration. SigniWcant diVerence was notedbetween periportal and centrilobular immunohistochemicalexpression. VEGF proves to play a critical role duringAPAP-induced liver regeneration as it presents with threepoints of higher expression. The Wrst two time points areassociated with the initial inXammatory reaction to the nox-ious stimulus and the hepatocyte regenerative processwhere as the third one is indicative of the potential involve-ment of VEGF in processes of remodeling

Keywords Liver regeneration · Acetaminophen · VEGF · VEGFR1 · VEGFR2

AbbreviationsVEGF Vascular endothelial growth factorVEGFR Vascular endothelial growth factor receptorVPF Vascular permeability factorAPAP Acetyl para-amino phenol (acetaminophen)NAPQI N-acetyl-p-benzoquinone-imineALT Alanine aminotransferaseAST Aspartate aminotransferaseALP Alkaline phosphataseHGF Hepatocyte growth factorHIF-1� Hypoxia inducible factor 1�IL Interleukin

V. P. Papastefanou (&) · M. G. Mykoniatis · A. GrypiotiDepartment of Experimental Pharmacology, Medical School, University of Athens, Mikras Asias 75, Goudi, 115 27 Athens, Greecee-mail: [email protected]

E. Bozas · C. S. BartsocasPediatric Research Laboratory, Faculty of Nursing, University of Athens, Athens, Greece

S. GaryfallidisDepartment of Biochemistry, Patision General Hospital, Athens, Greece

P. Nicolopoulou-StamatiDepartment of Pathology, University of Athens, Athens, Greece

123

730 Arch Toxicol (2007) 81:729–741

MIP-2 Macrophage inhibitory protein-2MCP-1 Monocyte chemoattractant protein-1TNF Tumor necrosis factor

Introduction

Acetaminophen (4’ hydroxyacetanilide, paracetamol,APAP) is a non-narcotic/analgesic/antipyretic availableover the counter since approximately 50 years. A variety oftoxic eVects has been attributed to APAP use and abuse.However, with the exception of hepatotoxicity and nephro-toxicity their incidence is very low. (Bessems and Vermeu-len 2001)

Hepatotoxicity has been attributed to the production ofthe toxic intermediate metabolite N-acetyl benzoquinoneimine (NAPQI) through interaction with members of thecytochrome P450 enzymes. Cell death is induced intrinsi-cally as NAPQI is a strong oxidant and electrophile inter-acting in both a covalent and non-covalent fashion withintracellular proteins. Covalent interaction leads to the for-mation of protein adducts inducing morphologic and func-tional changes of mitochondria, depletion of ATP andeventually centrilobular necrosis. Non-covalent interactionsaVect important enzymes such as Ca2+ ATPases, proteinphosphatases and xanthine dehydrogenases. (Bessems andVermeulen 2001)

Depletion of GSH, redox imbalances and alterations tocalcium homeostasis with fragmentation of DNA eventu-ally ensue. In addition, protein structure is disrupted, inter-mediary metabolism is inhibited, regulatory pathways andsignal transduction pathways are aVected (Jaeshke and Bajt2006).

Cell death is also induced extrinsically in associationwith the inXammatory response. Many pro-inXammatorymediators have been implicated in relation to this responsenamely, TNF, Fas, IL6-8a and 10, MIP-2, MCP-1. The acti-vation of macrophages, neutrophils and monocytes pro-vokes the involvement of NO, superoxide anions and otherreactive oxygen species. All these processes increasehepatic injury.

However, even after a hepatotoxic stimulus, the liver hasbeen shown to possess a regenerative capacity (Michalopo-ulos and DeFrances 2005). Liver regeneration is a phenom-enon that has been studied in various models ofhepatotoxicity (CCl4, ethanol, thioacetamide, cadmium andAPAP) (Liakos et al. 1999; Liatsos et al. 2003; Grypiotiet al. 2005; Theocharis et al. 1999; Margeli et al. 1993;Kanaghinis et al. 1982) but has been mostly examined inrelation to surgical removal of hepatic tissue. The model of70% partial hepatectomy by Higgins and Anderson hasbeen the gold standard in elucidating aspects of the processof liver regeneration whereas 30% partial hepatectomy has

been also applied (Assy et al. 1999). In all models, thehepatic tissue mass is restored.

The restoration of hepatic tissue would not be feasiblewithout the restoration of the hepatic microcirculation. Vas-cular endothelial growth factor A (VEGF-A), a highly con-served disulWde bonded dimeric glycoprotein (Keck et al.1997) is a member of the vascular permeability factor/VEGF family. VEGF-A, from now on VEGF, is one of themost important regulators of physiological and pathologicalangiogenesis. Many diVerent actions have been attributedto VEGF, mitogenic for endothelial and non-endothelialcells, antiapoptotic and regulatory of the vessel permeabil-ity (Ferrara 2003). VEGF is expressed after partial hepatec-tomy (70 and 30%) (Mochida et al. 1996; Shimizu et al.2005; Ishikawa et al. 1999; Sato et al. 2001; Taniguchiet al. 2001) and after acute hepatotoxic stimuli (Ishikawaet al. 1999; Ancoma-Sey et al. 1998). VEGF has been alsoadministered exogenously in models of acute and ongoingacute failure (Namisaki et al. 2006a, b) and in a model of30% hepatectomy (Assy et al. 1999; Kraizer et al. 2001)with a proven protective eVect.

Vascular endothelial growth factor gene is comprisedof eight exons separated by seven introns (Tischer et al.1991). VEGF gene is alternatively spliced to produce var-ious isoforms that vary in amino acid number accordingto the species under investigation. These isoforms havedistinct biochemical properties and bioavailability and adiVerential role in the angiogenetic process and diVerentbioavailability. The isoforms on VEGF in rats are tradi-tionally considered to be three; VEGF120, VEGF164 andVEGF188 (Finkelstein and D’Amore 2006; Kraizer et al.2001). The diVerential amino acid number and nature(Ferrara 2001) provides each isoform with diVerent prop-erties. In particular, an inverse relationship existsbetween diVusibility and heparin aYnity. VEGF120 isfreely diVusible and has the lowest aYnity for heparin.VEGF164 is a basic heparin binding protein and issecreted with an important fraction bound to the cell sur-face and the extracellular matrix and VEGF188 is basicand tightly bound to heparin binding moieties. It has beenpostulated that VEGF188 could probably play a role inangiogenesis mainly through the production of a proteo-lytic fragment that becomes diVusible. VEGF proteinsmay become available therefore to liver cells evendirectly or through plasmin related cleavage by proteaseactivation (Ferrara 2003)

Vascular endothelial growth factor binds as a homodi-mer to two tyrosine kinase receptors: VEGFR-2 mediatingthe mitogenic, angiogenic and permeability enhancingeVects of VEGF and VEGFR-1 acting as a regulator ofVEGF availability.

The aim of this paper is to examine the course of expres-sion and the importance of VEGF isoforms and principal

123

Arch Toxicol (2007) 81:729–741 731

receptors, VEGFR-1 and VEGFR-2 throughout APAP-induced liver toxicity and regeneration.

Materials and methods

Experimental animals

Adult male Sprague Dawley rats (Hellenic Pasteur Institute,Athens, Greece) weighing 200–220 g were used for thisstudy. All animals received humane care in accordancewith the European Union Directive 609/86 for care and useof laboratory animals. Rats were kept at the laboratory pre-mises for 5 days before any manipulation and were fed adlibitum under a 12 h/12 h light/dark cycle. Animals werestarved for 12 h prior to administration of APAP as shownin the past (Tygstrup et al. 1997; Grypioti et al. 2005).Administrations were performed at 07:00–09:00 h.

Ten groups of rats (n = 5) received per os an APAP(Sigma-Aldrich) 3.5 g/kg in solution diluted with 0.2%tragacanth (Sigma-Aldrich) with the use of a gastric tube(Fine Science Tools). The animals of the control groupreceived an equal volume of water. The animals were sacri-Wced under light diethyl ether anesthesia at 12, 24, 36, 48,72, 96, 144, 192, 240 and 288 h post administration. Whileunder light anesthesia, blood was drawn from the heart andimmediately after exsanguination livers were removed,cleaned and weighted. Small portions of the livers werekept frozen at ¡70°C for biochemical assays whereasanother portion was separated and immersed in buVeredformalin solution for histologic examination. Another por-tion (100 mg) was immersed in guanidinium-based dena-turation solution for total RNA extraction.

Biochemical analysis

All serum samples were sterile, hemolysis-free and wereused for the determination of the enzymatic activity of ala-nine aminotransferase (ALT), aspartate aminotransferase(AST) and alkaline phosphatase (ALP). Enzyme levelswere determined with the use of a random-access chemistryanalyzer (RA-1000, Technicon Instruments Corp., Tarry-town, NY, USA)

Thymidine kinase assay

The enzymatic activity of TK was determined by themethod of Kahn et al. (1988) in the supernatant obtainedafter homogenization of liver samples and ultracentrifuga-tion at 105,000g for 1 h at 4°C with an ultracentrifuge(Model L5-75; Beckmann Instruments, Fullerton, CA,USA). Duplicate aliquots of each sample were spottedonto diethylaminoethyl cellulose disks. The disks were

counted for their radioactivity in a liquid scintillationcounter (1211 Rackbeta; LKB-Wallace). The speciWcactivity of 3H-thymidine was 925 GBq/mol (3.79 GBq/mg). The protein was determined by the method of Lowry(1951). The activity of the enzyme TK was expressed ascpm/min/mg of protein.

Isolation of RNA

Hundred milligrams of liver tissue samples were placed inguanidinium-based denaturation solution and werehomogenized immediately after resection. Isolation oftotal RNA ensued from the lysates with the use of ToTallyRNA kit from Ambion Inc. according to the instructionsof the manufacturer. The absorbance of each RNA isolatewas estimated with the use of a UV phasmatophotometer(Perkin-Elmer) at 260 and 280 nm. Absorbances wereused for the calculation of the concentration of RNA persample.

c-DNA synthesis

Five micrograms of total RNA were then reverse tran-scribed with the use of the SuperScript First Strand Synthe-sis for RT-PCR kit (Invitrogen) according to theinstructions of the manufacturer.

PCR

The c-DNA Wrst strand obtained from the previous proce-dure was ampliWed directly by PCR. Ten percent of theoriginal amount (2 �l) was used.

The primers used for the ampliWcation of DNA ofVEGF, VEGFR-1, VEGFR-2, are presented in Table 1. Thehousekeeping gene GAPDH was examined as internal stan-dard per sample.

An initial solution of 50 �l was produced containing perreaction 10£ PCR buVer with (NH4)2SO4, MgCl2 2 mM,0.2 �M d-NTP mix, autoclaved, distilled water and 0.2 ��sense and antisense primers. Negative controls (no-RT) andblank controls were included in each reaction. PCR ampliW-cation ensued with the use of Taq polymerase by Fermentasin a thermal cycler. The number of cycles was predeter-mined by an initial control ampliWcation of random c-DNAsamples between 28 and 36 cycles. The optimum number ofPCR cycles eventually chosen for the Wnal ampliWcationrepresented the exponential ampliWcation of the product yield.

QuantiWcation of the PCR product

The PCR product was quantiWed with the performance of1.5% agarose gel electrophoresis in 1£ Tris–borate buVer.The detected bands were ethidium-bromide stained. Polaroid

123

732 Arch Toxicol (2007) 81:729–741

images were acquired and scanned for each reaction. PCRproducts were measured with the use of GelPro Analyzersoftware (Media Cybernetics) and the Wnal evaluation wasdone in comparison to the expression of GAPDH for eachsample.

Histopathological evaluation

For liver histopathology analysis, midsections of the leftlobes of the liver were processed for light microscopy.Each specimen was Wxed in 4% buVered neutral formalinsolution for 24 h, embedded in paraYn wax, sliced at 5 �mthick sections and stained with hematoxylin and eosin.Each specimen was then photographed with a digital photocapture microscopic system. (Nikon Eclipse 80i micro-scope, DS-2MBWc-L1Cooled monochrome digital camerawith L1 controller)

Morphometric analysis

Morphometric analysis of each tissue sample was per-formed with the use of the Sigma Scan Pro analyzer (Systatsoftware). In particular, the average distance between cen-tral venules and portal triads was evaluated. Ten measure-ments were taken per three visual Welds per tissue sample.Distances were expressed in micrometers (�m)

Immunohistochemical analysis

Liver samples were deparaVinized and rehydrated. Eachspecimen was then covered with 3% hydrogen peroxideand incubated for 5 min. The specimens were gently rinsedwith distilled water and placed in fresh buVer bath. ExcessbuVer was removed and primary antibodies covered eachspecimen overnight at 4°C. The primary antibodies usedwere VEGF sc 7269 (Santa Cruz) diluted at 1/100 v/v, Flk-1 (VEGFR-2) sc 6251 (Santa Cruz) and Ki-67 (Lab Vision)rm-9106-S. Rabbit Link drops and streptavidin peroxidasedrops were then placed followed by addition of substratechromogen solution. Finally, each specimen was counter-

stained with hematoxylin. Slides were then mounted andcoverslipped with DPX.

Each sample was photographed with the use of a NikonEclipse 80i microscope with the use of a DS-2MBWc-L1Cooled monochrome digital camera with L1 controller.For the assessment of the spatial expression of VEGF andVEGFR2 ten optical Welds per sample were taken in 20£objective magniWcation. Out of these, Wve were takenfocusing on the centrilobular and Wve on the periportal areain order to examine the diVerential immunohistochemicalexpression in these areas for each sample.

For the assessment of Ki-67 expression Wve optical Weldswere taken per sample in 10£ objective magniWcation andthe total of staining nuclei was calculated per 1,000 cellsper Weld.

QuantiWcation was made with the use of SigmaScan Pro5 for Windows (Systat software).

Statistical analysis

All statistical analyses were performed with the SPSS 11for Windows. The statistical signiWcance among groupswas evaluated with the use of one-way ANOVA. For posthoc analysis Tukey’s multiple comparison test was used.P < 0.05 was considered statistically signiWcant for twotails. The diVerential expression between groups was evalu-ated with the use of Mann–Whitney U non-parametric test.

Results

Serum enzyme activities

As observed in Fig. 1a, ALT enzymatic activity peaks at36 h post administration (P < 0.001, one-way ANOVA vscontrol) and AST enzymatic activity peaks at 24–48 h(P < 0.01 at 36 h vs control and P < 0.05 at 24 and 48 h,one way ANOVA). A second peak of AST activity wasobserved at 192 h post administration (P < 0.001 vs controlone-way ANOVA). High levels of ALP (Fig. 1b) activities

Table 1 The sequences of sense and antisense primers used for the determination of the m-RNA expression of VEGF, VEGF receptors and GAP-DH in liver regeneration after acetaminophen intoxication as used in the past

a Rosmorduc et al. 1999 b Sato et al. 2001

Factors Sense (5�–3�) Antisense (5�–3�) Annealing temperature (°C)

VEGFa ACCTCCACCATGCCAAGT TAGTTCCCGAAACCCTGA 60

VEGFR-1b AGGAGAGGACCTGAAACTGTCTT ATTCCTGGGCTCTGCAGGCATAG 60

VEGFR-2b GTGATTGCCATGTTCTTCTGGC TCAGACATGAGAGCTCGATGCT 60

GAPDHa CCATGGAGAAGGCTCGGG CAAAGTTGTCATGGATGACC 57

123

Arch Toxicol (2007) 81:729–741 733

are maintained post 24 h till 288 h with the highest of themobserved at 72, 192 and 240 h.

Hepatic thymidine kinase activity

Thymidine kinase activity is presented in Fig. 2. Thymidinekinase activity presented a gradual increase from 36 to

144 h to eventually reach control levels at 288 h postadministration.

Ki-67 immunohistochemical expression

Ki-67 expression is depicted in Fig. 3a and b. As observed,the expression is increased signiWcantly at 24, 72 and 96 hdue to the vast regeneration of hepatocytes (P < 0.01 at24 h, P < 0.001 at 72 and 96 h and P < 0.05 at 192 h vs con-trol) localized at periportal and midzonal areas. Ki-67expression subsides post 192 h and does not return to con-trol values at 288 h.

Hematoxylin and eosin

The principal Wndings of the histopathological analysiswere extensive centrilobular necrosis at 48 h with theappearance of mitotic nuclei at 72 and 96 h post administra-tion and restoration of the hepatic architecture at 288 h.(Fig. 4a, b and c)

Morphometric analysis

As presented in Fig. 5 the distance from the central vein tothe portal triad was found to be signiWcantly higher at24 h (P < 0.05 vs control, one-way ANOVA) thereafterdecreasing at 36 h and returning within control levels at240 h. Non-signiWcant increases were found at 12 h andbetween 36 and 192 h. Surprisingly, at 288 h the meandistance was slightly above control though not statisti-cally signiWcant.

Fig. 1 a Serum aspartate aminiotransferase (AST) and alanine amino-transferase (ALT) activities after acute acetaminophen intoxication inrats with 3.5 g APAP/kg bodyweight per os. Results represent the Wnd-ings in all groups examined at 12, 24, 36, 48, 72, 96, 144, 192, 240 and288 h after administration in relation to control values. Values are ex-pressed as means § SE. *P < 0.05 **P < 0.01 ***P < 0.001 level ofstatistical signiWcance in relation to control (one-way ANOVA, Tu-key’s post hoc test). b Serum alkaline phosphatase (AP) levels afteracute acetaminophen intoxication in rats with 3.5 g APAP/kg body-weight per os. Results represent the Wndings in all groups examined at12, 24, 36, 48, 72, 96, 144, 192, 240 and 288 h after administration inrelation to control values. Values are expressed as means § SE.**P < 0.01 ***P < 0.001 level of statistical signiWcance in relation tocontrol (one-way ANOVA, Tukey’s post hoc test)

Fig. 2 Thymidine kinase activities after acute acetaminophen intoxi-cation in rats with 3.5 g APAP/kg bodyweight per os. Results representthe Wndings in all groups examined at 12, 24, 36, 48, 72, 96, 144, 192,240 and 288 h after administration in relation to control values. Valuesare expressed as means § SE. *P < 0.05 ***P < 0.001 level of statis-tical signiWcance in relation to control (one-way ANOVA, Tukey’spost hoc test)

123

734 Arch Toxicol (2007) 81:729–741

Expression of VEGF

m-RNA expression

The diVerential m-RNA expression of VEGF isoforms isdepicted at Fig. 6. VEGF188 m-RNA expression was highlyexpressed throughout the period examined. It did not present

with a statistically signiWcant alteration yet was decreasedat 36 and 288 h. However, VEGF164 peaked at 72 and 192 h(P < 0.05 vs control, one-way ANOVA). VEGF144 wasincreased at 24, 72 and 240 h post administration (P < 0.05vs control, one-way ANOVA). VEGF120 was increased in asimilar three peak fashion however peaking at 72 h(P < 0.05 vs control, one way ANOVA) and at 192–288 h

Fig. 3 a Ki-67 expression dem-onstrated in liver sections (H + E £20 objective magniWcation) af-ter acute acetaminophen intoxi-cation in rats with 3.5 g APAP/kg bodyweight per os. The expression of staining nuclei is depicted at 0, 24, 72, 96, 192 and 288 h respectively. b. Ki-67 expression after acute acetami-nophen intoxication in rats with 3.5 g APAP/kg bodyweight per os. Results represent the Wndings in all groups examined at 12, 24, 36, 48, 72, 96, 144, 192, 240 and 288 h after administration in relation to control values. Values are expressed as means § SE. *P < 0.05 **P < 0.01 ***P < 0.001 level of statistical signiWcance in relation to control (one-way ANOVA, Tukey’s post hoc test)

123

Arch Toxicol (2007) 81:729–741 735

(P < 0.001 vs control, one way ANOVA). As observed,VEGF120 was the isoform peaking among isoforms at240 h.

Immunohistochemical expression

Vascular endothelial growth factor expression increased at24 h in both pericentral (P < 0.05 vs control) and periportalareas (P < 0.001 vs control). Thereafter the pericentralexpression increased at 72 h (P < 0.001 vs control) and the

periportal expression was high at 240 h (P < 0.001 vs con-trol) as presented in Fig. 7a, b and c. At 288 h, VEGF didnot return to control levels.

Expression of VEGF receptors

VEGFR2 m-RNA expression (Fig. 8a) presents with a two-peak pattern, namely, a signiWcant increase at 24 h(P < 0.05 vs control) and at 96 h (P < 0.05 vs control).Expression returns to control levels at 240 h decreasing fur-ther at 288 h.

The diVerential expression of VEGFR-2 at periportaland pericentral areas (Fig. 8b) peaked at 24 h in both areas(pericentral: P < 0.05 vs control, periportal: P < 0.001 vscontrol) (Fig. 9). At 36 and 48 h the expression was high atthe periportal and midzonal areas with no expression in thenecrotic areas. A second peak of expression was noted at72 h in both areas (pericentral: P < 0.01 vs control, peripor-tal: P < 0.001 vs control). A third peak of expression wasnoted at the pericentral area at 144 h (35.02 § 2.52%P = 0.01 vs control, one-way ANOVA) and 192 h(40.13 § 2.66%, P < 0.01 vs control, one way ANOVA).

VEGFR1 m-RNA expression though increased at 24 hdid not present with any statistically signiWcant alterationsthroughout the period examined.

Discussion

Liver regeneration is a complex phenomenon that has beenstudied extensively in the past years and still currentresearch yields important Wndings. As noted before, the

Fig 4 a Centrilobular necrosis demonstrated in liver after acute acet-aminophen intoxication in rats with 3.5 g APAP/kg bodyweight per osat 48 h post administration (H + E £20 objective magniWcation). b Mi-totic nuclei (white arrowheads) developing around the central vein at72 h post administration (H + E £40 objective magniWcation). c He-patic architecture in process of restoration at 240 h post administration(H + E £10 objective magniWcation)

Fig. 5 Mean distance of central vein to portal triad after acute acet-aminophen intoxication in rats with 3.5 g APAP/kg bodyweight per os.Results represent the Wndings in all groups examined at 12, 24, 36, 48,72, 96, 144, 192, 240 and 288 h after administration in relation to con-trol values. Values are expressed as means § SE. *P < 0.05 level ofstatistical signiWcance in relation to control (one-way ANOVA, Tu-key’s post hoc test)

123

736 Arch Toxicol (2007) 81:729–741

predominant model for the analysis of liver regeneration todate has been the model of Higgins and Anderson, i.e., 70%partial hepatectomy. (Higgins and Anderson 1931). Theloss of hepatic tissue, however, has scarcely been due tosurgical removal. In the vast majority of cases, toxic, infec-tious or immunological causes are responsible for such aneVect. (Czaja 1995)

One of these causes is APAP, a common over thecounter analgesic with a known hepatotoxic action uponadministration of massive doses. Cases of intentional oraccidental poisoning with APAP increase yearly in theUnited States and the United Kingdom making APAP over-dose the most frequent cause of drug-induced liver failure(Lee 2004)

The aim of this paper was to determine the criticalimportance of VEGF isoforms and receptors throughout theregenerative process in such a model spanning an extendedperiod of time till the complete restoration of the hepaticarchitecture. Given the growing importance and the multi-tude of the experimental and clinical applications of VEGF(Ferrara 2003) this temporal approach was expected toyield important conclusions.

To our knowledge this is the only study examining theexpression of VEGF in an APAP-induced toxicity andregeneration model in this strain of experimental animalsand for such an extended amount of time. For reasons ofclarity, the Wndings of the present study are discussed inthree temporal sections namely at 0–48 h, 48–144 h and144–288 h. VEGF expression in APAP intoxication in micefor a period of time up to 96 h was examined by Donahoweret al. providing an interesting set of comparative data.

Acetaminophen overdose eVect (0–48 h)

In our study, APAP toxicity was induced with a dose of3.5 g/kg, i.e, a dose with a sublethal eVect as shown in thepast (Tygstrup et al. 1997; Grypioti et al. 2005). The soluteused was a 0.2% tragacanth solution, a gum without anyhepatotoxic eVect (Anderson et al. 1984) that has been usedin the past. All animals survived post administration andthroughout the period of time under investigation.

This dose of APAP induced a toxic eVect as was indi-cated by the rise in the levels of transaminases at 48 h postadministration and the development of massive, conXuentcentrilobular necrosis at similar time points. This pattern ofnecrosis has been attributed to the colocalization of CYP2E1 and protein adducts at zone 3 of the acinus (Nelson andBruschi 2003). In the present study, the levels of ALP wereincreased at 24 h to be approximately at the same level by48 h. In all time points they were, in the least, doubled indi-cating that APAP intoxication induces hepatocanalicularcholestasis and doubling of the ALP values as shown in thepast (Zimmerman and Ishak 1994)

As far as the hepatic regeneration following APAP intoxi-cation was concerned, by the end of 48 h post administration,thymidine kinase activity gradually increased while Ki-67expression was increased. InXammatory reaction secondaryto the development of necrosis was observed. Indicative ofthis reaction is a marked increase in the average distance ofthe central venule to the portal triad at 12–24 h. It has beenproven that APAP induces sinusoidal congestion prior tocentrilobular necrosis (DeLeve et al. 1997). Apart from that,a microvascular cast study indicated the presence of extended

Fig. 6 m-RNA expression of VEGF isoforms over time after acute acetaminophen intoxica-tion in rats with 3.5 g APAP/kg bodyweight per os. Results rep-resent the Wndings in all groups examined at 12, 24, 36, 48, 72, 96, 144, 192, 240 and 288 h after administration in relation to con-trol values. Results are displayed in conjunction with representa-tive samples from the agarose gel electrophoresis. Values are expressed as means § SE. *P < 0.05 **P < 0.01 ***P < 0.001 level of statistical signiWcance in relation to control (one-way ANOVA, Tukey’s post hoc analysis)

123

Arch Toxicol (2007) 81:729–741 737

centrilobular cavities post APAP hepatotoxicity (Lim et al.1995). In addition, a scanning electron microscope investiga-tion (Walker et al. 1983) revealed among its early Wndingsthe appearance of large pores across the sinusoidal cells andenlargement of the space of Disse. Large gaps have been

detected as early as 2 h post administration with maximallevels at 6 h (Ito et al. 2003). Erythrocytes accumulate in thespace of Disse with a collapse of the sinusoidal lumen(Walker et al. 1983) and the induction of hypoxia. Transmis-sion electron microscopy studies suggested that the regula-

Fig. 7 a Immunohistochemical expression of VEGF pericentrally andperiportally after acute acetaminophen intoxication in rats with3.5 g APAP/kg bodyweight per os. Results represent the Wndings in allgroups examined at 12, 24, 36, 48, 72, 96, 144, 192, 240 and 288 h afteradministration in relation to control values. Area of expression is in %per visual Weld. Values are expressed as means § SE. *P < 0.05**P < 0.01 ***P < 0.001 level of statistical signiWcance in relation tocontrol (one-way ANOVA, Tukey’s post hoc analysis). b Periportal

VEGF expression after acute acetaminophen intoxication in rats with3.5 g APAP/kg bodyweight per os. The images depict the expressionof VEGF periportally at 0, 12, 48, 96, 192 and 240 h post administra-tion. (cv central vein, pt portal triad). c Pericentral expression of VEGFafter acute acetaminophen intoxication in rats given 3.5 g APAP/kgbodyweight per os. The images depict the expression of VEGF peri-centrally at 0, 12, 48, 96, 192 and 240 h post administration. (cv centralvenule, pt portal triad)

123

738 Arch Toxicol (2007) 81:729–741

tion of sinusoidal porosity could be the result of intercellularinteractions (Wack et al. 2000). VEGF upregulates the poros-ity of sinusoidal endothelial cells (Funyu et al. 2001)

Vascular endothelial growth factor has been shown to beupregulated by hypoxia (Dor et al. 2001) and in particularHIF-1� a transcriptional factor whose levels increase withhypoxia (Semenza et al. 2001). Hepatic HIF-1� is induced1 h after a toxic administration of APAP in mice (Jameset al. 2006).

In our study, VEGF164 m-RNA expression was increasedat 12–24 h, a Wnding consistent with the above. The expres-sion of VEGF144 an isoform detected in hepatic stellatecells subjected to hypoxic stimuli in the past (Ancoma-Seyet al. 2000) is also increased at the same time points.VEGF144 has not been classiWed as one of the principal iso-forms of VEGF in the rat (Finkelstein and D’Amore 2006),however, it has been characterized mostly as a VEGF 120/164

heteroduplex in the past. (Eckhart et al. 1999). Therefore, itis not clear whether the change in its levels of expression isthe result of “autonomous” behavior or is in direct correla-tion to VEGF164 or the non-signiWcant increase ofVEGF120. Similar results were noted in a recent model ofAPAP toxicity in mice (Donahower et al. 2006) withVEGF-A protein expression levels increasing at 24 h.

Vascular endothelial growth factor immunohistochemi-cal expression was increased periportally and pericentrallyat 24 h to decrease thereafter due to the development ofconXuent necrosis. The same pattern of staining was notedin a similar model (Donahower et al. 2006). On the otherhand, this pattern is completely diVerent in relation to car-bon tetrachloride hepatotoxicity model. CCl4 induces cen-trilobular necrosis with marked inXammation and VEGFstaining in the inWltrating areas and slightly in the non-necrotic areas. (Ishikawa et al. 1999)

VEGF tyrosine kinase receptors VEGFR-1 and VEGFR-2 have distinct roles. VEGFR-2 has been characterized asthe key signaling receptor and VEGFR-1 as the decoyreceptor regulating the activity of VEGF in a negative fash-ion rendering this ligand less available to VEGFR-2. (Ferr-ara 2001). Sinusoidal endothelial cells and hepatic stellatecells in vitro (Mashiba et al. 1999; Ankoma-Sey et al.1998) express VEGFR-1 and VEGFR-2 receptors (Yamane1994).The responsiveness of stellate cells to VEGF in asso-ciation with the fact that they bear components of the plas-minogen system (urokinase-type, tissue type plasminogen

Fig. 8 a m-RNA expression of VEGF receptors after acute acetami-nophen intoxication in rats given 3.5 g APAP/kg bodyweight per os.*P < 0.05 Mann–Whitney U test. b Immunohistochemical expressionof VEGFR2 *P < 0.05 ***P < 0.001 one way ANOVA

Fig. 9 VEFGR-2 expression may occur as early as 24 h post inges-tion. (cv central vein, pt portal triad)

123

Arch Toxicol (2007) 81:729–741 739

activator, metalloproteinase interstitial collagenase) is asso-ciated with the degradation of the extracellular matrix andthe release of VEGF. It could also indicate responsivenessof other pericytes to VEGF (Ancoma-Sey 1998). Bindingof VEGF to VEGFR-1 does have a negative eVect on sinu-soidal endothelial cell proliferation but regulates the perme-ability of sinusoidal endothelial cells. Apart from thatVEGFR-1 activation has been implicated in the inductionof HGF and other mitogenic/survival factors after the bind-ing of VEGF (Le Couter et al. 2003)

In our study the m-RNA expression of VEGFR-1 andVEGFR-2 increased at 24 h post administration. A similarpattern of expression was noted in a model of partial hepa-tectomy (Sato et al. 2001) and a model of CCl4 intoxication(Ishikawa et al. 1999). The protein expression of VEGFR-1and VEGFR-2 was diVerent temporally in a model ofAPAP-induced toxicity in mice. (Donahower et al. 2006).DiVerent parameters of this study could account forobserved diVerences. The peak of VEGFR-1 at 24 h isimportant in the process of liver regeneration consideringthe mitogenic eVect of its activation.

Tissue repair and regeneration (48–144 h)

At 72–96 h after APAP administration the extent of thenecrotic areas subsides considerably and mitotic nucleiappear around the central vein. Thymidine kinase activityincreases progressively from 36 h to peak at 144 h. The lev-els of transaminases have declined. Ki-67 peaks at 72 and96 h. At the same time points, VEGF isoform m-RNAexpression peaks signiWcantly in relation to control whereasVEGF and its receptors are highly expressed around thecentral vein and the portal triad. Similar Wndings areencountered in various models of 70% partial hepatectomy.(Sato et al. 2001; Ishikawa et al. 1999; Shimizu et al.2005). Post carbon tetrachloride intoxication VEGF expres-sion was marked at 168 h. (Ishikawa et al. 2001) SinusoidalXow has been found to be enhanced during the regenerativeprocess. (Shimizu et al. 2001) This element in combinationwith the mitoses observed lead to an increase of the hepaticdistance between the central vein and the portal triad at72 h, indicative of regeneration and is the result of theincreased activity of VEGF.

The above Wndings are in striking diVerence with amodel of APAP-induced hepatotoxicity in mice in whichVEGF, VEGFR-1 and VEGFR-2 are only moderatelyexpressed at 72 h and VEGFR-3 a receptor for VEGF-Cand VEGF-D involved in the process of lymph angiogene-sis (Donahower et al. 2006; Yamazaki and Morita 2006)peaks at 72 h. Such a diVerence could be attributed to inter-species diVerence, the dosage of APAP or the mode ofadministration. These Wndings suggest directly the impor-tance of VEGF-A in liver regeneration.

Late stages—VEGF and remodeling (144–288 h)

The results during the later stages of the time period exam-ined are of particular interest. VEGF isoform expressionpeaks at 192 h, remains at 240 h at relatively high levels,above control values and with a reversal in the isoformexpression proWle—VEGF120 expression surpassing allother isoforms, an element maintained at 288 h as well. Inaddition, VEGFR-2 m-RNA expression increases at 240 h.VEGFR-2 has been demonstrated to have a predilection forlarge vessel endothelial cells and the fraction of sinusoidalendothelial cells close to the large vessels (Ross et al. 2001)during regeneration. In our study this predilection becameevident at 144–192 h post administration.

Morphometrically the distance between portal triads andhepatic venules returns within control values at 240 h torise again at 288 h, indicative of a remodeling proceduretaking place during this stage whereas at the same time Ki-67 expression does not return within control values and pre-sents a higher expression in relation to control at 192 hindicative of a proliferative activity at a later stage.

All these elements occurring at this stage are indicativeof the critical importance of VEGF in liver remodeling inthis model of hepatotoxicity. This temporal expression pro-Wle of VEGF is in direct contradiction with 70% partialhepatectomy studies in which no VEGF peak was encoun-tered post 72 h. (Shimizu et al. 2005; Sato et al. 2001).However, the time period between 144 and 240 h was notexamined in the Wrst study and the second study did notextend beyond 168 h. On the other hand, an increase inVEGF expression at 240 h. was noted at another model ofhemihepatectomy (Sturm et al. 2004).

One interesting result is the increase observed in AST at192 h post administration. This elevation is not in accor-dance with the histological Wndings. Similar discrepanciesbetween histological Wndings and enzyme values have beenreferred in the past. This could be attributed to decreasedclearance of these enzymes from the circulation (Dona-hower et al. 2006).

Acute APAP administration induces renal cortical necro-sis (Abraham et al. 2005) and Wlling of the tubular lumenwith necrotic debris. Moreover, acute renal toxicity is char-acterized by cellular injury primarily conWned at the proxi-mal tubule and signiWcant reductions in the glomerularWltration rate (Bessems and Vermeulen 2001; Blantz 1996).The diminished GFR could be attributed to the tubularobstruction and the elevated fractional excretion of Na+ dueto a decrease in the activity and the abundance of Na+-K+

ATPase (Trumper et al. 2000). This decrease could be dueto detachment of the ATPase from its membrane anchoring(Trumper et al. 2005). However, the renal damage is notassociated to the extent of the hepatic damage (Bessemsand Vermeulen 2001).

123

740 Arch Toxicol (2007) 81:729–741

Further studies need to be performed in relation to thattime point, addressing the expression of molecules ofproven importance in remodeling and the nature of theirrelation to VEGF (Eklund and Olsen 2006). It is evidentthat the phenomenon of liver regeneration still has a lot ofimportant elements that have not yet been clearly eluci-dated. VEGF proves once more to be critical after APAP-induced liver injury but equally important when it comes tothe restoration of hepatic tissue mass and the remodeling ofhepatic architecture.

Acknowledgements To Zoe Papadopoulou-Daifoti and George Sy-kiannakis for their substantial support. To Nikolaos Kavantzas andGeorge Agrogiannis for their help concerning the image acquisitionprocess. To Maria Kemerli and Argiro Papageorgiou for their help intechnical issues.

References

Abraham P, Kanakasabapathy I, Bondu JD (2005) Propylthiuracilattenuates acetaminophen-induced renal damage in the rat.Nephrology 10:588–593

Ancoma-Sey V, Matli M, Chang KB, Lalazar A, Donner DB, Wong L,Warren RS, Friedman SL (1998) Coordinated induction of VEGFreceptors in mesenchymal cell types during rat hepatic woundhealing. Oncogene 17:115–121

Ancoma-Sey V, Wang Y, Dai Z (2000) Hypoxic stimulation of vascu-lar endothelial growth factor expression inactivated rat hepaticstellate cells. Hepatology 31:141–148

Anderson DM, Ashby P, Busuttil A, Kempson SA, Lawson ME (1984)Transmission electron microscopy of heart and liver tissues fromrats fed with gums arabic and tragacanth. Toxicol Lett 21(1):83–89

Assy N, Spira G, Paizi M, Shenkar L, Kraizer Y, Kohen T, Neufeld G,Dabbah B, Enat R, Baruch Y (1999) EVect of VEGF on hepaticregenerative activity following partial hepatectomy in rats. J Hep-atol 30:911–915

Bessems JGM, Vermeulen NPE (2001) Acetaminophen-induced tox-icity: molecular and biochemical mechanisms, analogues and pro-tective approaches. Crit Rev Toxicol 31(1):55–138

Blantz RC (1996) Acetaminophen acute and chronic eVect on renalfunction. Am J Kidney Dis 28(S1):S3–S6

Czaja MJ (1995) Liver regeneration following hepatic injury. In: StrainAJ, Diehl AM (eds) Liver growth and repair. Chapman and Hall,London, pp 28–49

DeLeve LD, Wang X, Kaplowitz N, Shulman HM, Bart JA, Van DerHoek A (1997) Sinusoidal endothelial cells as a target for acet-aminophen toxicity. Biochem Pharmacol 53:1339–1345

Donahower B, McCullough SS, Kurten R, Lamps LW, Simpson P,Hinson JA, James LP (2006) Vascular endothelial growth factorand hepatocyte regeneration in acetaminophen toxicity. Am JPhysiol Gastrointest Liver Physiol 291(1):G102–G109

Dor Y, Porat R, Keshet E (2001) Vascular endothelial growth factorand vascular adjustments to perturbations in oxygen homeostasis.Am J Physiol Cell Physiol 280:C1367–C1374

Eckhart L, Bau J, Ballan G, Weninger W, Tschachler E (1999) Reversetranscription-polymerase chain reaction products of alternativelyspliced mRNAs form DNA heteroduplexes and heteroduplexcomplexes. J Biol Chem 274(5):2613–2615

Eklund L, Olsen BR (2006) Tie receptors and their angiopoietinligands are context-dependent regulators of vascular remodeling.Exp Cell Res 312:630–641

Ferrara N (2001) Role of vascular endothelial factor in regulation ofphysiological angiogenesis. Am J Cell Physiol 280:C1358–C1366

Ferrara N (2003) The biology of VEGF and its receptors. Nat Med9(6):669–676

Finkelstein EB, D`Amore PA (2006) VEGF-A and its isoforms. In:Shepro D (ed) Microvascular research, vol 1. Elsevier/AcademicPress, Amsterdam/Boston/Heidelberg/London/New York/Ox-ford, pp 41–46

Funyu J, Mochida S, Inao M, Matsui A, Fujiwara K (2001) VEGF canact as vascular permeability factor in the hepatic sinusoidsthrough upregulation of porosity of endothelial cells. BiochemBiophys Res Commun 280(2):481–485

Grypioti AD, Theoharis SE, Papadimas GK, Demopoulos CA, Papad-opoulou-Daifoti Z, Basayiannis AC, Mykoniatis MG (2005)Platelet-activating factor (PAF) involvement in acetaminophen-induced liver toxicity and regeneration. Arch Toxicol 79:466–474

Higgins GM, Anderson RM (1931) Experimental pathology of the liv-er: restoration of the liver of the white rat following surgical re-moval. Arch Pathol 12:186–202

Ishikawa K, Mochida S, Mashiba S, Inao M, Matsui A, Ikeda H, OhnoA, Sibuya M, Fujiwara K (1999) Expressions of vascular endo-thelial growth factor in nonparenchymal as well as parenchymalcells in rat liver after necrosis. Biochem Biophys Res Commun254:587–593

Ito Y, Bethea NW, Abbil E, McCuskey RS (2003) Early hepatic micro-vascular injury in response to acetaminophen toxicity. Microcir-culation 10:391–400

Jaeshke H, Bajt ML (2006) Intracellular signaling mechanisms ofacetaminiphen-induced liver cell death. Toxicol Sci 89(1):31–41

James LP, Donahower B, Burke AS, McCullough S, Hinson JA (2006)Induction of the nuclear factor HIF-1� in acetaminophen toxicity:evidence for oxidative stress. Biochem Biophys Res Commun343:171–176

Kahn D, Svanas GW, Eagon PK, Makowka L, Podesta L, Chapchap P,Starzl TE, Van Thiel DH (1988) EVect of an antiandrogenic H2receptor antagonist on hepatic regeneration in rats. J Lab ClinMed 112:232–239

Kanaghinis T, Avgerinos A, Scliros P, Kalantzis N, Hatzioannou J,Nikolopoulou P, Anagnostou D, Katsas A, Demopoulos J, Reko-umis G, Stathakos D (1982) Plasma lipoprotein pattern in relationto liver histology after toxic hepatitis and experimental biliaryobstruction in rabbits. Am J Gastroenterol 77(7):512–522

Keck RG, Berleau L, Harris R, Keyt BA (1997) DisulWde structure ofthe heparin binding domain in VEGF. Arch Biochem Biophys344(1):103–113

Kraizer Y, Mawasi N, Seagal J, Paizi M, Assy N, Spira G (2001) Vas-cular endothelial growth factor and angiopoietin in liver regener-ation. Biochem Biophys Res Commun 287(1):209–215

LeCouter J, Moritz D, Li B, Phillips GL, Liang XH, Gerber HP, HillanKJ, Ferrara N (2003) Angiogenesis independent endothelial pro-tection of liver: role of VEGFR-1. Science 299:890–893

Lee WM (2004) Acetaminophen and the U.S. acute liver failure studygroup lowering the risks of hepatic failure. Hepatology 42:110–116

Liakos AA, Mykoniatis MG, Kokala ME, Papadimitriou DG, LiatsosGD (1999) Levels of hepatic stimulator substance inliver regener-ating process of partially hepatectomized rats pretreated with asingle dose of carbon tetrachloride. Dig Dis Sci 44:1046–1053

Liatsos GD, Mykoniatis MG, Margeli AP, Liakos AA, Theocharis SE(2003) EVect of acute ethanol exposure on hepatic stimulator sub-stance (HSS) levels during liver regeneration. Protective functionof HSS. Dig Dis Sci 48:1929–1938

Lim SI, Andrews FJ, O’Brien PE (1995) Acetaminophen inducedmicrovascular injury in the rat liver: protection with misoprostol.Hepatology 22:1776–1781

123

Arch Toxicol (2007) 81:729–741 741

Lowry OH, Roscbrough NJ, Farr AL, Randall RJ (1951) Protein mea-surement with the folin phenol reagent. J Biol Chem 193:265–275

Margeli A, Theocharis S, Skaltsas S, Skopelitou A, Mykoniatis MG(1993) EVect of cadmium on liver regeneration after partial hep-atectomy in rats. Environ Health Perspect 102(Suppl 3):273–276

Mashiba S, Mochida S, Ishikawa K, Inao M, Matsui A, Ohno A, IkedaH, Nagoshi S, Shibuya M, Fujiwara K (1999) Inhibition of hepaticsatellite contraction during activation in vitro by vascular endo-thelial growth factor in association with upregulation of FLT tyro-sine kinase receptor family, FLT-1. Biochem Biophys ResCommun 258:674–678

Michalopoulos GK, DeFrances M (2005) Liver regeneration. Adv Bio-chem Eng Biotechnol 93:101–134

Mochida S, Ishikawa K, Inao M, Shibuya M, Fujiwara K (1996) In-creased expressions of vascular endothelial growth factor and itsreceptors Xt-1 and KDR.Xk-1 in regenerating rat liver. BiochemBiophys Res Commun 226:176–186

Namisaki T, Yoshiji H, Kojima H, Yoshii J, Ikenaka Y, Noguchi R,Sakurai S, Yanase K, Kitade M, Yamazaki M, Asada K, UemuraM, Nakamura M, Fukui H (2006a) Salvage eVect of the vascularendothelial growth factor on chemically induced acute severe liv-er injury in rats. J Hepatol 44(3):568–575

Namisaki T, Yoshiji H, Kuriyama S, Kojima H, Yoshii J, Ikenaka Y,Noguchi R, Sakurai S, Yanase K, Kitade M, Yamazaki M, AsadaK, Tsujimoto T, Akahane T, Uemura M, Fukui H (2006b) A po-tent angiogenic facroe, vascular endothelial growth factor im-proves the survival of the ongoing acute hepatic failure in rats.Hepatol Res 35:199–203

Nelson SD, Bruschi SA (2003) Mechanisms of acetaminophen-in-duced liver disease. In: Kaplowitz N, DeLeve LD (eds) Drug-in-duced liver disease. Dekker Publishing, New York, pp 287–327

Rosmorduc O, Wendum D, Corprechot C, Galy B, Sebbagh J., HoussetC, Poupon H (1999) Hepatocellular-hypoxia induced vasculargrowth factor expression and angiogenesis in experimental biliarycirrhosis. Am J Pathol 155(4):1065–1073

Ross MA, Sander CM, Kleeb TB, Watkins SC, Stolz DB (2001) Spa-tiotemporal expression of angiogenesis growth factor receptorsduring the revascularization of regenerating rat liver. Hepatology34:1135–1148

Sato T, El-Assal O, Ono T, Yamanoi A, Kumar Dhar D, Nagasue N(2001) Sinusoidal endothelial cell proliferation and expression ofangiopoietin/tie family in regenerating rat liver. J Hepatol34:690–698

Semenza GL (2001) Hypoxia-inducible factor 1: oxygen homeostasisand disease pathophysiology. Trends Mol Med 7:345–350

Shimizu H, Miyazaki M, Wakabayashi Y, Mitsuhashi N, Kato A, ItoH, Nakagawa K, Yoshidome H, Kataoka M, Nakajima N (2001)VEGF secreted by replicating hepatocytes induces sinusoidal

endothelial cell proliferation during regeneration after partial hep-atectomy in rats. J Hepatol 34:683–689

Shimizu H, Mitsuhashi N, Ohtsuka M, Ito H, Kimura F, Ambiru S,Togawa A, Yoshidome H, Kato A, Miyazaki M (2005) Vascularendothelial growth factor and angiopoietins regulate sinusoidalregeneration and remodeling after partial hepatectomy in rats.World J Gastroenterol 11(46):7254–7260

Sturm J, Keese M, Zhang H, BonninghoV R, Magdeburg R, VajkoczyP, Dono R, Zeller R, Gretz N (2004) Liver regeneration in FGF-2deWcient mice: VEGF acts as potential functional substitute forFGF-2. Liver Int 24:161–168

Taniguchi E, Sakisaka S, Matsuo K, Tanikawa K, Sata M (2001)Expression and role of VEGF in liver regeneration after partialhepatectomy in rats. J Histochem Cytochem 49:121–129

Theocharis SE, Margeli AP, Agapitos EV, Mykoniatis MG, Kittas N,Davaris PS (1999) EVect of hepatic stimulator substance admin-istration on tissue regeneration due to thioacetamide induced liverinjury in rats. Scand J Gastroenterol 33:656–663

Tischer E, Mitchell R, Hartman T, Silva M, Gospodarowicz D, FiddesJC, Abraham JA (1991) The human gene for vascular endothelialfactor. Multiple protein forms are encoded through alternativeexon splicing. J Biol Chem 266(18):11947–11954

Trumper L, Coux G, Elias MM (2000) EVect of acetaminophen onNa+-K+ ATPase and alkaline phosphatase on plasma membranesof renal proximal tubules. Toxicol Appl Pharmacol 164:143–148

Trumper L, Coux G, Monasterolo LA, Molika S, Garcia VMC, EliasMM (2005) EVect of acetaminophen on Na+-K+ ATPase of rat re-nal epithelial cells. Biochim Biophyts Acta 1740:332–339

Tygstrup N, Jensen SA, Krog B, DalhoV K (1997) Expression of liverfunctions following sublethal and non lethal doses of allyl alcoholand acetaminophen in the rat. J Hepatol 27:156–162

Wack KE, Ross MA, Zegarra V, Sysko LR, Watkins SC, Stolz DB(2000) Sinusoidal ultrastructure evaluated during the revasculari-zation of regenerated rat liver. Hepatology 33:363–378

Walker RM, Racz WJ, Mcelligot TF (1983) Scanning electron micro-scope examination of acetaminophen-induced hepatotoxicity andcongestion in mice. Am J Physiol 113:321–330

Yamane A, Seetharam L, Yamaguchi S, Gotoh N, Takahashi T, Neu-feld G, Shibuya M (1994) A new communication system betweenhepatocytes and sinusoidal endothelial cells in liver through vas-cular endothelial growth factor and Flt tyrosine kinase receptorfamily (Flt-1 and KDR/Flk-1). Oncogene 9:2683–2690

Yamazaki Y, Morita T (2006) Molecular and functional diversity ofvascular endothelial growth factors. Mol Divers 10(4):515–527

Zimmerman HJ, Ishak KG (1994) Hepatic injury due to drugs and tox-ins. In: MacSsween RNM, Anthony PP, Scheuer PJ, Burt AD,Portmann BC (eds) Pathology of the liver. Churchill Livingstone,London, pp 563–633

123