31s 31s 31s 31s 31s t A t A t A t A t A ve ve ve ve ve nue/L nue/L nue/L nue/L nue/L ong B ong B ong B ong B ong B oule oule oule oule oule var var var var var d d d U U U rban Desig rban Desig rban Desig rban Desig rban Desig n O n O n O n O n O verla verla verla verla verla y y y Me Me Me Me Me t t t r r r o P o P o P o P o P lanning De lanning De lanning De lanning De lanning De par par par par par tme tme tme tme tme n n n t t t Attachment to Ordinance No.BL2004-151 as adopted 3/16/04 and Ordinance No. 2005-699 as adopted on 7/19/05 and Ordinance No. 2007-29 as adopted on 12/04/07
42
Embed
Urban Design Overlay - nashville.gov · Urban Design Overlay Metro Planning Department ... related design standards, ... tion to the future urban edge of Centennial
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
31s31s31s31s31st At At At At Avevevevevenue/Lnue/Lnue/Lnue/Lnue/Long Bong Bong Bong Bong Bouleouleouleouleoulevarvarvarvarvarddddd
UUUUUrban Desigrban Desigrban Desigrban Desigrban Design On On On On Overlaverlaverlaverlaverlayyyyy
MeMeMeMeMetttttrrrrro Po Po Po Po Planning Delanning Delanning Delanning Delanning Deparparparparpartmetmetmetmetmennnnnttttt
AAAAAs As As As As Adoptdoptdoptdoptdopted 3/16/04ed 3/16/04ed 3/16/04ed 3/16/04ed 3/16/04AAAAAttttttttttacacacacachmehmehmehmehmennnnnt tt tt tt tt to Oro Oro Oro Oro Ordinancdinancdinancdinancdinance No. BL2004-151e No. BL2004-151e No. BL2004-151e No. BL2004-151e No. BL2004-151
Attachment to Ordinance No.BL2004-151 as adopted 3/16/04
and Ordinance No. 2005-699 as adopted on 7/19/05
and Ordinance No. 2007-29 as adopted on 12/04/07
On the Cover:
Perspective view looking northwest at the
intersection of 31st Avenue North and
Long Boulevard. Mixed-use building at left;
courtyard residential buiding in the
distance.
11111
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
TTTTTable of Cable of Cable of Cable of Cable of Conononononttttteeeeennnnntttttsssss
PPPPParking and Aarking and Aarking and Aarking and Aarking and Accccccccccessessessessess
LLLLLandandandandandscscscscscapapapapape, Se, Se, Se, Se, Stttttrrrrreeeeeeeeeetttttscscscscscapapapapape, and Se, and Se, and Se, and Se, and Scrcrcrcrcreeeeeeeeeeningningningningning
SigSigSigSigSignagnagnagnagnageeeee
AAAAAppppppppppeeeeendix Andix Andix Andix Andix A
Regulating Plan
Standards
AAAAAppppppppppeeeeendix Bndix Bndix Bndix Bndix B
Process
22222
33333
44444
55555
77777
88888
99999
1010101010
1212121212
1313131313
1414141414
1616161616
1919191919
2020202020
2121212121
2222222222
2323232323
2424242424
2525252525
2626262626
2828282828
3030303030
3131313131
3232323232
3636363636
22222
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
InInInInInttttteeeeennnnnt of tt of tt of tt of tt of the Guidehe Guidehe Guidehe Guidehe Guidelineslineslineslineslines
The design intent of the Urban DesignOverlay Concept Plan are as follows:
Encourage and maintain a pedestrianfriendly environment while minimizingthe impact of the automobile.Encourage an appropriate mix ofcompatible uses consistent with thelocation, access, and amenity character-istics of the area in relation to the WestEnd Corridor.Maintain and enhance current publicspaces and provide new public spacesfor recreational use by area residents.Encourage an appropriate mix ofcompatible housing types that worktogether to create a harmoniousstreetscape
How tHow tHow tHow tHow to Use to Use to Use to Use to Use the Guidehe Guidehe Guidehe Guidehe Guidelineslineslineslineslines
This document has a main body and twoappendices. The main body is devoted tosetting forth goals, objectives, and, in somecases, implementation strategies for eachimportant subject area comprising theconcept plan for future development in the31st Avenue/Long Boulevard area. All of thisevolved from the charrette sessions thatinvolved property owners, area residents,Planning Department staff and other inter-ested parties. This document is intended toguide future development in a manner thataddresses the important issues raised anddiscussed during the charrette sessions andsubsequent follow-up meetings. A portion ofthe objectives and illustrations in the mainbody of this document pertain to areas forwhich Metropolitan Government exercises
final authority over design, construction andoperation of facilities, such as public rights-of-way. The implementation of some objec-tives in the main body of this document andrelated design standards, as described in theregulatory appendix, are dependent uponsite specific or area wide solutions to infra-structure, such as water service, andstormwater detention and conveyance. Theincorporation of these objectives and designstandards into any final developmentconstruction plans will depend on Metro-politan Government review for consistencywith policies, laws, and related standards ofvarious departments. This plan can be fullyimplemented only to the extent that suchissues can be resolved and these policies,laws, and related standards will permit.The first appendix contains a regulatingplan, according to permitted building types,and a set of design standards that have thesame force and effect as, but are variationsfrom, the standards set forth for the basezone districts in the zoning regulations ofthe Metro Code. Any final developmentconstruction plans submitted for approvalunder the Urban Design Overlay will bereviewed for adherence to these standards.The second appendix contains a briefdescription of the historical events and thecharrette process that led to this document.
33333
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
The 31st Avenue/Long Boulevard area islocated just off the West End Avenue Corri-dor at Interstate 440 in southwest DavidsonCounty (see map below). The southern edgeof the area backs up to commercial proper-ties that face West End Avenue. The easternboundary of the area is 29th Avenue North.The western boundary is the interstate. Thenorthern boundary includes properties onthe south side of Parthenon Avenue andsouth of the public open space known as“Flag Pole Hill.” The properties affected bythis Urban Design Overlay are highlightedin yellow on the aerial photograph at left.
The concept plan depicts the structure ofthe area and is based on the refinement ofconcepts introduced during the charrette. Itshould be used as a guide for the proposedcharacter of future development within eacharea. The regulating plan in the first appen-dix further describes the character of eachstreet.
CCCCCororororore (Be (Be (Be (Be (Blue):lue):lue):lue):lue): Based on existing land usepatterns and recent development, this area isintended to remain a high intensity transi-tion to the future urban edge of CentennialPark. Buildings may take many forms suchas multi-story mixed-use, commercial, andstacked residential flats. Buildings along theeastern edge of 31st Avenue North shouldrespect the height limitations of the westernedge of the street by stepping their facadesback at the point where their heights differ.The remainder of the area should be devel-oped in a dense, urban manner with avariety of building types as high as approxi-mately six stories.
CCCCCeeeeennnnnttttter (Rer (Rer (Rer (Rer (Red):ed):ed):ed):ed): A small, mixed-use neighbor-hood center is proposed for the intersectionof two important streets. This will be theonly location in the Urban Design Overlaywhere street level retail will be encouraged.The intersection is within a short walkingdistance of much of the area and is anappropriate location for establishments thatmay fulfill a resident’s daily needs, such ascorner market or coffee shop. The proposedcharacter of future development is a “MainStreet” feel that is urban and oriented to thepedestrian environment. Buildings on thewest side of 31st Avenue North will be
limited to approximately four stories;however buildings on the east side of 31st
will be allowed to be higher provided theyrespect buildings on the opposite side of thestreet by stepping back their facades.
GGGGGeeeeenernernernerneral (al (al (al (al (YYYYYeeeeellow):llow):llow):llow):llow): The area west of 31st
Avenue North is predominantly residentialand is intended to remain as such. Existingand proposed high intensity zoning is offsetwith design standards that create a consis-tent streetscape, without sacrificing varietyin housing type and design. Design stan-dards are not the same for every propertybecause the streets have a variety of charac-
ter. Medium intensity development of up toapproximately four stories is permittedalong the busy street of Acklen Park Drive aswell as west of Acklen Park Drive. Approxi-mately three story buildings are permittedalong portions of Parthenon facing FlagpoleHill and along portions of Long Boulevard,West End Circle, Mason Avenue, andHillcrest Place. Future development alongBellwood Street and portions of Burns andParthenon near Interstate 440 may include avariety of building types, yet it must beconsistent with the existing single-familycharacter of those streets.
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
DeDeDeDeDevevevevevelopmelopmelopmelopmelopmennnnnt St St St St Sccccceeeeenarionarionarionarionariosssss
The development scenarios show a possibledevelopment pattern for portions of the areathat, if redeveloped, should accomplish theobjectives related to restoring the characterof an interconnected, urban neighborhood.They should be used as a guide for theappropriate building placement, parkingarrangement, and street design of futuredevelopment.
RRRRReeeeeccccconneonneonneonneonneccccction of artion of artion of artion of artion of areeeeea wesa wesa wesa wesa west of At of At of At of At of Acccccklekleklekleklen Pn Pn Pn Pn Parkarkarkarkark
DriDriDriDriDriveveveveve
If redevelopment occurs west of Acklen ParkDrive, it should seamlessly connect to theexisting urban fabric on the east side ofAcklen Park Drive. Existing streets shouldbe connected to new streets creating a clearpattern of blocks. Future developmentshould highlight the importance of theintersection of Acklen Park Drive and LongBoulevard. Vistas from Long Boulevardshould terminate on an important feature orlandmark such as a small green (pictured), acivic building, or a unique feature of aresidential building. A variety of housingtypes, appropriate to the topography, shouldframe the streets and open space.
LLLLLon
g B
on
g B
on
g B
on
g B
on
g B
ou
leo
ule
ou
leo
ule
ou
leva
rva
rva
rva
rva
rdddddFFFFFairairairairairm
onm
onm
onm
onm
ont P
t Pt P
t P
t Pla
cla
cla
cla
cla
ceeeee
AAAAAcccccklekleklekleklen P
n Pn Pn Pn Park D
ri
ark Dri
ark Dri
ark Dri
ark Driveveveveve
Ne
w S
Ne
w S
Ne
w S
Ne
w S
Ne
w S
tttttrrrrre
ee
ee
ee
ee
ettttt
Hillcr
Hillcr
Hillcr
Hillcr
Hillcresesesesest P
t Pt Pt Pt Plac
laclaclaclace (r
e (re (re (re (reeeeeccccconf
onfonfonfonfigur
igurigurigurigured)
ed)ed)ed)ed)
66666
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
DeDeDeDeDevevevevevelopmelopmelopmelopmelopmennnnnt St St St St Sccccceeeeenarionarionarionarionariosssss
CCCCConneonneonneonneonneccccction of Mtion of Mtion of Mtion of Mtion of Maaaaason Ason Ason Ason Ason Avevevevevenue and Hillcrnue and Hillcrnue and Hillcrnue and Hillcrnue and Hillcresesesesesttttt
PPPPPlaclaclaclaclaceeeee
In an effort to eliminate double-frontagelots, minimize offsets in intersections alongAcklen Park Drive, and to improve connec-tivity, this development scenario depicts theextension and connection of Mason Avenueinto Hillcrest Place. Property lost to right-of-way can be regained in closing the northernleg of Hillcrest Place. Additionally, thesouthern leg of Hillcrest Place could beshifted north to connect at Fairmont Place(not shown). This additional refinementwould allow new building lots to back up tocommercial property that fronts Park Drive.Before any of these changes can be imple-mented, a traffic impact study must becompleted and the results presented at apublic meeting.
AAAAAddiddiddiddiddition of option of option of option of option of opeeeeen spacn spacn spacn spacn space and dee and dee and dee and dee and devevevevevelopablelopablelopablelopablelopable
parparparparparccccceeeeellllls nors nors nors nors norttttth of Ph of Ph of Ph of Ph of Parararararttttthehehehehenon Anon Anon Anon Anon Avevevevevenuenuenuenuenue
Portions of Metro Parks property along thenorth side of Parthenon Avenue and west ofOman Street could be platted into usable lotsand added to the UDO. These new lotswould visually screen the Parks Departmentmaintenance buildings and parking fromproperties along the south side of Parthenon.In addition, property that is currently usedfor housing on the north side of Parthenonand west of Flagpole Hill could be redevel-oped into open space. This additional openspace would create an extension of FlagpoleHill to the historic Parks building on OmanStreet.
DDDDDouble-fouble-fouble-fouble-fouble-frrrrrononononontttttagagagagage loe loe loe loe lottttts on Ls on Ls on Ls on Ls on Long Bong Bong Bong Bong Bouleouleouleouleoulevarvarvarvarvarddddd
A series of lots on Long Boulevard havedouble-frontage along Belwood Street. Theshallow depth of the lots creates a difficultchallenge in building and parking place-ment. Property in this area should be devel-oped as a single parcel with its primaryfrontage to a small public or private openspace along Mason Avenue and its second-ary frontage to Bellwood and Long. Parkingshould be placed behind the primary front-age and screened from public view alongBellwood and Long Boulevard.
PPPPParararararttttthehehehehenon A
non Anon A
non Anon A
vevevevevenuenuenuenuenue
Om
an S
Om
an S
Om
an S
Om
an S
Om
an Stttttrrrrree
eeeeeeeettttt
Bel
Bel
77777
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
Existing streets in the area vary in width,function, and visual appeal. Long Boulevardacts as a connector street from the Centen-nial Park area to the neighborhoods to thewest. Long’s approximately fifty feet ofpavement, originally intended to accommo-date a trolley car line, and its curves encour-age high speed traffic.31st Avenue North, another wide, highspeed, heavily traveled street, is a barrier atpeak times for pedestrians moving betweenthe neighborhoods and destinations west ofCentennial Park as well as the park itself.Acklen Park Drive serves the immediateneighborhood and connects West EndAvenue to northwestern neighborhoods.Commercial activity near Park Drive inter-feres with pedestrian, bicycle, and vehiculartraffic along Acklen Park Drive at peaktimes, which causes congestion and encour-ages dangerous maneuvers.Overall, the streets in the neighborhood arewell connected yet lack a continuous side-walk network, streetscape treatments, andsafe crossing opportunities.
Beautiful, functional streets are typical of many urban
neighborhoods. As West End Park and the areas
around 31st Avenue North continue to evolve and
redevelop, these neighborhoods will need to reclaim
the streets as pleasant, desirable places to be.
88888
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
1.1 Construct a raised median that narrowsthe width of the street pavement.
1.2 Provide permanent on-street parking toincrease friction in the flow of vehiculartraffic.
1.3 Plant trees at equal intervals within themedian and planting strips to increasefriction in the flow of vehicular traffic.
1.4 Provide paved landing areas wherecrosswalks intersect the median to createa refuge for pedestrians crossing LongBoulevard.
SSSSStttttandandandandandararararardddddsssss
Refer to Figure 1 for proposed street section.The Metropolitan Government of Nashvilleand Davidson County shall approve changeswithin the public right-of-way.
PS P+G TL TL P+G PS
R.O.W.
M SWSW variesvaries
G:G:G:G:G: Gutter
PS:PS:PS:PS:PS: Planting Strip
SW:SW:SW:SW:SW: Sidewalk
TL:TL:TL:TL:TL: Travel Lane
PPPPP::::: Parking
M:M:M:M:M: MedianFFFFFigurigurigurigurigure 1: Se 1: Se 1: Se 1: Se 1: Seeeeeccccction - Ltion - Ltion - Ltion - Ltion - Long Bong Bong Bong Bong Bouleouleouleouleoulevarvarvarvarvarddddd
2.1 Study the impact of removing theexisting concrete island near the inter-section of Parthenon Avenue and 31st
Avenue North to prevent its dangeroususe as a pedestrian refuge (see OpenSpace Objective 1.2).
2.2 Increase the width of sidewalks alongboth sides of the street at locations withhigh projected levels of pedestrianactivity in order to allow more than twopeople to walk side by side.
2.3 Decrease the width of vehicular travellanes in order to slow traffic and accom-modate wider sidewalks.
2.4 Define bicycle travelway by creating awide outside lane in both directionsfrom West End Avenue to Park Plaza.This requirement fulfills the recommen-dations of the Metro Bikeway/Pedestrianplan.
2.5 Install a marked parallel parking laneadjacent to the sidewalk on each side ofstreet to accommodate additionalparking and provide a buffer betweenpedestrians and vehicular traffic.
2.6 Encourage the installation of pedestrianbulb-outs at the intersection of 31st
Avenue North and Park Place,Parthenon Avenue, and Belwood Av-enue, to define permanent on-streetparking and reduce the width of pave-ment pedestrians must cross.
SSSSStttttandandandandandararararardddddsssss
Refer to Figure 2 for proposed street section.The Metropolitan Government of Nashvilleand Davidson County shall approve changeswithin the public right-of-way.
BL:BL:BL:BL:BL: Bike Lane
G:G:G:G:G: Gutter
PS:PS:PS:PS:PS: Planting Strip
SW:SW:SW:SW:SW: Sidewalk
TL:TL:TL:TL:TL: Travel Lane
PPPPP::::: Parking
FFFFFigurigurigurigurigure 2: Se 2: Se 2: Se 2: Se 2: Seeeeeccccction - 31stion - 31stion - 31stion - 31stion - 31st At At At At Avevevevevenue Nornue Nornue Nornue Nornue Norttttthhhhh
www.pedbikeimages.org/Dan Burden
1010101010
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
GGGGGoal 3—Inoal 3—Inoal 3—Inoal 3—Inoal 3—Inttttterseerseerseerseerseccccction of 31tion of 31tion of 31tion of 31tion of 31sssssttttt A A A A Avevevevevenue Nornue Nornue Nornue Nornue Norttttthhhhh
and Land Land Land Land Long Bong Bong Bong Bong Bouleouleouleouleoulevarvarvarvarvarddddd
To make the intersection of 31st AvenueNorth and Long Boulevard pedestrian-friendly.
3.1 Utilize signalization and signage asappropriate to minimize conflictsbetween pedestrians and vehicles.
SSSSStttttandandandandandararararardddddsssss
Refer to Figures 3 and 4 for proposed planand street section. The Metropolitan Gov-ernment of Nashville and Davidson Countyshall approve changes within the publicright-of-way.
Metro completed a signalization studyof this intersection in the summer of2003, when it was determined that asignal was not yet warranted. Metrowill reevaluate this determination asthe character of the area changes.
3.2 Install crosswalks to give pedestrianspriority in crossing this intersection.
3.3 Install pedestrian bulb-outs at theintersection to define permanent on-street parking and reduce the width ofpavement pedestrians must cross.
FFFFFigurigurigurigurigure 3: Ine 3: Ine 3: Ine 3: Ine 3: Inttttterseerseerseerseerseccccction Ption Ption Ption Ption Plan - 31slan - 31slan - 31slan - 31slan - 31st At At At At Avevevevevenue Nornue Nornue Nornue Nornue Norttttth and Lh and Lh and Lh and Lh and Long Bong Bong Bong Bong Bouleouleouleouleoulevarvarvarvarvarddddd3
FFFFFigurigurigurigurigure 4: Se 4: Se 4: Se 4: Se 4: Seeeeeccccction - 31stion - 31stion - 31stion - 31stion - 31st At At At At Avevevevevenue Nornue Nornue Nornue Nornue Norttttth neh neh neh neh near Lar Lar Lar Lar Long Bong Bong Bong Bong Bouleouleouleouleoulevarvarvarvarvarddddd
4.1 Install signage that only permitspermanent on-street parking on the westside of Acklen Park Drive.
4.2 Install signage that prohibits deliverytrucks that serve businesses on ParkDrive from parking along Acklen ParkDrive.Metro cannot disallow on-streetparking for delivery and pick-up ifnone is provided off-street.
SSSSStttttandandandandandararararardddddsssss
Refer to Figure 5 for proposed street section.The Metropolitan Government of Nashvilleand Davidson County shall approve changeswithin the public right-of-way.
FFFFFigurigurigurigurigure 5: Se 5: Se 5: Se 5: Se 5: Seeeeeccccction - Ation - Ation - Ation - Ation - Acccccklekleklekleklen Pn Pn Pn Pn Park Driark Driark Driark Driark Driveveveveve
G:G:G:G:G: Gutter
PS:PS:PS:PS:PS: Planting Strip
SW:SW:SW:SW:SW: Sidewalk
TL:TL:TL:TL:TL: Travel Lane
PPPPP::::: Parking
1313131313
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
wiwiwiwiwittttthin thin thin thin thin the Phe Phe Phe Phe Public Rublic Rublic Rublic Rublic Righighighighighttttt-of-of-of-of-of-----WWWWWaaaaayyyyy
1 Request Metro to perform an itemizedcost estimate for proposed changes andrequire land developers to pay into acapital improvement fund based onlocation and length of frontage.
2 Apply, as a neighborhood association,for available local, state, and federalcommunity enhancement grants.
3 Request improvements to be included infuture Capital Improvements Budgets.
This area benefits, more than most neigh-borhoods in Nashville, from its proximity togreat open space. Centennial Park forms theeastern boundary of the area. A leg ofCentennial Park called Flagpole Hill formsthe neighborhood’s northern boundary butgood visibility of the open space is limited.The open space along Park Drive is notowned or maintained by Metro, yet it is oneof the most active open spaces in the cityand is the front lawn to the West End Parkneighborhood.While these spaces provide for active andpassive recreation, some of the commonfunctions of urban open space are moredifficult to find. Playgrounds and commu-nity gardens are not numerous, but there isample room to accommodate additionalfunction while preserving the natural beautyof the existing open space.
Open spaces that encourage more frequent use with
facilities such as playgrounds, shelters, benches, and
gardens are essential to complete the neighborhood’s
network of useful urban outdoor areas.
1515151515
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
1.1 Develop an agreement or program withproperty owners whereby the parkalong West End Avenue betweenMurphy Road and 31st Avenue North ispreserved and maintained for futuregenerations.
1.2 Provide a clearly marked, pedestrian-friendly crosswalk to join “FlagpoleHill” and Centennial Park at theintersection of Parthenon Avenue and31st Avenue North.
1.3 Increase security at open spaces byincreasing the number of “eyes on thepark.”
1.4 Install signage along 31st Avenue Norththat directs visitors, including motorists,bicyclists, and pedestrians, to CentennialPark.
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
BBBBBuildinguildinguildinguildinguildingsssss
Due in large part to the area’s currentzoning, which allows high density residen-tial and office, the character of theneighborhood’s buildings has been intransition for decades. The deterioration ofWest End Park’s original character of single-family detached houses is evident onvirtually every street. Between 31st AvenueNorth and Centennial Park, old houses thathad been converted to office use are nowbeing replaced with mid-rise residentialcondominium buildings. Other recentdevelopment forms, especially prevalentwest of 31st Avenue, include the tacked-onappendages of converted single-familydetached houses and new apartment build-ings on single lots that are built perpendicu-lar to the street with parking along the side.These additions, intermingled with theremaining single-family detached houses,create a jumbled streetscape. The newvariety of housing has continued to breakup the neighborhood’s historically consistentbuilding pattern.
Buildings that exhibit quality construction, beauty, and
permanence reinforce the neighborhood’s strength.
Buildings must orient themselves to public spaces, such
as streets and sidewalks, to encourage walking and
interaction, a benefit of the area’s unique location and
proximity to Nashville’s urban resources.
1717171717
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
BBBBBuildinguildinguildinguildinguildingsssss
GGGGGoal 1—31oal 1—31oal 1—31oal 1—31oal 1—31sssssttttt A A A A Avevevevevenue Nornue Nornue Nornue Nornue Norttttth and Lh and Lh and Lh and Lh and Longongongongong
BBBBBouleouleouleouleoulevarvarvarvarvarddddd
To create a mixed-use neighborhood centerwith a “Main Street” character at theintersection of 31st Avenue North and LongBoulevard. (refer to Transportation NetworkGoal 3 for related objectives and standards)
1.1 Construct buildings close to thesidewalk to provide convenientpedestrian access and narrow theperceived width of the street.
1.2 Require building facades at street levelto be taller than other floors and includelarger window areas to encourage theiruse as retail.
1.3 Require the first floor of residentialbuildings to be above the level of thesidewalk to increase privacy.
1.4 Allow multi-story buildings with heightlimits to encourage intensity.
1.5 Require building facades to maintain aconsistent setback while incorporatingarticulation of the façade to mitigatelong, uninterrupted facades.
1.6 Require finishes on facades at street levelto be constructed of durable materialsthat do not imitate other materials.
SSSSStttttandandandandandararararardddddsssss
Refer to Figures 6 through 10 for illustrationof building types. Refer to regulatorystandards for bulk requirements and façadestandards.
GGGGGoal 2—31oal 2—31oal 2—31oal 2—31oal 2—31sssssttttt A A A A Avevevevevenue Nornue Nornue Nornue Nornue Norttttthhhhh
To encourage higher intensity residentialuses along 31st Avenue North, which takeadvantage of their natural context and theirproximity to the neighborhood center,Centennial Park, and major transportationroutes.
2.1 Construct buildings with shallowsetbacks to frame the street and preserveprivate rear yards.
2.2 Require the first floor of residentialbuildings to be above the level of thesidewalk to increase privacy.
2.3 Allow multi-story buildings with heightlimits appropriate to the width of thestreet to encourage intensity.
2.4 Encourage building facades to bedesigned and articulated so as to avoidmassive, unbroken facades.
2.5 Encourage fencing and walls at the sidesand rear of properties to increaseprivacy.
2.6 Require the architecture of newbuildings to be compatible with andcomplementary to the historic buildingsin the area without being facsimiles ofolder buildings.
SSSSStttttandandandandandararararardddddsssss
Refer to Figures 8 through 10 for illustrationof building types. Refer to regulatorystandards for bulk requirements and façadestandards.
GGGGGoal 3—Woal 3—Woal 3—Woal 3—Woal 3—Wesesesesest of 31t of 31t of 31t of 31t of 31sssssttttt A A A A Avevevevevenue Nornue Nornue Nornue Nornue Norttttthhhhh
To promote a diverse residential neighbor-hood containing a mixture of housing typeswest of 31st Avenue North that responds toits natural and physical context as well as itsproximity to Centennial Park, VanderbiltUniversity, and the West End corridor.
3.1 Construct buildings with shallowsetbacks to frame the street and preserveprivate rear yards.
3.2 Require the first floor of residentialbuildings to be above the level of thesidewalk to increase privacy.
3.3 Allow multi-story buildings with heightlimits appropriate to the width of thestreet to encourage intensity.
3.4 Encourage building facades to bedesigned and articulated so as to avoidmassive, unbroken facades.
3.5 Encourage fencing and walls at the sidesand rear of properties to increase pri-vacy.
3.6 Require the architecture of new build-ings to be compatible with and comple-mentary to the historic buildings in thearea without being facsimiles of olderbuildings.
3.7 Preserve contiguous pockets of singlefamily detached buildings to provide amix of building types.
3.8 Reconstruct the blocks and street net-work west of Acklen Park Drive to createa seamless connection between thehistoric development pattern and themodern development pattern.
1818181818
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
SSSSStttttandandandandandarararararddddds (fs (fs (fs (fs (for Gor Gor Gor Gor Goal 3)oal 3)oal 3)oal 3)oal 3)
Refer to Figures 9, 10, 11, and 12 for illustra-tion of building types. Refer to regulatorystandards for bulk requirements and façadestandards.
GGGGGoal 4—Eoal 4—Eoal 4—Eoal 4—Eoal 4—Eaaaaassssst of 31t of 31t of 31t of 31t of 31sssssttttt A A A A Avevevevevenue Nornue Nornue Nornue Nornue Norttttthhhhh
To fulfill the intensity potential of existingmixed office and residential zoning with anurban character that creates a transitionbetween 31st Avenue North and the edge ofCentennial Park.
3.1 Construct buildings close to the side-walk or with shallow setbacks to framethe street and preserve private rearyards.
3.2 Require buildings with ground floorresidential uses to raise the ground levelabove the level of the sidewalk toincrease privacy.
3.3 Allow multi-story buildings withincreased height limits to encourageintensity.
3.4 Encourage building facades to bedesigned and articulated so as to avoidmassive, unbroken facades.
3.5 Require the architecture of new build-ings to be compatible with and comple-mentary to the historic buildings in thearea without being facsimiles of olderbuildings.
SSSSStttttandandandandandararararardddddsssss
Refer to Figures 6 through 10 for illustrationof building types. Refer to regulatorystandards for bulk requirements and façadestandards.
BBBBBuildinguildinguildinguildinguildingsssss
1919191919
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
BBBBBuildinguildinguildinguildinguildingsssss
Res.
Residential
ResidentialFirst
Flo
or
Ele
vation
Street Sidewalk
Garage
Service Lane
Sid
e S
etb
ack
Co
rne
r L
ot
BU
ILD
ING
Rear
Setback
PA
RK
ING
Wall
Street
Sidewalk
Wall
Side Setback
Corner LotSide Setback
Interior Lot
BUILDING
PARKING
Service Lane
Serv
ice L
ane
Me
ws
Front
Setback
Heig
ht
Side Setback
Corner Lot
Sid
e S
etb
ack
Inte
rior
Lot
Side Setback
Interior Lot
Extension of
building depth
on end units
Side
Setback
Interior Lot
Between building
and outbuilding
FFFFFigurigurigurigurigure 10e 10e 10e 10e 10
TTTTTownhouownhouownhouownhouownhousesesesese
ww
w.p
rosp
ectn
ewto
wn.
com
2424242424
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
Sid
e S
etb
ack
Inte
rior
Lot
SidewalkStreet
Residential
Residential
Service Lane
Garage
Res.
Planting Strip
Sidewalk
Between building
and outbuilding
Sid
e S
etb
ack
Corn
er
Lot
Front
Setback
Sid
ew
alk
Pla
ntin
g S
trip
Stre
et
Rear
Setback
Front
Encroachment
Zone
Street
Service Lane
Serv
ice L
ane
Side Setback
Interior Lot
PARKING
BUILDING
Side Setback
Corner Lot
Me
ws
First F
loor
Ele
vation
Heig
ht
Res.
PARKINGBUILDING
BUILDING
PARKING
PARKING
BBBBBuildinguildinguildinguildinguildingsssss
FFFFFigurigurigurigurigure 11e 11e 11e 11e 11
CCCCCooooottttttttttagagagagageeeee
2525252525
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
BBBBBuildinguildinguildinguildinguildingsssss
Residential
Street Sidewalk
Garage
Service Lane
ResidentialRes.
Sid
e S
etb
ack
Corn
er
Lot
Rear
Setback
Between building
and outbuilding
Front
Setback
Planting StripSidewalk
Sid
ew
alk
Pla
ntin
g S
trip
Stre
et
Se
rvic
e L
an
e
Sid
e S
etb
ack
Inte
rio
r L
ot
Garage shall be
hidden from
public view
Front Access Driveway
Street
PARKING PARKING
BUILDING BUILDING BUILDING
PARK.Front
Encroachment
Zone
Side Setback
Corner Lot
First F
loo
r
Ele
vatio
n
He
igh
t
BUILDING PARKING
FFFFFigurigurigurigurigure 12e 12e 12e 12e 12
HouHouHouHouHousesesesese
2626262626
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
PPPPParking and Aarking and Aarking and Aarking and Aarking and Accccccccccessessessessess
Historically, access to private lots in thearea was accomplished through narrowfront driveways or rear service lanes.Parking was often located to the rear of thelot or to the side of the building and re-cessed behind the front façade. This place-ment ensured that parking did not dominatethe streetscape of the mostly single-familyneighborhood.Recent higher intensity development hasunavoidably required more parking, yet itsplacement and visibility has contributed tounattractive gaps in the streetscape. Inaddition to visual discontinuity, frequentfront driveways accessing parking lotsinterrupt sidewalks and disrupt the pedes-trian network.
Parking facilities, although essential in today’s market,
can be integrated into the urban fabric in ways that do
not detract from the public realm. Utilizing the ground
floor for retail and office space helps diminish the
otherwise harsh facades of larger parking structures.
2727272727
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
PPPPParking and Aarking and Aarking and Aarking and Aarking and Accccccccccessessessessess
GGGGGoal 1oal 1oal 1oal 1oal 1
To fulfill the vehicular parking needs ofthose who live, work, and shop in a mannerthat is visually appealing and sensitive to thepedestrian environment.
1.1 Encourage shared parking facilities tominimize the amount of parking spaces.
1.2 Require parking areas to be separatedfrom buildings to avoid parking areasdirectly abutting buildings.
1.3 Require cross access between parkingareas to minimize street curb cuts andadjacent driveways.
1.4 Require parking structures to be locatedbelow or behind buildings andlandscaped to mitigate their visualimpact.
1.5 Encourage parking structures that arelocated close to the sidewalk to includeretail uses at street level to minimize thevisual impact of the structure andengage the pedestrian network.
1.6 Require parking structures to bedesigned to look similar to buildingswith other uses.
1.7 Limit the width of parking access tominimize the interruption to thesidewalk network.
1.8 Improve the service lane networkthroughout the neighborhood throughpaving and appropriate lighting.
SSSSStttttandandandandandararararardddddsssss
Refer to regulatory standards for parkingand access standards.
2828282828
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
LLLLLandandandandandscscscscscapapapapape, Se, Se, Se, Se, Stttttrrrrreeeeeeeeeetttttscscscscscapapapapape, and Se, and Se, and Se, and Se, and Scrcrcrcrcreeeeeeeeeeningningningningning
Current landscaping is all but limited toprivate lots and occasional street trees.Existing overhead utilities limit the opportu-nity for a consistent tree canopy or otherunified streetscape treatment. The area’sopen spaces are well maintained; however,they lack additional amenities to theirprimary function of active and passiverecreation. Street lighting is scaled to ve-hicles rather than both pedestrians andvehicles.Other streetscape elements necessary in anurban area, such as waste receptacles, bikeand media racks, benches, and transitshelters are scattered or non-existent.Building elements such as transformers,utility meters, and heating and coolingequipment are not adequately screened frompublic view. Parking lots that face publicstreets are ill-defined and parking spaces arevisible from the street. The area lacks afunctional and visible continuity in itslandscape, streetscape, and screeningtreatment.
Urban amenities include benches in sidewalks and other public spaces,
trash receptacles, media/newspaper racks, pedestrian-scaled lighting, and
bike racks. They are critical to the viability and success of the whole
neighborhood.
2929292929
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
LLLLLandandandandandscscscscscapapapapape, Se, Se, Se, Se, Stttttrrrrreeeeeeeeeetttttscscscscscapapapapape, and Se, and Se, and Se, and Se, and Scrcrcrcrcreeeeeeeeeeningningningningning
GGGGGoal 1oal 1oal 1oal 1oal 1
To soften the visual impact of developmentand provide a greater level of comfort topedestrians.
1.1 Restore lighting to the concrete pillars atthe edge of the neighborhood nearOutback Steakhouse
1.2 Provide new landscaping includingstreet trees where possible to provideshade and visual relief.
1.3 Require new development to be sensitiveto existing mature trees.
1.4 Screen from public view utilities, meterboxes, heating and cooling units, andother building systems that are visiblefrom a public right-of-way (excludingservice lanes).
1.5 Provide street furniture, such as benchesand waste receptacles, at regular inter-vals along the sidewalk within theneighborhood center at the intersectionof 31st Avenue North and Long Boule-vard.
1.6 Combine media racks at specific loca-tions to avoid clutter along the pedes-trian network.
1.7 Provide bicycle racks within the areaidentified as the neighborhood center sothat bicyclists may park their bicycleswithout obstructing the pedestriannetwork.
1.8 Utilize landscaping to identify key entrypoints or “gateways” to the neighbor-hood, such as Acklen Park Drive at WestEnd Avenue.
1.9 Encourage landscaping of front yards toprovide visual relief from existing andnew development.
1.10Require screening of surface parking lotswhere they face a public right-of-way tominimize the visual impact of parkedvehicles.
1.11Require new street and parking lotlighting to be pedestrian scaled anddesigned to minimize light pollution.
SSSSStttttandandandandandararararardddddsssss
Refer to regulatory standards for landscape,streetscape, and screening standards forprivate property. The MetropolitanGovernment of Nashville and DavidsonCounty shall approve changes in the publicright-of-way.
Adding beauty to the streetscape goes beyond lighting
and benches - landscaping along building edges further
soften the impact of hard materials and help cool the
immediate area. Low walls and plantings are also useful
in screening undeveloped areas or parking lots.
3030303030
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
SigSigSigSigSignagnagnagnagnageeeee
GGGGGoal 1oal 1oal 1oal 1oal 1
To assist and guide those who live, work,and shop in the area.
1.1 Design and place signage so that it ispedestrian-oriented.
1.2 Place signage so that it does not obscureor conceal key architectural features.
1.3 Align signs with other signs within theblock to maintain a consistent pattern ofhorizontal and vertical features.
1.4 Illuminate signage so as to prevent glareand minimize light pollution on adjacentproperties.
1.5 Fabricate signs that are made of durablematerials that are easy to maintain.
StandardsRefer to regulatory standards for signagestandards.
The need for signage was somewhat limitedby the area’s predominantly residentialcharacter. The area’s need for signage hasbeen historically limited by its predomi-nantly residential character. As commercialdevelopment increases in the area, signagemay not be sensitive to the pedestrianenvironment. Wayfinding is equally impor-tant. The area’s access to Centennial Park isvirtually unnoticeable to area visitors. Asthe character of the area changes, additionalsign regulations are required to ensure thatnew signage is not obtrusive within thestreetscape, yet is functional to guide usersof the area.
Signage that is simple and effective goes a long way in
defining how the neighborhood wants to be perceived
by visitors and residents alike. Signs need not be large
or ornate; the pedestrian orientation of the area will
ensure appropriate visibility.
3131313131
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
AAAAAppppppppppeeeeendix A - Rndix A - Rndix A - Rndix A - Rndix A - Regulaegulaegulaegulaegulating Pting Pting Pting Pting Planlanlanlanlan
Due to the variety of physical conditionswithin and adjoining the 31st Avenue/LongBoulevard UDO, the area has been dividedinto eight sub-districts. Where appropriate,specific design standards have beendeveloped for each sub-district by buildingtype.
PPPPPererererermimimimimitttttttttted Bed Bed Bed Bed Building Tuilding Tuilding Tuilding Tuilding Typypypypypeseseseses
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
TATABLE OF BULK STABLE OF BULK STANDARDS BY BUILD BUILDINGNG TYPE
BULKBULK
STANDARANDARD/PARPARKINGNG
STANDARDSTANDARD
COMMERCMMERCIAL/MIXED-USEL/MIXED-USE
BUILDBUILDINGNG TY TYPE
LIVE/WORKLIVE/WORK
BUILDBUILDINGNG TYPE
STASTACKEDKED FLA FLATS
BUILDBUILDINGNG TYPEe
COURTYARARD FD FLATATS
BUILDBUILDINGNG TY TYPEe
Front Yard Set Back from
Front Property Line fWhere buildings directly front
the public right of way, 100% of
the front facade must be within
5 ft. of the front property line;
Exceptions may be made for
recesses up to 15 ft. to
accommodate outdoor seating or
dining areas.
Where buildings directly front
the public right of way, 80% of
the front facade must be built to
10 ft. from the front property
line; where buildings front
common areas (e.g. sidewalks,
parking, open spaces) 80% of the
front façade must be built
between 5 ft. and 10 ft. from the
back of the proposed sidewalka
Where buildings directly front
the public right of way, 80% of
the front facade must be built to
15 ft. from the front property
line in subdistricts CO,CE and G-
1 and to 20 ft. from the front
property line in subdistricts G-2
and G-3; where buildings front
common areas (e.g. sidewalks,
parking, open spaces) 80% of the
front facade must be built
between 5 ft. and 10 ft. from the
back of the proposed sidewalk.b
Where buildings directly front
the public right of way, 80% of
the front facade (except the
portion that fronts the
courtyard) must be built to 15 ft.
from the front property line in
subdistricts CO, CE, and G-1
and to 20 ft. from the front
property line in subdistricts G-2
and G-3; where buildings front
common areas (e.g. sidewalks,
parking, open spaces) 80% of the
front facade (except the portion
that fronts the courtyard) must
be built between 5 ft. and 10 ft.
from the back of the proposed
sidewalk.b
Side Yard Setback Building wall must extend
across 100% of lot at the front
setback line. Exceptions may be
made on interior lots for
pedestrian passages or one
single or double loaded parking
bay. Minimum setback for
interior side of corner lots is 0 ft.;
street side is 5 ft. with no
parking bays permitted on street
side.
Interior Lots: 0 ft. except end
units 5 ft. min.
Corner Lots: interior side 0 ft.;
street side 5 ft. min.
Minimum
Rear Yard Setback 5 ft.
5 ft. min.; if garage doors open to
service lane, setback shall be 5 ft.
or 15 ft. and greater
Maximum Building Heightc
(Sub-districts CO,CE,G)
CO-1 90 ft.
CO-2
50 ft. + additional 25 ft if. set
back 10 ft. from front wall
CE-1
50 ft. + additional 25 ft. if set
back 10 ft from front wall
CE-2 50 ft.
G-1
G-2
G-3
G-4
Minimum Building Height
Minimum Raised
Foundation
Minimum First Floor Height 14 ft. 12 ft.
Parking Access Service lane, side street, front
Parking Location on Lot
Behind, beneath or beside
building (see side yard setback
standard)
Not applicable
3 stories
10 ft. min.
20 ft.
50 ft.
40 ft.
50 ft.
90 ft.
50 ft. + additional 25 ft if. set back 10 ft. from front wall
50 ft. + additional 25 ft if. set back 10 ft. from front wall
50 ft.
Not applicable
Service lane, side street
Behind or beneath building
30 ft. except in G-3, which shall have no minimum requirement
No Requirement 1.5 ft. above highest point along front property line
SSSSStttttandandandandandarararararddddds - As - As - As - As - Appppppppppeeeeendix Andix Andix Andix Andix A
GGGGGeeeeenernernernerneralalalalal
For residential uses, these design standardsapply to new construction and additionsthat increase the number of dwelling units.For non-residential uses, these designstandards apply to new construction andadditions with a gross floor area thatexceeds the gross floor area of the originalstructure. Applicants are encouraged towork with Planning staff early in the designand development process. Applicants shallsubmit three complete sets of final construc-tion documents, including site plan andlandscape plan, for review and approvalprior to the issuance of permits.Where obvious physical constraints exist ona site within the UDO, Metro Planning staffwill review alternative design solutions asthey relate to the intent of the guidelines.Where a single use or function spans morethan one sub-district, planning staff willexplore with the applicant alternativesolutions that achieve the design intent ofthe urban design overlay.
TABLE OF BULK STANDARDS BY BUILDING TYPE
BULKSTANDARD/PARKING
STANDARDCOMMERCIAL/MIXED-USE BUILDING TYPE
LIVE/WORKBUILDING TYPE
STACKED FLATSBUILDING TYPE e
COURTYARD FLATS BUILDING TYPE e
Front Yard Set Back fromFront Property Line f
Where buildings directly frontthe public right of way, 100% ofthe front facade must be within 5ft. of the front property line;Exceptions may be made forrecesses up to 15 ft. toaccommodate outdoor seating ordining areas.
Where buildings directly frontthe public right of way, 80% ofthe front facade must be built to10 ft. from the front propertyline; where buildings frontcommon areas (e.g. sidewalks,parking, open spaces) 80% of thefront façade must be builtbetween 5 ft. and 10 ft. from theback of the proposed sidewalka
Where buildings directly frontthe public right of way, 80% ofthe front facade must be built to15 ft. from the front property linein subdistricts CO,CE and G 1and to 20 ft. from the frontproperty line in subdistrictsG 2and G 3; where buildings frontcommon areas (e.g. sidewalks,parking, open spaces) 80% of thefront facade must be builtbetween 5 ft. and 10 ft. from theback of the proposed sidewalk.b
Where buildings directly frontthe public right of way, 80% ofthe front facade (except theportion that fronts thecourtyard) must be built to 15 ft.from the front property line insubdistricts CO, CE, and G 1and to 20 ft. from the frontproperty line in subdistrictsG 2and G 3; where buildings frontcommon areas (e.g. sidewalks,parking, open spaces) 80% of thefront facade (except the portionthat fronts the courtyard) mustbe built between 5 ft. and 10 ft.from the back of the proposedsidewalk.b
Side Yard Setback Building wall must extendacross 100% of lot at the frontsetback line. Exceptions may bemade on interior lots forpedestrian passages or onesingle or double loaded parkingbay. Minimum setback forinterior side of corner lots is 0 ft.;street side is 5 ft. with noparking bays permitted on streetside.
Interior Lots: 0 ft. except endunits 5 ft. min.Corner Lots: interior side 0 ft.;street side 5 ft. min.
MinimumRear Yard Setbackh 5 ft.
5 ft. min.; if garage doors open toservice lane, setback shall be 5 ft.or 15 ft. and greater
5 ft. min. in CO and CE; 10 ft. min. in G, except side adjacent to aservice lane may be 5 ft. min.
5 ft. min. in CO and CE; 20 ft. min in G
General
For residential uses, these design standards apply to new construction and additions that increase the number of dwelling units. For non-residential uses, these design standards apply to new constructions and additions with a gross fl oor area that exceeds the gross fl oor area of the original structure. Applicants are encouraged to work with Planning staff early in the design and development process. Applicants shall submit a fi nal UDO application for review and approval prior to the issuance of building permits. Applications shall include site plans, landscape plans and building elevations. All improvements affecting the exterior appearance of property and requiring building permits must be approved by a Design Review Committee designated by the Metropolitan Planning Commission.
All sites are subject to Stormwater review regardless of the size of the property or the disturbance area.
Where obvious physical constraints exist on a site within the UDO, Metro Planning staff will review alternative design solutions as they relate to the intent of the guidelines. Where a single use or function spans more than one sub-district, planning staff will explore with the applicant alternative solutions that achieve the design intent of the urban design overlay.
32
*See Page 35 for footnotes
*See Page 35 for footnotes
33333
TA F LK ST (CONTINU
LK
ST I
NDARD
TOWN S
BUIL G TYPE
TA
BUIL G TYPE
SE
IL G TYPE
TITUTIO
IL G TYPE
AAAAAppppppppppeeeeendix A - Sndix A - Sndix A - Sndix A - Sndix A - Stttttandandandandandararararardddddsssss
Floor Area Ratio Exemptions:Sub-district CE: Residential floor spaceshall be excluded from floor area used inthe calculation of floor area ratio.All sub-districts: Parking structuresused to accommodate required parkingshall be excluded from floor space usedin the calculation of floor area ratio.
Exemption from the visibility provision:Development within the UDO shall beexempt from the “visibility triangle” provi-sions as set forth in Section 17.20.180 of theMetro Code whenever compliance with thebuild-to-line or setback standards of theUDO would otherwise prevent compliancewith the “visibility triangle” provisions.
33
Maximum Building Heightc
(Sub districts CO,CE,G)CO 1 90 ft.
CO 250 ft. + additional 25 ft if. setback 10 ft. from front wall
CE 150 ft. + additional 25 ft. if setback 10 ft from front wall
CE 2 50 ft.G 1G 2G 3G 4
Minimum Building HeightMinimum RaisedFoundation
Maximum RaisedFoundation
Not applicable Not applicable 5 ft. 5 ft.
Minimum First Floor Height 14 ft. 12 ft.
Parking Access Service lane, side street, front
Parking Location on LotiBehind, beneath or besidebuilding (see side yard setbackstandard)
3 stories
Not applicable
Service lane, side street
Behind or beneath building
30 ft. except in G 3, which shall have no minimum requirement
No Requirement 1.5 ft. above highest point along front property line
50 ft.
3 stories and a maximum of 40 ft.
4 stories and a maximum of 50 ft.
90 ft.
50 ft. + additional 25 ft if. set back 10 ft. from front wall
50 ft. + additional 25 ft if. set back 10 ft. from front wall
50 ft.
Not applicable
COMMERCIAL/MIXED-USE BUILDING TYPE
LIVE/WORKBUILDING TYPE
STACKED FLATSBUILDING TYPE
COURTYARD FLATSBUILDING TYPE
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
TATABLE OF BULK STABLE OF BULK STANDARDS BY BUILD BUILDINGNG TYPE
BULKBULK
STANDARANDARD/PARPARKINGNG
STANDARDSTANDARD
COMMERCMMERCIAL/MIXED-USEL/MIXED-USE
BUILDBUILDINGNG TY TYPE
LIVE/WORKLIVE/WORK
BUILDBUILDINGNG TYPE
STASTACKEDKED FLA FLATS
BUILDBUILDINGNG TYPEe
COURTYARARD FD FLATATS
BUILDBUILDINGNG TY TYPEe
Front Yard Set Back from
Front Property Line fWhere buildings directly front
the public right of way, 100% of
the front facade must be within
5 ft. of the front property line;
Exceptions may be made for
recesses up to 15 ft. to
accommodate outdoor seating or
dining areas.
Where buildings directly front
the public right of way, 80% of
the front facade must be built to
10 ft. from the front property
line; where buildings front
common areas (e.g. sidewalks,
parking, open spaces) 80% of the
front façade must be built
between 5 ft. and 10 ft. from the
back of the proposed sidewalka
Where buildings directly front
the public right of way, 80% of
the front facade must be built to
15 ft. from the front property
line in subdistricts CO,CE and G-
1 and to 20 ft. from the front
property line in subdistricts G-2
and G-3; where buildings front
common areas (e.g. sidewalks,
parking, open spaces) 80% of the
front facade must be built
between 5 ft. and 10 ft. from the
back of the proposed sidewalk.b
Where buildings directly front
the public right of way, 80% of
the front facade (except the
portion that fronts the
courtyard) must be built to 15 ft.
from the front property line in
subdistricts CO, CE, and G-1
and to 20 ft. from the front
property line in subdistricts G-2
and G-3; where buildings front
common areas (e.g. sidewalks,
parking, open spaces) 80% of the
front facade (except the portion
that fronts the courtyard) must
be built between 5 ft. and 10 ft.
from the back of the proposed
sidewalk.b
Side Yard Setback Building wall must extend
across 100% of lot at the front
setback line. Exceptions may be
made on interior lots for
pedestrian passages or one
single or double loaded parking
bay. Minimum setback for
interior side of corner lots is 0 ft.;
street side is 5 ft. with no
parking bays permitted on street
side.
Interior Lots: 0 ft. except end
units 5 ft. min.
Corner Lots: interior side 0 ft.;
street side 5 ft. min.
Minimum
Rear Yard Setback 5 ft.
5 ft. min.; if garage doors open to
service lane, setback shall be 5 ft.
or 15 ft. and greater
Maximum Building Heightc
(Sub-districts CO,CE,G)
CO-1 90 ft.
CO-2
50 ft. + additional 25 ft if. set
back 10 ft. from front wall
CE-1
50 ft. + additional 25 ft. if set
back 10 ft from front wall
CE-2 50 ft.
G-1
G-2
G-3
G-4
Minimum Building Height
Minimum Raised
Foundation
Minimum First Floor Height 14 ft. 12 ft.
Parking Access Service lane, side street, front
Parking Location on Lot
Behind, beneath or beside
building (see side yard setback
standard)
Not applicable
3 stories
10 ft. min.
20 ft.
50 ft.
40 ft.
50 ft.
90 ft.
50 ft. + additional 25 ft if. set back 10 ft. from front wall
50 ft. + additional 25 ft if. set back 10 ft. from front wall
50 ft.
Not applicable
Service lane, side street
Behind or beneath building
30 ft. except in G-3, which shall have no minimum requirement
No Requirement 1.5 ft. above highest point along front property line
SSSSStttttandandandandandarararararddddds - As - As - As - As - Appppppppppeeeeendix Andix Andix Andix Andix A
GGGGGeeeeenernernernerneralalalalal
For residential uses, these design standardsapply to new construction and additionsthat increase the number of dwelling units.For non-residential uses, these designstandards apply to new construction andadditions with a gross floor area thatexceeds the gross floor area of the originalstructure. Applicants are encouraged towork with Planning staff early in the designand development process. Applicants shallsubmit three complete sets of final construc-tion documents, including site plan andlandscape plan, for review and approvalprior to the issuance of permits.Where obvious physical constraints exist ona site within the UDO, Metro Planning staffwill review alternative design solutions asthey relate to the intent of the guidelines.Where a single use or function spans morethan one sub-district, planning staff willexplore with the applicant alternativesolutions that achieve the design intent ofthe urban design overlay.
TABLE OF BULK STANDARDS (CONTINUED)
BULKSTANDARD/PARKING
STANDARD
TOWNHOUSEBUILDING TYPE
COTTAGEBUILDING TYPEg
HOUSEBUILDING TYPE
CIVIC/INSTITUTIONALBUILDING TYPE
Minimum Lot SizeMinimum width at frontsetback: 20 ft.Minimum depth: 80 ft.
Minimum width at frontsetback: 36 ft.Minimum depth: 100 ft.
Minimum width at frontsetback: 48 ft.Minimum depth: 100 ft.
Front Yard Setback(Subdistricts CO, CE, G)
CO, CE, G 1100% of façade built to 15 ft.from front property lineb
G 2, G 3100% of façade built to 20 ft.from front property lineb
G 4100% of façade built to 35 ft.from front property lineb
Minimum Side Yard SetbackEnd units 5 ft.
Minimum Rear Yard Setbackh
Maximum Heightc
(Subdistricts CO,CE,G)
CO, CE, G 1, G 24 stories with a maximum of 50
ft.
G 33 stories with a maximum of 40
ft.G 4
Minimum Raised Foundation
Maximum Raised Foundation 5 ft. 5 ft. 5 ft. Not applicable
Parking Access Service alley, side street, front
Parking Location on Loti Beneath or behind building Beneath or behind building
Beneath, behind or besidebuilding; if beside, 12 ft. max.width driveway with side byside driveways on adjoining lotsprohibited; if garage, recessfrom front façade of residencebuilding 10 ft. min.
50% of façade built to 35 ft. from front property lined
1.5 ft. above highest point along front property line
Set by Design Review
Set by Design Review
5 ft.; if garage doors open to service alley, setback shall be 5 ft. or 15 ft. and greater
3 stories
Interior lot: 5 ft.; Corner lot: 5 ft. on interior side and 10 ft. onstreet side; garage: 0 ft. along interior side
Service alley, side street
50% of façade built to 15 ft. from front property lined
50% of façade built to 20 ft. from front property lined
3 stories
34
Base Zoning Standards
Refer to the base zoning district for any items not addressed by the Table of Bulk Standards.
*See Page 35 for footnotes
3333333333
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
TABLBLE OE OF BU BULK STANANDARDSDARDS (CONTINUED)ED)
BUBULK
STANDARD/PARKANDARD/PARKINGNG
STASTANDARD
TOWNHOUHOUSE
BUILDINDING TYPE
COTCOTTAGEGE
BUILDINDING TYPE
HOUHOUSE
BUBUILDINDING TYPE
CIVIC/INSCIVIC/INSTITUTIONALNAL
BUBUILDINDING TYPE
Minimum Lot Size
Minimum width at front
setback: 20 ft.
Minimum depth: 80 ft.
Minimum width at front
setback: 36 ft.
Minimum depth: 100 ft.
Minimum width at front
setback: 48 ft.
Minimum depth: 100 ft.
Front Yard Setback
(Subdistricts CO, CE, G)
CO, CE, G-1100% of façade built to 15 ft.
from front property lineb
G-2, G-3100% of façade built to 20 ft.
from front property lineb
G-4100% of façade built to 35 ft.
from front property lineb
Minimum Side Yard
Setback
End units 5 ft.
Minimum Rear Yard
Setback
Maximum Heightc
(Subdistricts CO,CE,G)
CO, CE, G-1, G-2 50 ft.
G-3 40 ft.
G-4
Minimum Raised
Foundation
Parking Access Service alley, side street, front
Parking Location on Lot Beneath or behind building Beneath or behind building
Beneath, behind or beside
building; if beside, 12 ft. max.
width driveway with side by
side driveways on adjoining
lots prohibited; if garage, recess
from front façade of residence
building 10 ft. min.
fFRONT SETBACK ON CORNER LOT: For construction on corner lots, new construction or additions that change the original orientation of the front yard shall
meet the front yard setbacks for both streets.
3 stories
eFLAT AND COURTYARD FLAT DESIGN: Flats and courtyard flats are permitted in sub-district G-4 provided that they are designed so that their appearance
from the fronting street is that of a single-family house type.
aPERMITTED ENCROACHMENTS: Balconies, porches, stoops and other architectural protrusions may encroach to within 5 ft. of the front property line but all
such encroachments combined shall not exceed 60% of the façade width. Steps may encroach to within 0 ft. of the front property line.bPERMITTED ENCROACHMENTS: Balconies, porches, stoops and other architectural features may encroach to within 10 ft. of the front property line but all such
encroachments combined shall not exceed 60% of the façade witdth. Steps may encroach to within 0 ft. of the front property line.
dPERMITTED ENCROACHMENTS: Balconies, porches, stoops and other architectural features may encroach to within 25 ft. of the front property line. Steps may
encroach to within 0 ft. of the front property line.
cBUILDING HEIGHT CALCULATION: Height shall be measured to the top of the parapet or bottom of the eave as applicable and shall be measured from the
average elevation of the front setback. Non-occupiable building elements, such as towers, may exceed the building height by 20%. Where site slope conditions
prevent the reasonable application of building height standards, exceptions may be made as long as the design intent of the building height standard is met.
50% of façade built to 35 ft. from front property lined
1.5 ft. above highest point along front property line
Set by Design Review
Set by Design Review
5 ft.; if garage doors open to service alley, setback shall be 5 ft. or 15 ft. and greater
3 stories
Interior lot: 5 ft.; Corner lot: 5 ft. on interior side and 10 ft. on
street side; garage: 0 ft. along interior side
Service alley, side street
50% of façade built to 15 ft. from front property lined
50% of façade built to 20 ft. from front property lined
AAAAAppppppppppeeeeendix A - Sndix A - Sndix A - Sndix A - Sndix A - Stttttandandandandandararararardddddsssss
Floor Area Ratio Exemptions:Sub-district CE: Residential floor spaceshall be excluded from floor area used inthe calculation of floor area ratio.All sub-districts: Parking structuresused to accommodate required parkingshall be excluded from floor space usedin the calculation of floor area ratio.
Exemption from the visibility provision:Development within the UDO shall beexempt from the “visibility triangle” provi-sions as set forth in Section 17.20.180 of theMetro Code whenever compliance with thebuild-to-line or setback standards of theUDO would otherwise prevent compliancewith the “visibility triangle” provisions.
35
gCOTTAGE AND TOWNHOUSE COURT BUILDING TYPES: Individual Cottage and Townhouse building types on a single lot or multiple lots may be groupedaround a central open space, provided that buildings on the street front the street and buildings in the interior of the lot front the central open space. The followingstandards shall also apply:1. Buildings shall abut both sides of the central open space.2. Parking, driveways, and detention areas shall not be located within the central open space. Parking adjacent to the central open space shall be separated from it bylandscaping or an architectural screen.3. The width of the central open space, measured between buildings, shall be no less than the height of the buildings, measured to the bottom of the eave or top ofparapet.4. For buildings that front the central open space there shall be a minimum distance of 10 ft. between the back of the building and the side property line abutting aneighboring lot.5. The maximum number of dwelling units shall be established by the maximum density of the underlying base zoning district.hALLEY IMPROVEMENTS FOR REAR LOADED BUILDING TYPES: Developers shall be required to dedicate and improve to Metro standards existing alleys alongiPARKING LOCATION ON LOT: All parking structures, below grade or above grade, shall stay within the front yard, side yard and rear yard setbacks
fFRONT SETBACK ON CORNER LOT: For construction on corner lots, new construction or additions that change the original orientation of the front yard shallmeet the front yard setbacks for both streets.
eFLAT AND COURTYARD FLAT DESIGN: Flats and courtyard flats are permitted in sub district G 4 provided that they are designed so that their appearancefrom the fronting street is that of a single family house type.
aPERMITTED ENCROACHMENTS: Balconies, porches, stoops and other architectural protrusions may encroach to within 5 ft. of the front property line but allsuch encroachments combined shall not exceed 60% of the façade width. Steps may encroach to within 0 ft. of the front property line.bPERMITTED ENCROACHMENTS: Balconies, porches, stoops and other architectural features may encroach to within 10 ft. of the front property line but all suchencroachments combined shall not exceed 60% of the façade witdth. Steps may encroach to within 0 ft. of the front property line.
dPERMITTED ENCROACHMENTS: Balconies, porches, stoops and other architectural features may encroach to within 25 ft. of the front property line. Steps mayencroach to within 0 ft. of the front property line.
cBUILDING HEIGHT CALCULATION: Height shall be measured to the top of the parapet or bottom of the eave as applicable and shall be measured from theaverage elevation of the front setback. Non occupiable building elements, such as towers, may exceed the building height by 20%. Where site slope conditionsprevent the reasonable application of building height standards, exceptions may be made as long as the design intent of the building height standard is met.
Footnotes
3434343434
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
SSSSStttttandandandandandarararararddddds - As - As - As - As - Appppppppppeeeeendix Andix Andix Andix Andix A
AAAAArrrrrccccchihihihihittttteeeeecccccturturturturtural Tal Tal Tal Tal Trrrrreeeeeaaaaatmetmetmetmetmennnnnt St St St St Stttttandandandandandararararardddddsssss
General: Proposed development requiredto meet these design standards shall becompatible with and complementary to thearchitecture of historic buildings in the areawithout being facsimiles of older buildings.
Permitted Awnings: In addition to require-ments placed on awnings by existing codesand ordinances, awnings shall comply withthe following requirements:
Length: No awning shall exceed 25 feetin length.Materials: Awnings constructed ofrigid materials, plastic, or fabric that isglossy in texture are not permitted. Thecolors and patterns shall complementthe building.Shape: Awnings shall reflect the shapeand character of window openings.
Open and Closed Side Facades: On lotswith a width of less than 50 feet, cottagesshall be designed with an open side façadeand a closed side façade to encourage theprovision of individual lot privacy. Closedside facades shall be limited in the size,location, and quantity of windows and shallface the Open side façade of the building onthe adjacent lot. Open side facades shouldinclude more fenestration and are encour-aged to open onto private outdoor court-yards. On corner lots, a closed side façadeshall not face a street.
Windows: Windows, with the exception oftransoms, shall be square or verticallyproportioned and rectangular in shape withvertically proportioned or square sashes and
panes. Windows should not be flushmounted to the exterior of the façade.
Muntins, if installed, shall be true-divided lites or simulated divided liteson both sides of the window. Snap-intype muntins are prohibited.Shutters, if installed, shall be sized andshaped to match the their openings.
Glazed Area: A commercial use mustprovide a minimum of 40 percent of thefront facade on the ground floor as clear orlightly tinted windows, doors, or othertreatments sufficiently transparent toprovide views into the interior of buildings.Additional floors shall have a minimum of25 percent glazing. The first floor glazedarea calculation shall be based on the facadearea measured to a height of 14 feet fromgrade in sub-district CO and 12 feet fromgrade in sub-district CE.
Corner Lot Glazing: On corner lots, thepercentage glazing requirements for theground floor of commercial buildings shallapply only to the wall facing the frontproperty line and 20 feet along the sideproperty line facing the street.
Massing: A building shall avoid long,monotonous, uninterrupted walls or roofplanes facing streets.
Wall Planes shall not exceed 25 feet inlength without a change in plane bymeans such as a vertical recess, projec-tion, change in material or color, or
pilaster. Changes in roof plane shall bein harmony with changes in wall planes.Changes in Plane shall be related toentrances, the integral structure or theorganization of interior spaces andactivities and not merely for cosmeticeffect. False fronts or parapets of insub-stantial appearance are prohibited.
Building Presentation at Corner Lots:Buildings located at the intersection of twostreets shall address both streets witharchitectural and massing elements, includ-ing porches, windows, bay windows, andother facade projections or features. For thepurpose of this provision, a service lane isnot a street.
Building Presentation to Street Frontage:Building facades shall be built parallel to thestreet frontage. If the street frontage is notstraight, facades shall be built tangent to thestreet frontage.
Roof Types: Mansard roofs are prohibited.Roofs must be sloped or flat with parapets.
Materials: Vinyl siding is prohibited andE.I.F.S. is prohibited on ground floor facadesfronting a public way.
Entrances: Building entrances (excludingemergency egress) facing a public way shallbe defined by awnings or by being recessed.
36
Building Facades: All building facades, including those facing a public way and those not facing a public way, shall be required to meet the Architectural Treatment Standards and are subject to review
3535353535
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
TABLE OF SIGN STANDARDS FOR SUBDISTRICTS CO AND CE
Permanent On-Premise
Sign TypesMinimum Setback Minimum Height Maximum Height
Awning Sign - Front N/A 14 feet 50 percent of the surface area of
the awning in the same plane
Awning Sign - Side
treat the same as
Building Sign - Projecting
N/A 14 feet 10 square feet
Building Sign - Wall Mounted N/A
1 foot below the cornice or eave
line
50 square feet or 5 percent of
the building façade wall facing
the same public street,
whichever is less
8 feeta
aAny sign that encroaches a public right-of-way must meet Metropolitan Government's current clearance standards and the encroachment must first be approved
under the mandatory referral process.
AAAAAppppppppppeeeeendix A - Sndix A - Sndix A - Sndix A - Sndix A - Stttttandandandandandararararardddddsssss
Parking Structure Facades: Parking struc-ture facades that face public streets, exceptservice lanes, shall be designed so as to looksimilar to buildings having other types ofuses.
Primary Pedestrian Entrance: Buildingsshall be placed so that at least one primarypedestrian entrance is oriented to the streetor civic open space. If the building is locatedon a corner, the entrance shall be at thecorner or on the primary street.
Number of Parking Spaces: The parkingstandards for the underlying zoning districtsshall be used in this UDO except thatresidential units located within mixed usebuildings shall be exempt from requiredparking.
Parking Lot Lighting: Lighting shall beappropriate in function and scale for boththe pedestrian and the vehicle. Lighting thatminimizes light trespass, pollution, anduplight shall be utilized. Luminaire styles,colors, and finishes shall complement thearchitectural features of the development.
Screening and Buffering: Parking spacesshall be screened from all public ways exceptservice lanes.
Parking Lot Location: Parking lots shall notabut a building with the exception of park-ing that extends beneath a building. Parkinglots shall be separated from structures 5 ft.minimum.
LLLLLandandandandandscscscscscapapapapape, Se, Se, Se, Se, Stttttrrrrreeeeeeeeeetttttscscscscscapapapapape, and Se, and Se, and Se, and Se, and Scrcrcrcrcreeeeeeeeeeningningningningning
Parking Lot Screening: Any parking lotadjoining a public street shall be screened toa height of three feet by walls, berms,landscaping, or a combination of these. Iflandscaping is used, the planting bed shallbe a minimum of six feet wide.
Buffering Waiver: The landscape bufferingand screening standards of Article IV of thezoning code shall be waived along internalbase zone district boundaries within theUDO.
Containers and Loading Docks: All solidwaste, recycling, and yard trash containers(except litter containers), grease containers,and loading docks shall be located in park-ing areas, or at the side, or rear of a building,furthest from the public sidewalk. Theyshall also be screened to minimize soundand visibility from residences, and to pre-clude visibility from abutting sidewalks orstreets, excluding service lanes.
Equipment Visibility: All outdoor equip-ment, such as heating, cooling, and ventila-tion systems, utility meters and panels, shallbe placed on the roof, in the rear or side ofthe building, or otherwise visually screenedfrom the street. In no case shall mechanicalequipment be allowed along streetfrontage(s). Mechanical equipment on theroof shall be screened from abutting streetswith parapets or other types of visualscreening.
SigSigSigSigSign Sn Sn Sn Sn Stttttandandandandandararararardddddsssss
Limitations on Lighting: Signs shall bespotlighted, externally lit, or back lit with adiffused lighting source. Back-lightingshould illuminate only the letters, characters,or graphics on the sign rather than thebackground of the sign. Backgrounds shallbe opaque.
Placement of Signs: Signs shall be placed soas not to obscure key architectural featuresor door or window openings.
37
3636363636
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
NeighbNeighbNeighbNeighbNeighborhoorhoorhoorhoorhooooood in Td in Td in Td in Td in Trrrrrananananansisisisisitiontiontiontiontion
The area known as West End Park wasestablished in the 1890’s by the West EndLand Co. The development featured gentlycurving streets, large single-family estates,and stately apartment buildings. Thedevelopment’s perimeter was fenced andfour entrance gates provided access to theneighborhood. One of the great stoneentrances, off West End Avenue at AcklenPark Drive, remains today as one of the fewremnants of the once exclusive subdivision.A trolley car line, which was never built, wasenvisioned to pass through the heart of theneighborhood connecting it to other neigh-borhoods and downtown. A large park,which remains today, stretched along WestEnd and served as a foreground to thebuildings that fronted the open space. Thegrand neighborhood was once advertised asthe “garden spot of this Queen city of theSouth” but it fell into decline in the early1970’s and much of its original grandeur hasbeen replaced with a haphazard character ofold houses and new apartments, condomini-ums, and offices.In the early 1970’s, the area was rezoned toallow more than twenty units per acre. Thisevent in addition to the area’s proximity toVanderbilt and the busy West End corridorcontributed to the transformation of itscharacter. Many large, single-family houseswere converted to multiple dwellings and,subsequently, rented to students. Otherhouses were demolished and replaced bycondominium complexes. By the mid 1980’s,the Interstate 440 project was well underwayand its wide path cut through the neighbor-
hood permanently changing its boundariesand furthering its character transformationthrough the demolition of more houses andthe termination of connecting streets. Asimilar transformation has occurred east of31st Avenue North to Centennial Park assingle-family houses have been converted tooffices or replaced with office buildings and,most recently, high-end residential lofts. Inthe 1990’s, new zoning for multi-familydwellings in urban neighborhoods allowedbuildings to be placed much closer to thestreet than the existing buildings in WestEnd Park. The result of nearly three decadesof development was a neighborhood thathad lost its physical identity. Incompatiblebuilding placement and façade articulationhas led to a jumbled streetscape that lacksconsistency.Recent development pressure in the areaalong 31st Avenue North prompted thePlanning Commission to request thatPlanning Commission staff study the areaprior to hearing future proposals. Staffrecommended using the charrette process to
develop concepts for the area. The charretteprocess was a public participatory processby which the plan for future development ofthe area was created with the assistance ofthose directly affected by its outcome,primarily owners, residents, and members ofthe development community. This processwas designed to identify the issues affectingan area, consolidate the issues into concep-tual solutions, and validate the conceptsthrough public input. The end result wouldhopefully be a plan that represents theinterests of all who are affected by itsimplementation.
TTTTThe Che Che Che Che Charharharharharrrrrreeeeetttttttttteeeee
On February 17th, 2003, a pre-charrettemeeting was held to explain the charretteprocess and identify the boundary fornotification about the upcoming events. Themeeting was well attended by neighborhoodleaders, the district councilmember, andmembers of the development community.Staff set up a remote studio for the charretteat the Parks Board room near the heart of theneighborhood. The charrette was kicked offon February 25th, with a visioning sessionattended by approximately 35 participants.Charrette participants were divided into fivegroups and Planning staff served as facilita-tors to each group. Each group sat at tableswith a map and a set of questions. Theyidentified the boundaries of the study areaand discussed issues surrounding develop-ment, traffic, and open space in the area.Each group presented its findings at theconclusion of the evening and the meetingwas adjourned.
38
3737373737
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
AAAAAppppppppppeeeeendix B - Prndix B - Prndix B - Prndix B - Prndix B - Prooooocccccessessessessess
The following day, Planning staff consoli-dated the issues maps into a single map thatbecame a preliminary concept plan for thearea. The most critical issues raised centeredon transportation and development charac-ter. Transportation issues ranged from high-speed, cut-through traffic on Acklen ParkDrive and Long Boulevard, to the function ofthe 31st Avenue North and Long Boulevardintersection, to the congestion of traffic,parking, and delivery vehicles at peak timeson Acklen Park Drive, to ease of pedestrianand bicycle circulation. Developmentcharacter issues ranged from the placementand architecture of new multi-family build-ings to the screening and landscaping ofsurface parking lots and building equipmentand utilities. As staff consolidated the issues,design concepts were established to beginaddressing the issues. Staff presented theconsolidated issues map and preliminarydesign concepts in a second public meetingon the evening of the second day of thecharrette.Planning staff spent the final day of thecharrette preparing concepts illustratingappropriate development character as wellas proposed street sections for 31st Avenue
North, Long Boulevard, and Acklen ParkDrive. Concepts for appropriate develop-ment character focused on the placementand articulation of buildings and the place-ment and screening of associated parkingand building systems in an effort to create amore consistent streetscape that is compat-ible with its surroundings. The neighbor-hood was divided into several sub-areaswith distinct differences in developmentcharacter based on location, street width,and existing development patterns. Develop-
The Concept Plan (at left) wasdeveloped on the final day of thecharrette. It conolidated the threedays’ worth of input, discussion, and
design study into severaldevelopment characterareas. The accompaninglegend (below) highlightsimportant goals for trans-portation improvementsand physical developmentin the area.
39
3838383838
Attachment to Ordinance No. BL2004-151 as adopted 3/16/04
such as the separation of sanitary and stormsewers. This would allow the area to achieveits true development potential as recom-mended by the economic consultant; how-ever, there was no timeframe for suchimprovements. The final two alternativesprovided opportunities to incorporatedesign standards for new development,while allowing for an increase in density tooffset the cost of design standards. Thiscompromise was identified early in thecharrette process when issues regarding thecharacter of development were raised. Onealternative proposed that planning for thearea be focused on 31st Avenue North in thehope that improved development along thecorridor would positively impact propertyto the east and west. The other alternativeproposed design standards for the entirearea along with some increase in density. Bythe end of the meeting, it was determinedthat Planning staff woulddevelop the alternative thataffected the entire area. Theimplementation of the planwould depend on rezoning andan urban design overlay fordevelopment on private prop-erty. Implementation of im-provements in the public right-of-way would depend on theirinclusion in future capitalimprovement budgets or alter-native methods of funding suchimprovements.On October 9th, Planning staffpresented the draft UrbanDesign Overlay concept plan
ment scenarios for multi-family and mixed-use buildings illustrated future developmentpossibilities in the area. Some of the con-cepts for transportation elements includeddesigns intended to calm traffic, providebetter pedestrian and bicycle circulation,and beautify the area, such as a plantedmedian and permanent on-street parking onLong Boulevard, the addition of bicyclelanes and wider sidewalks on 31st AvenueNorth, and the reconfiguration of on-streetparking near the intersection of Acklen ParkDrive and Park Drive. All proposals werepresented that evening at the final charrettepresentation and the community encour-aged staff to proceed with refinement of theconcepts into a plan for the area.
FFFFFollowollowollowollowollow-up-up-up-up-up
After the charrette, Planning staff performedan audit of the area to determine the typesof buildings and approximate the number ofdwellings in the area. This information wasincluded with the work produced in thecharrette and sent to an economic consultantto determine the viability of the designconcepts for the area. The economic consult-ant suggested that the area was wellunderutilized for its location to Vanderbilt,Centennial Park, West End Avenue, andnearby hospitals and offices. These findingswere combined with public input from thefinal charrette meeting to develop threealternative plans that were presented to thecommunity on March 31st.The first alternative proposed that planningfor the area be postponed until majorinfrastructure work could be completed,
and associated design standards for the area.No consensus approval of the plan wasreached at the meeting and more time wasrequested by the community to review theplan and make suggestions. Planning staffmade available a zoning comparison studythat illustrated what was allowed undercurrent zoning versus what was proposedunder the rezoning and application of anUrban Design Overlay. The neighborhoodassociation in the area met privately todiscuss the plan and propose changes. Thesesuggested changes were presented to thedistrict councilmember and Planning staff inearly December. A meeting with Neighbor-hood Association board members was heldthereafter to discuss the proposed changes.Final revisions, as a result of public inputand internal review, were incorporated intothis document and preparations were madefor the approval process to begin.