UNIVERSIDADE DO ESTADO DO AMAZONAS FUNDAÇÃO DE MEDICINA TROPICAL DR. HEITOR VIEIRA DOURADO PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA TROPICAL MESTRADO EM DOENÇAS TROPICAIS E INFECCIOSAS EPIDEMIOLOGIA MOLECULAR DOS AGENTES DA CRIPTOCOCOSE E PERFIL DE SUSCEPTIBILIDADE ANTIFÚNGICA DE ISOLADOS CLINICOS OBTIDOS EM UM CENTRO DE REFERÊNCIA NO AMAZONAS DIEGO FERNANDO SILVA ROCHA MANAUS 2017
108
Embed
UNIVERSIDADE DO ESTADO DO AMAZONAS FUNDAÇÃO DE MEDICINA TROPICAL … · 2018. 7. 24. · Medicina Tropical, 2017. xvi, 108f. : il. Dissertação (Mestrado) apresentada ao Programa
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
UNIVERSIDADE DO ESTADO DO AMAZONAS
FUNDAÇÃO DE MEDICINA TROPICAL DR. HEITOR VIEIRA DOURADO
PROGRAMA DE PÓS-GRADUAÇÃO EM MEDICINA TROPICAL
MESTRADO EM DOENÇAS TROPICAIS E INFECCIOSAS
EPIDEMIOLOGIA MOLECULAR DOS AGENTES DA CRIPTOCOCOSE E PERFIL
DE SUSCEPTIBILIDADE ANTIFÚNGICA DE ISOLADOS CLINICOS OBTIDOS EM
UM CENTRO DE REFERÊNCIA NO AMAZONAS
DIEGO FERNANDO SILVA ROCHA
MANAUS
2017
i
DIEGO FERNANDO SILVA ROCHA
EPIDEMIOLOGIA MOLECULAR DOS AGENTES DA CRIPTOCOCOSE E PERFIL
DE SUSCEPTIBILIDADE ANTIFÚNGICA DE ISOLADOS CLINICOS OBTIDOS EM
UM CENTRO DE REFERÊNCIA NO AMAZONAS
Orientador: Prof. Dr. João Vicente Braga de Souza
Co-orientadora: Profᵃ Dra Luciana Trilles
MANAUS
2017
Dissertação apresentada ao Programa de Pós- Graduação em Medicina Tropical da Universidade do Estado do Amazonas, em convênio com a Fundação de Medicina Tropical Dr. Heitor Vieira Dourado, para obtenção do grau de Mestre em Doenças Tropicais e Infecciosas
ii
FICHA CATALOGRÁFICA
R672e Rocha, Diego Fernando Silva.
Epidemiologia molecular dos agentes da criptococose e perfil de
susceptibilidade antifúngica de isolados clínicos obtidos em um
centro de referência no Amazonas./Diego Fernando Silva Rocha. --
Manaus : Universidade do Estado do Amazonas, Fundação de
Medicina Tropical, 2017.
xvi, 108f. : il.
Dissertação (Mestrado) apresentada ao Programa de Pós-Graduação em Medicina Tropical da Universidade do Estado do Amazonas – UEA/FMT, 2017.
Ficha Catalográfica elaborada pela Bibliotecária Maria Eliana N Silva, lotada na Escola
Superior de Ciências da Saúde - UEA
iii
FOLHA DE JULGAMENTO
EPIDEMIOLOGIA MOLECULAR DOS AGENTES DA CRIPTOCOCOSE E PERFIL
DE SUSCEPTIBILIDADE ANTIFÚNGICA DE ISOLADOS CLINICOS OBTIDOS EM
UM CENTRO DE REFERÊNCIA NO AMAZONAS
DIEGO FERNANDO SILVA ROCHA
“Esta Dissertação foi julgada adequada para obtenção do Título de Mestre em Doenças
Tropicais e Infecciosas, aprovada em sua forma final pelo Programa de Pós-Graduação
em Medicina Tropical da Universidade do Estado do Amazonas em convênio com a
Fundação de Medicina Tropical Dr. Heitor Vieira Dourado”.
Banca julgadora:
Presidente
Membro
Membro
iv
AGRADECIMENTOS
À Deus por sua infinita graça, bondade e misericórdia manifestadas pelo seu
amor que excede as barreiras da nossa capacidade compreensiva. Obrigado por ter
preparado o caminho, por ter cuidado de cada detalhe com tanta perfeição, pela vida,
força e saúde doados para que eu tivesse o privilégio de vivenciar momentos tão
maravilhosos e de ter conhecido pessoas que foram essenciais para que eu pudesse
hoje estar escrevendo essas palavras de gratidão na minha dissertação de mestrado.
Tudo é teu Senhor Deus!
À toda a minha família pelo amor demonstrado a cada dia e pela preocupação
constante com o meu bem-estar. Reconheço e serei eternamente grato pelo esforço
dos meus pais e avós em proporcionar um ambiente familiar saudável e favorável aos
estudos.
Ao Dr. João Vicente Braga de Souza, meu querido orientador e pai científico
que me acompanha desde o PIBIC e por quem tenho um profundo respeito e
admiração. Sou grato pela sua expressiva contribuição na minha formação acadêmica
e profissional, por cada palavra de incentivo, críticas, elogios e pelos desafios. Me
sinto abençoado em tê-lo como conselheiro, por saber que ele sempre enxerga e
acredita no melhor de cada um e principalmente pelo seu esforço contínuo em criar
uma relação de amizade com seus alunos e um ambiente de trabalho e estudo
harmônicos.
À minha co-orientadora Dra. Luciana Trilles por ter aceitado a parceria neste
projeto, pela ajuda com as reações de sequenciamento de DNA que foram essenciais
para a produção de resultados de qualidade e principalmente por ter me acolhido de
forma tão cordial e atenciosa na sua residência e no Laboratório de Micologia da
Fiocruz durante a minha estadia no Rio de Janeiro para que eu pudesse aprimorar o
meu conhecimento nas metodologias desenvolvidas durante esta pesquisa.
À Dra. Rossicléia Lins Monte, gerente do Laboratório de Bacteriologia da FMT-
HVD e demais funcionários pela parcela de contribuição na produção dos dados
utilizados nesta pesquisa, assim como pela oportunidade de estágio realizado durante
os anos de 2011 a 2013 ainda durante a minha graduação. Agradeço a Ana Carolina
pela indicação, a Luiza Mara e Andrea Espara pelos ensinamentos e pela amizade.
v
Esta experiência foi importante para o meu amadurecimento e decisiva nas minhas
escolhas profissionais.
À Dra. Kátia Santana Cruz, Dra. Carla Silvana Silva Santos, aos técnicos do
Laboratório de Micologia da FMT-HVD e em especial aos alunos Lizandra e João
Ricardo pelo acolhimento, atenção, ajuda no levantamento de dados e no
armazenamento das cepas fúngicas e principalmente pelo excelente serviço de
diagnóstico prestado aos pacientes que foram o alvo deste estudo. Sem a participação
de vocês essa pesquisa não teria sido realizada.
Aos amigos do Laboratório de Micologia do INPA pelos conhecimentos
transmitidos, pela companhia diária, por cada momento de descontração e pelo apoio
emocional e psicológico. Dedico meus agradecimentos em especial à Silviane
Pinheiro e à Lucyane Mendes pelo auxílio nos experimentos laboratoriais.
Aos colegas da turma de mestrado pela companhia e parceria nas atividades
realizadas para o cumprimento dos créditos, pelas sugestões durante os seminários
de avaliação dos projetos e pela riquíssima troca de conhecimentos e experiências
profissionais. E não poderia esquecer de agradecer pelo carinho das minhas amigas
Arlene Pinto e Regina Nelson que foram um presente de Deus.
Agradeço a FMT-HVD pelo incentivo a pesquisa, pela estrutura fornecida, aos
servidores e principalmente aos médicos que geraram dados clínicos de extrema
relevância. E também aos pacientes e familiares que concordaram em participar deste
estudo.
Ao Instituto Nacional de Pesquisas da Amazônia (INPA) por conceder as
condições e estrutura laboratorial para a realização dos experimentos e em especial
ao Dr. Maurício Ogusku, líder do nosso grupo de pesquisas pelo apoio com os
equipamentos laboratoriais.
À Universidade do Estado do Amazonas (UEA) e ao Programa de Pós-
Graduação em Medicina Tropical (PPGMT) pela oportunidade e pelos serviços
prestados sempre de forma organizada e buscando a excelência. E aos órgãos de
fomento: FAPEAM, SUFRAMA, CAPES e CNPq pelos incentivos essenciais a
manutenção do PPGMT e das atividades de pesquisas.
vi
DECLARAÇÃO DAS AGENCIAS FINANCIADORAS
À Coordenação de Aperfeiçoamento de Pessoal de Nível Superior (CAPES) pela concessão da bolsa de pesquisa e pelos recursos destinados a treinamento por meio do projeto Pró-Amazônia (N. 047/2012).
À Fundação de Amparo à Pesquisa do Estado do Amazonas (FAPEAM) pelo
financiamento desta pesquisa (Edital PPSUS 007/2009).
vii
RESUMO
A investigação da diversidade genética dos agentes da Criptococose contribui para
um melhor entendimento da epidemiologia molecular desta micose e dos mecanismos
evolutivos de seus patógenos. A utilização do MLST para esses fins tornou-se uma
tendência atual devido às vantagens discriminatórias e pela sua aplicabilidade
filogenética que permite a distinção entre genótipos pela identificação de alterações
nucleotídicas, favorecendo análises mais específicas da associação dos mesmos com
fatores clínicos e de virulência. Tal ferramenta tem sido pouco explorada em
investigações regionais que foram limitadas ao estudo de cepas de C. gattii e que
apontaram para a presença de genótipos emergentes no ambiente amazônico.
Objetivos: utilizar o MLST para determinar os subtipos (STs) de cepas clínicas,
principalmente os de C. neoformans, para definir se há diversidade e correlação com
aspectos clínicos, assim como situar os isolados regionais no contexto global.
Materiais e métodos: dados foram coletados com o objetivo de descrever o cenário
epidemiológico atual da doença e o perfil de susceptibilidade antifúngica dos isolados
também foi investigado como medida de vigilância. Um total de 38 isolados foram
reativados da coleção de fungos da FMT-HVD, sendo relativos a 30 pacientes
diagnosticados de Fevereiro de 2014 a Maio de 2016, cujos prontuários foram obtidos
pelo sistema de prontuário eletrônico desta fundação. Os genótipos foram definidos
inicialmente por PCR-RFLP do gene URA5 em seguida por MLST com ajuda de banco
de dados internacional. A relação entre os genótipos da população foi avaliada pelo
algoritmo goeBURST no software Phyloviz. A microdiluição em caldo RPMI foi
utilizada para determinar a CIM da Anfotericina B (ANF), Fluconazol (FLZ) e
Itraconazol (ITZ) conforme recomendações da CLSI. Resultados: foi observado que
os pacientes com HIV (n=26) foram acometidos exclusivamente por isolados VNI
(n=34), enquanto que o tipo VGII (n=4) foi identificado em pacientes sem HIV (n=4).
O ST93 foi identificado como o mais prevalente (n=33; 93%) dentre as cepas VNI e
este é um indício de que no Amazonas este tipo molecular apresenta baixa
variabilidade intragenotípica. Constatou-se que o ST93 é endêmico na nossa região
assim como na Ásia, África e sudeste do Brasil e que o mesmo apresenta uma estreita
semelhança genética com o ST32. Dentre as 4 cepas de C. gattii, três STs (ST5,
ST172 e o novo ST445) foram identificados, confirmando o potencial de diversificação
e variabilidade genética de isolados VGII. O ST445 distingue do ST128 em três lócus
(LAC1, PLB1, SOD1), sendo ambos de origem exclusivamente brasileira. Todas as
cepas foram sensíveis aos antifúngicos, apesar dos isolados de C. gattii terem
apresentado médias geométricas quatro vezes mais elevadas para os azólicos, sendo
duas cepas ST172 as que apresentaram a CIM mais elevada para o FLZ. Conclusão:
no Amazonas os pacientes com HIV são acometidos por cepas de C.neoformans VNI
que compõem um grupo geneticamente homogêneo, o que não se observa entre as
cepas de C. gattii. Esta estruturação genética identificada na nossa região dificulta o
estabelecimento de correlações entre os subtipos com fatores clínicos. A anfotericina
B e os azólicos continuam sendo alternativas viáveis para o tratamento.
The genetic diversity investigation of the cryptococcosis agents contributes to a better understanding of the molecular epidemiology of this mycosis and the evolutionary mechanisms of their pathogens. The use of MLST for these purposes has become a current trend due to the discriminatory advantages and its phylogenetic applicability that allows the distinction between genotypes by the identification of nucleotide alterations, favoring more specific analyzes of their association with clinical and virulence factors. This tool has been little explored in regional investigations that were limited to the study of C. gattii strains and that pointed to the presence of emergent genotypes in the Amazonian environment. Aims: use the MLST to determine the molecular subtypes (STs) of clinical strains, especially those of C. neoformans, to define if there is diversity and correlation with clinical aspects, as well as to situate the regional isolates in the global context. Materials and methods: data were collected with the aim of describing the current epidemiological scenario of the disease and the antifungal susceptibility profile of the isolates was also investigated as a surveillance measure. A total of 38 isolates were recovered from the FMT-HVD fungi collection, being related to 30 patients diagnosed from February 2014 to May 2016, whose records were obtained by the idoctor system of this foundation. Genotypes were initially defined by URA5-RFLP followed by MLST analyses in an international database. The relation between the genotypes of the population was evaluated by the algorithm goeBURST in Phyloviz software. The microdilution in RPMI broth was used to determine the MIC of ANF, FLZ and ITZ according to CLSI recommendations. Results: was observed that HIV patients (n = 26) were exclusively affected by VNI isolates (n= 34), whereas the VGII (n= 4) were identified only in non-HIV patients (n= 4). The ST93 was identified as the most prevalent (n= 33; 93%) among the VNI strains and this is an indication that in the Amazon this molecular type presents low intragenotypic variability. It was found that ST93 is endemic in our region as well as in Asia, Africa and Southeast Brazil and that it has a close genetic similarity with ST32. Among the four strains of C. gattii, three STs (ST5, ST172 and the new ST445) were identified, highlighting the potential for diversification and genetic variability of VGII isolates. The ST445 differs from ST128 in three loci (LAC1, PLB1, SOD1), both of exclusively brazilian origin. All strains were susceptible to the antifungals, although C. gattii isolates showed geometric means four times more higher for azoles and two strains ST172 showed the highest MIC for FLZ. Conclusion: in Amazonas state, patients with HIV are affected by strains of C.neoformans VNI that make up a genetically homogeneous group, which is not observed among strains of C. gattii. These genetic population structure identified in our region hamper the establishment of correlation between the subtypes with clinical factors. Amphotericin B and azoles remain as viable alternatives to treatment.
A Criptococose é uma doença grave e causada por fungos adquiridos por inalação após o contato com fezes de aves acumuladas, principalmente de pombos e também madeira em decomposição. Esses fungos podem se disseminar pela corrente sanguínea e comprometer vários órgãos, sendo bastante comum a meningite. Os indivíduos com HIV/Aids são frequentemente acometidos e evoluem para o óbito em quase 50% dos casos, principalmente por ainda serem diagnosticados de forma tardia. Existem duas espécies que acometem o ser humano e atualmente há um interesse em conhecer os seus perfis genéticos (genótipos) e assim determinar a sua frequência, conhecer sua distribuição geográfica e avaliar se os mesmos estão associados a fatores como resistência aos antifúngicos, com a capacidade de causar infecções graves e até surtos. Nesta pesquisa foram obtidos isolados fúngicos de 30 pacientes da FMT-HVD, os genótipos foram identificados utilizando o método MLST que permite ter acesso direto a informação genética presente no DNA, facilitando a diferenciação de fungos aparentemente semelhantes e a comparação dos mesmos com outros fungos identificados em diferentes países através da internet. Informações clínicas e epidemiológicas foram investigadas com o objetivo de descrever a situação atual da doença no estado do Amazonas, de verificar se a doença ocorre de forma distinta entre pacientes com e sem HIV e também de buscar associações com os genótipos. Também foi avaliado se esses fungos poderiam responder adequadamente às drogas disponíveis para tratamento. Foi constatado que o Cryptococcus neoformans é a espécie que prevaleceu nos pacientes com Aids nos quais o genótipo ST93 foi o de maior importância. Este já foi identificado na região sudeste do Brasil e também em países da Ásia e África. Quatro casos desta doença ocorreram em indivíduos HIV negativos nos quais foram identificados três genótipos diferentes (ST5, ST172 e o novo ST445). Ao avaliar a capacidade de ação dos antifúngicos nenhum isolado resistente às drogas foi identificado.
x
LISTA DE FIGURAS
Figura 1. Características micro e macromorfológicas dos agentes causadores da
Altas taxas de mortalidade por apresentarem maior capacidade de produzir cápsula e consequentemente de estimular o perfil de resposta imune do tipo Th2, considerada menos protetiva.
(92)
VNI (Brasil)
Isolados deste genótipo obtidos de pacientes com HIV foram menos susceptíveis ao FLZ do que os obtidos de pacientes hígidos.
(91)
VNIII (França)
Esterilização mais rápida do LCR e melhor prognóstico dos pacientes.
(83)
C.
gattii
VGII (Diversos países,
maioria da Austrália e Canadá)
Menos sensível a 5-FC e aos azólicos; principalmente ao FLZ quando comparado com os demais genótipos de C. gattii;
Observado que cepas com este mesmo genótipo obtidas de diferentes regiões, apresentavam diferenças de susceptibilidade antifúngica ao FLU.
(93,94)
VGII (Brasil)
Menos sensível aos azólicos e a 5-FC do que isolados VGI e VNI respectivamente.
(91)
VGIIa (ST20) e VGIIc (ST6)
(EUA e Canadá)
São os sub-genótipos mais virulentos relacionados ao surto no EUA e Canadá,
Apresentam altos de níveis de proliferação intracelular em macrófagos
VGIIa é capaz de produzir mais melanina
(64)
18
Frente ao exposto, o presente estudo teve como justificativa para a sua
realização a falta de dados mais atualizados e concretos sobre os aspectos
epidemiológicos da criptococose no Amazonas. Os únicos dados disponíveis não
descrevem as taxas de mortalidade, a frequência da infecção em indivíduos
imunodeprimidos e imunocompetentes, assim como a proporção de casos nos quais
ocorre desenvolvimento de sequelas. Até o momento nenhum estudo investigou de
forma mais minuciosa os parâmetros clínicos, laboratoriais e o desfecho dos pacientes
como tem sido realizado em trabalhos de âmbito nacional e mundial.
A criptococose é uma doença negligenciada pelos órgãos de saúde pública e
por isso os casos ainda não são notificados, tornando difícil avaliar a real dimensão
da frequência da doença e de seus efeitos. Estudos epidemiológicos regionais podem
ser úteis ao fornecer dados que respondam a esses questionamentos e que poderão
servir futuramente como subsídio para o desenvolvimento de medidas de prevenção
de agravos como a realização de diagnóstico precoce (triagem para detecção de
antígeno capsular criptocócico), beneficiando os pacientes por antecipar o tratamento
e na redução das taxas de morbi-mortalidade e de gastos com internação.
Estudos de genotipagem com os agentes da criptococose no Amazonas ainda
são escassos e os subtipos moleculares de isolados clínicos também não foram
investigados de uma forma mais abrangente, principalmente os de C. neoformans que
é a espécie mais frequente em indivíduos com Aids. Em virtude das suas inúmeras
vantagens como método de investigação em epidemiologia molecular, o MLST foi
aplicado com o intuito de caracterizar detalhadamente as cepas que acometem os
pacientes na nossa região, de avaliar o grau de associação genética dos STs regionais
com os de outras localidades, permitindo também verificar se os mesmos
compartilham características clínicas e fenotípicas de importância médica, sendo
estas informações importantes para entender o papel dos genótipos na infecção.
19
2 OBJETIVOS
2.1 Geral
Realizar a caracterização clínico-epidemiológica e molecular por MLST dos
casos de Criptococose em pacientes com e sem HIV no Amazonas e investigar o perfil
de susceptibilidade antifúngica dos isolados clínicos.
2.2 Específicos
Descrever as características clínico-epidemiológicas e laboratoriais dos casos
de Criptococose em pacientes com e sem HIV e compará-las para identificar
diferenças significativas no fenótipo da doença;
Utilizar o Multi Locus Sequence Typing (MLST) para definir os sequence types
(STs) dos isolados clínicos;
Descrever a correlação entre os subtipos moleculares (STs) dos isolados
regionais com outros geneticamente relacionados por comparação do perfil
alélico de STs já descritos na literatura;
Determinar a concentração inibitória mínima (CIM) dos antifúngicos
Anfotericina B, Fluconazol e Itraconazol frente aos distintos genótipos;
20
3 MATERIAIS E MÉTODOS
3.1 Modelo de estudo
Trata-se de um estudo de corte transversal que foi realizado com uma
população de pacientes diagnosticados com criptococose na Fundação de Medicina
Tropical Dr. Heitor Vieira Dourado (FMT-HVD) no período de Janeiro de 2014 a Maio
de 2016. A figura em seguida descreve os procedimentos que foram realizados de
acordo com os objetivos do presente estudo.
Figura 2. Fluxograma das etapas e procedimentos realizados.
21
3.2 Universo de estudo
3.2.1 Locais de estudo
Este estudo foi desenvolvido no Laboratório de Micologia da FMT-HVD, onde
os pacientes com criptococose foram diagnosticados e onde também foi realizado o
isolamento por cultivo das respectivas cepas fúngicas. Parte deste estudo também foi
realizado na Unidade de internação hospitalar Prof. Nelson Antunes, onde os
pacientes foram entrevistados.
Os procedimentos de extração de DNA, reação em cadeia da polimerase (PCR)
e a purificação dos produtos de PCR foram executados no Laboratório de Micologia
do Instituto Nacional de Pesquisas da Amazônia (INPA) e o preparo das amostras de
DNA para a reação de sequenciamento foi conduzida no Laboratório de Micologia do
Instituto Nacional de Infectologia Evandro Chagas (INI), na Fiocruz do Rio de Janeiro.
3.2.2 População analisada e período de estudo
No período de Janeiro de 2014 a Maio de 2016 este estudo avaliou 30 pacientes
oriundos da rotina de atendimento da FMT-HVD e que apresentaram diagnóstico
micológico de Neurocriptococose ou fungemia causadas pelas leveduras
Cryptococcus neoformans ou Cryptococcus gattii. Foram incluídos os pacientes que
atenderam aos critérios descritos abaixo.
3.2.2.1 Critérios de inclusão
Foram incluídos os pacientes que:
a) Foram atendidos e diagnosticados na FMT-HVD;
b) De todas as faixas etárias portadores ou não do vírus HIV;
22
c) Dos quais foi possível obter cepas de C. neoformans ou C. gattii a partir do
cultivo primário ou de culturas armazenadas na coleção de fungos do
Laboratório de Micologia da FMT-HVD representativas do período de estudo;
d) Com dados clínico-epidemiológicos e laboratoriais disponíveis para acesso
pelo sistema Idoctor da FMT-HVD ou por meio de entrevista.
3.2.2.2 Critérios de exclusão
Foram excluídos os pacientes que:
a) Cujos isolados fúngicos apresentaram inviabilidade de crescimento após
tentativas de reativação por repiques sucessivos em meios de cultura
específicos. E também por comprometimento da cultura por contaminação;
b) Foram transferidos para outros hospitais;
c) Dos quais não foi possível obter as informações clínico-epidemiológicas e
laboratorias adequada.
3.3 Procedimentos
3.3.1 Obtenção dos isolados clínicos
Foram obtidos um total de 38 isolados clínicos recuperados a partir de amostras
de LCR (n=30) e sangue (n=8) de 30 pacientes, destes 34 foram caracterizados por
ágar CGB como C. neoformans e 4 como C. gattii conforme registrado pelo laboratório
de Micologia da FMT-HVD. Dos 38 isolados, 26 foram recuperados de culturas em
tubos de ágar Sabouraud já armazenadas em geladeira a 8 ⁰C na coleção de fungos
da FMT-HVD e os 12 isolados restantes foram obtidos de pacientes diagnosticados
23
em 2016, permitindo o acesso ao cultivo primário em ágar níger onde as amostras
biológicas foram inoculadas.
Alguns isolados (n=8) foram obtidos de amostras seriadas de LCR coletadas
de dois pacientes durante o controle de tratamento e 4 isolados foram obtidos de
amostras de LCR e sangue coletadas simultaneamente em dois casos ainda durante
o diagnóstico, permitindo avaliar a possibilidade de detecção de genótipos distintos.
Para a realização dos experimentos, todos os isolados foram repicados duas vezes
em placas contendo ágar níger (contendo 20% de glicose e 10% de peptona) para
purificação e obtenção de colônias isoladas. Apenas 1 UFC de cada cepa foi
selecionada e em seguida repicada em triplicata em tubos contendo ágar Sabouraud
e estes foram mantidos em conservação a 8 ⁰C em geladeria para garantir possíveis
análises complementares.
3.3.2 Coleta de dados clínicos, epidemiológicos e de diagnóstico
Após a aprovação pelo CEP da FMT-HVD (Anexo B), foi realizada a busca dos
isolados no laboratório de Micologia da FMT-HVD, de acordo com o período
estipulado pelo estudo e em seguida foi realizado o levantamento dos dados clínico-
epidemiológicos e dados de exames laboratoriais. Em relação aos pacientes
diagnosticados em 2016, estas informações foram obtidas após os pacientes terem
sido esclarecidos sobre o estudo e aprovado a sua participação e a utilização das
cepas após a assinatura do TCLE (Anexo C). Em seguida foi realizada uma entrevista,
sendo aplicado um formulário próprio de investigação clínica, epidemiológica e
laboratorial dos casos de criptococose (Anexo D).
Os pacientes foram questionados sobre informações sociodemográficas (nome
da mãe, idade, naturalidade, endereço e profissão), assim como sobre as condições
de moradia, história de vida, relações de trabalho ou atividades de risco que poderiam
ter favorecido o desenvolvimento da criptococose e assim tentar avaliar a extensão
das possíveis áreas de transmissão, como o próprio ambiente domiciliar ou áreas de
lazer e trabalho.
24
Foram investigados os fatores de risco que possam ter contribuído para a
vulnerabilidade imunológica aos agentes da criptococose, principalmente a infecção
pelo HIV, outros fatores ou comorbidades como: alcoolismo, tabagismo, uso de drogas
ilícitas, uso prolongado de corticoesteróides devido a doenças auto-imunes ou
transplante, câncer, doenças crônicas cardiovasculares, renais ou hepáticas assim
como diabetes e tuberculose (TB).
Também foram questionados sobre os sintomas iniciais que o conduziram ao
diagnóstico. A ficha médica e o histórico dos pacientes disponível no sistema Idoctor
foi monitorada com frequência para avaliar a evolução do paciente, o desenvolvimento
de sequelas neurológicas decorrentes do quadro de meningoencefalite e também para
verificar a ocorrência de óbito. Foram analisados os resultados de exame direto e
cultivo de todas as amostras biológicas, principalmente de LCR enviadas para o
laboratório de micologia e bacteriologia. Resultados da contagem de linfócitos T CD4+
de pacientes com HIV foram obtidos diretamente no sistema idoctor.
Quanto aos pacientes diagnosticados entre 2014-2015 aos quais não tivemos
a oportunidade de entrevista-los, a mesma ficha de investigação clínico-
epidemiológica e laboratorial foi utilizada para preenchimento das informações obtidas
dos prontuários e histórico dos pacientes disponível no sistema iDoctor.
3.3.3 Caracterização molecular por MLST
3.3.3.1 Extração de DNA
A extração de DNA foi baseada no protocolo de Ferrer et al. (2001) (95).
Inicialmente os isolados foram cultivados por 48 horas em ágar Sabouraud, em
seguida foram transferidos com ajuda de alça bacteriológica para microtubos de 2,0
ml para serem incubadas a -20 ºC por 30 minutos ou overnight (Figura 3).
Posteriormente foram adicionados aos microtubos 500 µl de tampão de lise (contendo
SDS a 0,5%, NaCl a 1,4%, EDTA a 0,73% e 20 ml de Tris-HCl para 100 ml de água
destilada) e 5 µL de β-mercaptoetanol, sendo então incubados à 65 ºC por 1 hora.
Foram adicionados 500 µL de Fenol: clorofórmio: álcool-isoamílico (25:24:1), sendo
25
posteriormente realizada a agitação no vórtex para obtenção de uma suspensão
homogênea e em seguida a centrifugação a 14000 rpm por 15 min.
O sobrenadante obtido foi transferido para um novo microtubo de 1,5 ml e em
seguida foram adicionados 500 µl de isopropanol para precipitação do DNA,
homogeneizando levemente as amostras que foram novamente incubadas à -20 ºC
por 30 minutos ou overnight. Em seguida, foi realizada a centrifugação a 14000 rpm
por 15 min para sedimentar o DNA e retirar toda a fase líquida. Após esta etapa, o
precipitado foi lavado com 500 µl de etanol 70% e novamente realizada a
centrifugação a 14000 rpm por 15 min para retirar toda a fase líquida. Após a secagem
do precipitado, este foi ressuspendido em 100 µl de água ultrapura MilliQ®.
E a concentração de DNA Genômico foi verificada por leitura em
espectrofotômetro (GeneQuant-pro RNA/DNA Calculator, GE Healthcare) no
comprimento de onda de 260 nm (unidade de absorbância de 50 μg/ml) e a razão de
pureza determinada pela razão entre as absorbâncias a 260 e 280 nm.
Figura 3. Etapas para obtenção de DNA dos isolados clínicos (Fonte: acervo pessoal).
26
3.3.3.2 Genotipagem inicial por PCR-RFLP do gene URA5
A reação de amplificação foi realizada em um volume final de 40 µl contendo
50 ng de DNA molde, solução tampão 10X (Tris-HCl 10 mM, pH 8,3, KCl 50 mM), 1,5
mM MgCl2, 0,2 mM de cada dNTP, 0,4 µM de cada primer (senso: 5'
ATGTCCTCCCAAGCCCTCGAC-3' / anti-senso: 5´-
TTAAGACCTCTGAACACCGTACTC-3´) e 1,5 U de Taq DNA polimerase (Invitrogen).
A PCR consistiu em 5 minutos de desnaturação à 94 ⁰C; 40 ciclos de 45 segundos à
94 ⁰C, 1 min à 63 ⁰C, 2 min à 72 ⁰C e uma extensão final de 10 min à 72 ⁰C. Os
produtos da amplificação foram separados por eletroforese em gel de agarose 1,5%,
por 50 minutos a 100 V (Figura 4). Posteriormente 8 µl dos amplicons foram
misturados a 1 µl de tampão da enzima Hha I e digeridos duplamente com 0,5 µl da
enzima Sau96I (10 U/µl) e 0,5 µl de Hha I (20 U/µl), sendo em seguida incubados por
3 horas a 37 °C. (68).
Os genótipos foram definidos por eletroforese em gel de agarose a 3% por 2
horas a 100V por comparação das bandas de DNA com a das seguintes cepas de
referência: WM 148 (sorotipo A, VNI), WM 626 (sorotipo A, VNII), WM 628 (sorotipo
Logo após a esta etapa de purificação, foi adicionada Formamida Hi-di nos
poços para desnaturação do DNA. No Laboratório de Genômica Funcional e
Bioinformática foi realizada a eletroforese capilar no aparelho ABI 3730xl DNA
Analyser (Applied Biosystems) (Figura 5).
3.3.3.7 Determinação do perfil alélico e dos subtipos moleculares (sequences types
-STs)
As sequências nucleotídicas foram recebidas por e-mail (em formato abi.) e
pelo software Sequencher 5.3 (Gene Codes Corporation, Ann Arbor, MI, USA) foram
analisadas e corrigidas para remoção/substituição de gaps ou de bases nitrogenadas
incorretas, sendo então gerada uma sequência consenso (contig) (Figuar 5).
O algoritmo Muscle presente no software MEGA v6.0.6 foi utilizado para o
alinhamento dos contigs com sequencias já conhecidas (alelos) oriundas do banco de
dados Fungal MLST Database, permitindo então realizar uma segunda revisão das
sequencias nucleotídicas por comparação visual com os alelos já caracterizados
(Figura 5). Utilizando o recurso de alinhamento “Single Locus ID” no site do banco de
dados (http://mlst.mycologylab.org/), as sequencias foram analisadas para
identificação do seu número alélico, sendo considerado como aceitável o índice de
100% de similaridade com alelos já conhecidos e depositados. As sequencias com
alelos novos não apresentaram este valor e por isso foram enviadas para o curador
da Fungal MLST Database para determinar um novo número alélico correspondente
as suas alterações nucleotídicas e depositar a mesma no banco de dados.
Todas os contigs e seus respectivos números alélicos identificados foram
armazenados em uma planilha Excel. E para determinar o número do ST as
30
sequencias dos sete lócus foram copiadas e submetidas ao algoritmo de identificação
polifásica “Multi Loci ID” online da Fungal MLST Database, sendo aceito como
resultado o valor de 100% de similaridade (Figuar 5). O isolado cujas sequencias
apresentaram novos alelos também recebeu um novo número de ST corresponde a
sua ordem de identificação em relação aos já conhecidos.
3.3.4 Análise pelo algoritmo goeBURST
O algoritmo goeBURST disponível pelo software online PHYLOVIZ
(http://www.phyloviz.net/) foi utilizado com o intuito de avaliar as semelhanças
genéticas e relações dos STs presentes no Amazonas com os de cepas oriundas de
outras regiões e países. Inicialmente foi realizado um levantamento de todos os STs
de C. neoformans VNI e C. gattii VGII depositados no banco de dados Fungal MLST
Database (http://mlst.mycologylab.org/) e em seguida o download dos seus perfis
alélicos em arquivos distintos (planilhas no Excel). Artigos científicos foram
consultados para investigar a ocorrência geográfica dos STs, sendo mantidos na
análise somente os STs com origem geográfica conhecida (82,87). O algoritmo
interligou os STs conforme as semelhanças no perfil alélico e os resultados foram
apresentados sob a forma de um diagrama radial. Sequence types que apresentaram
no mínimo seis lócus semelhantes (dentre os sete analisados) foram agrupados,
formando um complexo clonal no qual o genótipo fundador foi centralizado (98).
3.3.5 Avaliação da susceptibilidade antifúngica
Os procedimentos foram realizados de acordo com o protocolo M27-A3
recomendado pela Clinical and Laboratory Standards Institute (99). As soluções
estoque de antifúngicos Anfotericina B (ANF) e Itraconazol (ITZ) foram preparadas
previamente em dimetil sufoxido (DMSO) e a de Fluconazol (FLZ) diretamente em
meio RPMI 1640. Em seguida as soluções foram diluídas em meio RPMI 1640 líquido
(pH= 7,0) e tamponado com ácido morfolino propanossulfônico (MOPS). Todas as
soluções foram armazenadas a uma temperatura de -20 ºC até o momento do uso.
31
Figura 5. Etapas pós-PCR e purificação para definição do perfil alélico e ST de cada isolado. A)
Aparelho (ABI 3730xl DNA Analyser) utilizado para as reações de sequenciamento senso e anti-senso
dos seis lócus e da região IGS1. B) Layout da página de edição das sequências nucleotídicas no
software Sequencher (pontos escuros indicavam os trechos das sequências que necessitavam de
revisão e correção). C) Alinhamento dos contigs no software MEGA. D) Resultados (perfil alélico e ST)
32
apresentados pelo banco de dados Fungal MLST Database após o preenchimento do campo de busca
“Multi Loci ID” com as sete sequências consenso (Fonte: acervo pessoal).
Para a preparação do inóculo fúngico, as cepas foram previamente reativadas
e cultivadas em ágar Saboraud dextrose por 48 horas. Em seguida foi feita a
suspensão de células em 5 ml de solução salina estéril (0,85%) e a quantificação das
mesmas em câmara de Neubauer. De acordo com a quantidade de células presentes
na solução foi calculada uma concentração final de 2x103 células/ml e posteriormente
o volume correspondente do inóculo inicial foi transferido para um novo tubo contendo
10 ml de meio RPMI 1640.
Para a microdiluição em caldo, 100 µl de meio RPMI 1640 e 100 µl da solução
da droga foram transferidos em duplicata para a microplaca de 96 poços com o auxílio
da pipeta multicanal, realizando a diluição seriada da droga do segundo até o
penúltimo poço. E por fim, foram adicionados 100 µl do inóculo fúngico, delimitando a
1ᵃ e a 12ᵃ coluna de poços da placa para o controle positivo (RPMI + Inóculo) e
controle negativo (apenas meio RPMI), respectivamente. A faixa de concentração
testada para o FLZ foi de 0,125 µg/ml a 64 µg/ml e a da ANF e ITZ de 0,062 µg/ml a
16 µg/ml.
As microplacas foram incubadas a 35 ºC por 72 horas, após este tempo foi
realizada a leitura visual da concentração inibitória mínima (CIM), tendo como
comparação o crescimento nos poços do controle positivo (Figura 6). A CIM da ANF
foi determinada como a menor concentração capaz de inibir completamente (100%) o
crescimento fúngico e para os azólicos a que gerou uma redução parcial (50%)
quando comparado ao crescimento nos poços do controle positivo. Para interpretação
dos resultados foram considerados os valores de corte epidemiológicos (VCE)
genótipo-específicos propostos atualmente e que categorizam os isolados como tipos
selvagem “wild-type” (sensíveis) ou não selvagem “non wild-type” (com
susceptibilidade reduzida ou resistente devido a mutações) (100,101).
33
Figura 6. Resultado do bioensaio de microdiluição em caldo RPMI. As faixas de concentração
destacadas em vermelho indicam a CIM dos antifúngicos determinadas por comparação visual do
crescimento fúngico nos poços teste com o dos poços controle.
3.3.6 Análise estatística
Foi criado um banco de dados com as informações clínico-epidemiológicas e
laboratoriais no software Excel. O software R version 3.3.1 (https://www.r-project.org)
foi utilizado para calcular as medidas de estatística descritiva (média, desvio-padrão
e frequência relativa), as variáveis categóricas foram analisadas pelo teste exato de
Fisher e variáveis continuas pelo Teste t de Student e pelo Teste não paramétrico de
Mann-Whitney. O intervalo de confiança aplicado foi de 95% e valor de p (< 0.05)
considerado como nível de significância estatística.
34
3.4 Aspectos éticos
Este projeto foi submetido e aprovado pelo Comitê de Ética em Pesquisa (CEP)
da FMT-HVD, sendo obtido o CAAE de n⁰ 53952416.1.0000.0005 (Anexo B).
35
4 RESULTADOS E DISCUSSÃO
Os resultados e discussão foram inseridos em formato de artigo científico em
inglês que será submetido para publicação no Periódico Plos One (instruções para
formatação disponíveis no link: http://journals.plos.org/plosone/s/submission-
guidelines).
36
4.1 Artigo
MLST reveals a clonal population structure for Cryptococcus neoformans
isolates and a new sequence type of Cryptococcus gattii obtained from
clinical sources in Amazonas, Northern-Brazil.
Diego Fernando Silva Rocha1,2, Lucyane Mendes Silva2, Silviane Bezerra Pinheiro2,
Lizandra Stephanny Fernandes Menescal3,4, João Ricardo da Silva Neto4, Katia
Santana Cruz4, Carla Silvana Silva Santos4, Luciana Trilles5, João Vicente Braga de
Souza1,2*.
1 Postgraduate Program in Tropical Medicine, University of State of Amazonas/Tropical Medicine Foundation Dr. Heitor Vieira Dourado, Manaus, Amazonas, Brazil.
2 Mycology Laboratory, Coordination of Society, Environment and Health, National Institute of Amazonian Research, Manaus, Amazonas, Brazil
3 Faculty of Pharmaceutical Sciences, Federal University of Amazonas, Manaus, Amazonas, Brazil. 4 Medical Mycology Laboratory, Tropical Medicine Foundation Dr. Heitor Vieira Dourado, Manaus, Amazonas, Brazil.
5 Evandro Chagas National Institute of Infectious Diseases, Oswaldo Cruz Foundation, Rio de Janeiro, Brazil
MLST analysis was carried out by the individual amplification of the six
housekeeping genes CAP59, GPD1, LAC1, PLB1, SOD1, and URA5 along with the
IGS1 region according to the conditions published previously by the ISHAM [32]. The
PCR products were purified with a modified method employing polyethylene-
glycol/NaCl [40] and were bidirectionally sequenced on an ABI3130 DNA Analyzer with
BigDye Terminators v3.1 (Applied Biosystems, Foster City, California, USA) at the
Laboratory of Functional Genomic and Bioinformatics (Fiocruz, Rio de Janeiro, Brazil).
The sequences were manually edited using the software Sequencher 5.3 (Gene Codes
Corporation, Ann Arbor, MI, USA), and the contigs were aligned using the Muscle
algorithm linked to the program MEGA 6.06 [41]. All sequences were analyzed in the
MLST Database (http://mlst.mycologylab.org) to determine the allele number and the
respective ST. DNA sequences of the STs will be submitted to the MLST Database
and to GenBank.
The goeBURST algorithm of PHYLOVIZ software (http://www.phyloviz.net/)
was applied to construct a minimum-spanning tree based on the allelic profile of the
isolates to point the degree of genetic similarity among the regional STs against the
global genotype dataset. A review of the literature was carried out to identify the
42
geographical origin of the STs of VNI and VGII isolates deposited in the MLST
database, and only those with known origin were selected for analysis. The data
reported in two recent studies were also used to check the origin of the STs from Brazil
[26,38]. Distinct colors were applied to illustrate the geographical origins categorized
by continents, and specific colors were attributed to distinguish the STs identified in
Amazonas and in other Brazilian states. In the final diagram, the maximum differences
shown between the molecular subtypes were up to triple locus variants (TLVs) STs.
Antifungal susceptibility test
The antifungal susceptibility test was carried out using the microdilution method
in RPMI broth according to the M27-A3 guideline of Clinical and Laboratory Standards
Institute (CLSI) [42]. The microdilution of the drugs tested were perfomed in duplicate
and in the following ranges: 0.125–64 µg/ml for FLZ (Iberoquímica Magistral, Jundiaí,
Brazil) and 0.03–16 µg/ml for AMB (Sigma Aldrich, Saint Louis, USA) and ITZ (Sigma
Aldrich, Saint Louis, USA).
Cryptococcus isolates were picked twice onto Sabouraud dextrose agar for 48
h and incubated at 35°C. The yeast colonies were transfered to 5 ml of sterile saline
solution (0.85%) and adjusted to a density equivant to 0.5 McFarland standard scale.
Then, 20 µl were removed for counting in a Neubauer chamber, and the inocula were
adjusted to 2.5 × 103 cells in 10 ml of RPMI medium (Sigma Aldrich, Saint Louis, USA).
The 96-well microplates were incubated at 35°C for 72 h, and the MIC of amphotericin
B was determined as the lowest concentration able to completely inhibit fungal growth
(100%) and to the azoles that generated partial reduction (50%) compared with the
growth control wells. The interpretation of MIC values was based on the following
genotype-specific epidemiological cut-off values (ECVs): AMB (0.5 µg/ml), FLZ (8
µg/ml) and ITZ (0.25 µg/ml) to VNI and AMB (1 µg/ml), FLZ (32 µg/ml) and ITZ (0.5
µg/ml) to VGII strains [43,44].
Statistical analyses
43
Statistical data were analyzed with R Software version 3.3.1 (https://www.r-
project.org) and presented descriptively using relative frequency, mean and standard
deviation. The variables were compared between groups defined according to HIV
infection status and the corresponding infecting species. Fisher’s exact test was used
to analyze categorical variables due to values smaller than five in the contigency table.
Continuous variables were compared using Student’s t-test and the non-parametric
Wilcoxon Rank-Sum Test. Relative risk (RR) and the corresponding 95% confidence
interval (CI) were also calculated. All statistical tests were two-tailed, and a P value
<0.05 was considered as the level of statistical significance.
Results
Clinical and epidemiological data
Clinical, epidemiological and laboratory data were obtained for the 30 patients
investigated. Most of them were from Manaus (25; 83%) and from other municipalities
such as Manacapuru (1; 3%) in the metropolitan region, Manicoré (1; 3%) and Jutaí
city (1; 3%), located respectivelly in the south and southwest of Amazonas. Two non-
autochthonous cases were also diagnosed at FMT-HVD, one from Boa Vista (Roraima
State – North of Brazil) and the other from Rio de Janeiro (Southeast of Brazil) (Fig.
1).
Fig 1. Map of Brazil showing the cities of origin of the 30 patients studied and
the corresponding infecting species (indicated by circle and triangle shapes)
and sequence types (different colors) identified in each location. QGIS v.2.16.1
were used to construct the map.
The majority of the patients were male (19; 73%), and the mean age was 39.8
± 12.2 with a range of 19-68 years. HIV infection was reported for 26 patients (87%),
of which 17 (74%) presented CD4+ T-cell counts below 50 mm3/ml, and all of them
were affected only by C. neoformans. Neurocryptococcosis was the most frequent
clinical presentation (29; 97%), and, of these cases, 10 (34%) were also associated
with blood infection; only one HIV patient had fungemia alone. The most common initial
44
signs and symptoms were headache (28; 93%), fever (21; 70%), weight loss (17; 57%),
disorientation (14; 47%) and visual impairment (11; 37%). Four (13%) patients also
used CSF derivation systems to overcome intracranial hypertension. Neurological
sequelae, such as decreased visual acuity (10; 33%), hearing deficit (4; 13%), motor
deficit (3; 10%), hydrocephalus (3;10%) and hyposmia (2; 7%), were more frequent in
the HIV population. Moreover, in-hospital mortality was observed for half of the patients
(15; 50%), mainly those with HIV (14; 54%), during the first 100 days after admission
(Table 1).
Tabel 1. Comparison of clinical, epidemiological and laboratory features of
patientes with cryptococosis in Amazonas according to the HIV infection status.
Variables
HIV positive
C. neoformans
N = 26 (%)
Non-HIV
C. gattii
N = 4 (%)
P-value
(RR/CI)
Demographics
Male sex 19 (73) 1 (25)
Age in years (Mean ± SD) 39.2 ± 12.3 44.5 ± 12.1
Age (Range) 19-68 30-55
Clinical presentation at baseline
Headache 24 (92) 4 (100)
Nausea/Vomiting 18 (73) 4 (100)
Fever 18 (69) 3 (75)
Weight loss 14 (54) 3 (75)
Disorientation 12 (46) 2 (50)
Visual deficit 7 (27) 4 (100)
0.012
(0.2 / CI: 0.14 –
0.5)
Cough 7 (27) 2 (50)
Seizure 6 (23) 1 (25)
Dizziness 6 (23) 1 (25)
Dyspnea 4 (15) 1 (25)
Photophobia 4 (15) 1 (25)
Neck stiffness and others meningeal signals 3 (11.5) 1 (25)
Papilledema 1 (4) 1 (25)
CD4+ T cells/mm3 23 (88.5) 0
> 50 cells/mm3 6 (26) -
< 50 cells/mm3 17 (74) -
45
RR: relative risk, CI: confidence interval, SD: standard deviation.
To find significant differences in the clinical phenotype of the disease between
HIV and non-HV patients, the variables were compared between these two groups
(Table 1), but no statistically significant differences were found, with the exception of
visual deficit development (p = 0.012) at the baseline. The relative risk value (0.2, CI:
0.14 – 0.5) indicated that these impairments can be more clinically relevant in the non-
HIV patients affected by C. gattii.
Clinical forms
Neurocryptococosis 15 (58) 4 (100)
Neurocryptococosis + fungemia 10 (38) 0
Fungemia 1 (4) 0
Positive cultures (+) obtained on
hospitalization
(Mean ± SD) 2 (1 - 3.8) 1.5 (1 - 2.2)
Hospitalizations
(Mean ± SD) 1 (1 – 3) 1 (1 – 1.2)
Hospitalization Time
Days (Mean ± SD) 57 (36.2 – 84)
57 (48.8 –
67.5)
Need of CSF shunt 3 (11.5) 1 (25)
Outcome
Death 14 (54) 1 (25)
Hospital discharge 12 (46) 3 (75)
Admission to death (time in days)
< 100 7 (50) 1 (100)
101 – 200 1 (7)
>200 6 (43)
Sequels
Decreased visual acuity 10 (38) 1 (25)
Decreased hearing acuity 4 (15) 0
Motor deficit 3 (11.5) 0
Hydrocephalus 3 (11.5) 0
Hyposmia 2 (8) 0
46
MLST and phylogenetic analyses
URA5-RFLP analyses, identified 34 clinical C. neoformans and four C. gattii
isolates as the major molecular types VNI and VGII, respectively. In addition, MLST
analyses divided these 38 strains into five STs. Among the C. neoformans var. grubbii
(VNI) isolates were identified the previously known ST93 (33, 97%), having been the
first report of ST93 as the most prevalent sub-genotype of opportunistic strains that
affect immunosuppressed patients in northern Brazil. Only one strain showed the ST2
(3%), and this was recovered from the non-autochthounous case that came from Rio
de Janeiro (Fig. 1). Despite the few C. gattii strains obtained, MLST identified three
different STs as the previously known ST172 (2; 50%), ST5 (1; 25%) and newly
identified ST445 (1; 25%). No genotypic differences were observed among the strains
recovered from serial CSF samples and from clinical different specimens
simultaneously, excluding the possibility of mixed infections.
For the VNI isolates, the goeBURST algorithm identified that ST94, ST95,
ST177, ST195, and ST540 are closely related genetically with ST93 and that these
isolates differ from ST32 by only one locus (GPD1), which suggests this ST as the
probable evolutionary ancestor of ST93 (Fig. 2A). The ST128 of C. gattii were indicated
by this algorithm as having allelic profiles more similar to the new ST445 (triple locus
variant of ST128) (Fig. 2B). In a regional context, few STs of C. gattii from Amazonas
showed genetic similarities among themselves (CC288, CC20 respectively and its
SLVs) (Fig. 2C).
Fig 2. Minimum spanning trees (MST) constructed with goeBURST algorithm A) MST showing the genetic and geographic links of 92 STs of C. neoformans VNI. Data of geographic origin were obtained from Ferreira-Paim et al. (2017) (38). B) MST constructed with data of 124 STs of C. gattii VGII obtained from Souto et al. (2016) (26) and Alves (2016) (37). In the final diagram only the most genetic related (up to TLVs) STs were keeped, totalizing 93 STs. C) MST highlighting the allelic diferences among 14 STs, including those from Amazonas, the three main emergent VGII sub-genotypes (VGIIa, VGIIb and VGIIc) and also the most ancient VGII sequence type (ST278) from Brazil. The numbers inside the circles correponds to the STs identification. The circles size is proportional to the number of isolates per each ST. Circles surrounded by yellow lines represent the founder of each clonal complex. Numbers outside de circles indicate the amount of different locus between
47
the STs. Different colors were applied to categorize the STs according to their geographic origin: light green (STs found in Amazonas), dark green (other brazilian states), blue (Africa), purple (Asia), red (Europe), orange (Oceania), black (North America countries), dark yellow (Central America) and gray (Other South America countries).
MIC results
An antifungal susceptibility test was perfomed with one strain per patient (n=30).
The antifungals AMB, FLZ and ITZ showed satisfactory inhibitory activity against all C.
neoformans and C. gattii strains considered as wild-type (susceptible) isolates
according to ECVs, regardles of the C. gattii isolates having showed a geometric mean
(GM) four times higher than those of C. neoformans. The highest MIC (32 µg/ml) for
FLZ was observed in both ST172 strains of C. gattii. The MIC range and geometric
mean of each drug tested are presented in Table 2.
Table 2. Differences in the MIC ranges and geometric means obtained of the wild
type VNI and VGII strains and the total of isolates with their respective MIC value.
We note that VNI and VGII are the genotypes of greater clinical importance in
Amazonas due to their endemicity, mainly of VNI in HIV patients [33,34]. In the current
study, some regional aspects of the molecular epidemiology of cryptococcosis were
elucidated for the first time by applying the MLST. Using this tool, we showed
indications that immunosuppressed patients from northern Brazil are affected by a
clonal group of VNI strains presenting ST93, a widely distributed subtype genetically
close to African and Asian STs [38,45–47]. These findings are new for the region and
demonstrate the low intragenotypic diversity of C. neoformans. For C. gattii isolates,
MLST revealed a new subtype (ST445), highlighting the high genetic diversification
ability of VGII strains from Brazil [26].
A more detailed and updated epidemiological picture of cryptococcosis in
Amazonas was also described in this current investigation, and we observed that the
clinical aspects of the disease among HIV and non-HIV patients were very similar. The
immunological condition of the patients can influence the development of eye injuries
and, consequently, a patient’s prognosis. Our results are thus the first to report the
antifungal susceptibility profile of these distinct STs; however, it was not possible to
establish correlations, as only the reduced susceptibility of C. gattii isolates, mainly
ST172, was noted.
Few studies on the epidemiology of cryptococcosis in Amazonas state (north of
Brazil) have been performed, and the scarce data has shown the endemicity of
cryptococcal meningitis caused by C. neoformans in our region [3,33,34]. According to
data obtained from records of the Mycology laboratory of the FMT-HVD in Manaus,
cryptococcosis was the most frequent systemic mycose diagnosed during the last 3
years, with an average annual occurrence of 33 cases, being more prevalent in HIV
patients (82%). Comparing this information with previous published data of the same
foundation, a slight increase in the frequency of the disease was observed [33].
No significant change in the epidemiological characteristics of the disease in
Amazonas was noticed, despite the slight increase in its occurence.
Meningoencephalitis caused by C. neoformans VNI remain the most important fungal
infection in HIV male patients aged between 20-45 years (mean of 39 years old), as
50
already reported by regional surveys [3,33,34]. These same profiles have been
observed in the Aids-associated cryptococcal meningoencephalitis cases reported
from African and Asiatic cohorts, as well as in other Brazilian studies, demonstrating
the epidemiological association of both diseases [1,4,38,48,49]. Especially in
Amazonas, the epidemic scenario of Aids cases that arose in the last few years can
explain the emergence of new cryptococcosis cases [4].
We also verified that 65% of HIV patients showed severe immunosuppression
(CD4+ count <50 cells/mm3) in the baseline, and all presented late for mycological
diagnosis with signs and symptoms of disseminated infection and neurological
impairment, which may have contributed to the high mortality (54%) observed in the
first hundred days after admission. The low adherence to antiretroviral therapy
(HAART), and even the absence of early detection strategies of HIV and related
opportunistic agents such as cryptococcosis, are factors that contribute to the
occurrence of such injuries [4]. The use of an immunoassay for the detection of
cryptococcal antigen (CRAG) incorporated to the HIV testing would overcome this
situation by screening asymptomatic patients with CD4 <200 cell/µl, allowing the
initiation of pre-emptive treatment and preventing morbidity and mortality [50]. Its
applicability in assessing the prevalence of antigenemia is still barely studied in Brazil
[51] and in Amazonas, where its use was recently initiated in the FMT-HVD for the
investigation of restricted cases, according to information from the mycology
department.
Despite the low number of patients evaluated, which is proportional to the
annual occurrence of cryptococcosis in the region, the frequency of initial symptoms
and the lethality that we describe is similar to larger studies conducted in areas with a
high burden of cryptococcal meningitis such as South Africa and in Brazil; however, a
lower proportion of deaths (28% after a year) were observed in HIV patients from the
United States, maybe because it is a developed country [47,48,52,53].
The altered mental status has been described as a contributing factor for death
in patients with Aids-related cryptococcal meningitis, and in the current study, this
condition was detected in 46% of cases, corroborating the demonstrated lethality
[48,52–54].
51
Visual impairment may occur as a secondary manifestation of cryptococcal
meningitis in 20-40% of cases, both in patients with and without HIV, and a similar rate
was also observed in the present study (36.6%) [48,53]. The causes are multifactorial
and could be to neuritis and compression of the optic nerve, direct parasitism,
papilledema and increased intracranial pressure being the most suggestive [55–57]. A
low frequency of papilloedema was observed, being described in only 2 patients, one
with and one without HIV. The use of a CSF shunt reported in 4 cases serves as an
indication of complications due to an increase in intracranial pressure; however, the
frequency of visual deficit was greater, demonstrating that other etiological
mechanisms could be involved, thus making it necessary to carry out a more detailed
investigation for a better understanding of its etiopathogeny.
Interestingly, when comparing groups (HIV and non-HIV), visual impairment
was the only variable whose frequency was statistically different between the groups
HIV and non-HIV, being more important in the immunocompetent patients affected by
C. gattii, since HIV infection was considered a protection factor; this can be explained
by the more exacerbated inflammatory responses developed by immunocompetent
individuals [58,59]. However, 38% of individuals with HIV developed or maintained a
visual deficit as a neurological sequel, which may have occurred due to the action of
HAART-induced immune reconstitution [58]. More patients need to be evaluated to
confirm these observations, and an investigation of the immunological mechanisms
involved is required.
For the first time, we report that ST93 is the main sub-genotype of VNI strains
that affect immunosuppressed patients in the north of Brazil. Alves (2016)37 isolated
this ST from household dust in a rural community close to Manaus, demonstrating that
it is established and widely distributed in the region. These results corroborate with
data recently released by an unique Brazilian study that analyzed a greater number of
isolates from Minas Gerais state and described a high prevalence of ST93 in
individuals with Aids as well as in environmental samples [38]. This ST has also been
observed in Aids cases from African and Asian countries, mainly South Africa and
India, as highlighted by goeBURST analysis [45–47].
Despite the limited number of isolates analyzed that could have decreased the
chance to detect other STs, our findings are pioneering in the region and important for
providing indications that regional VNI strains show a low intragenotypic diversity.
52
Similar results were described by two broad molecular investigations conducted in
Asia, and this limited genetic diversity can be assigned to a lesser ability to perform
genetic recombination favoring the occurrence of clonal reproduction and expansion
of these isolates [38,46,60]. However, VNI isolates from Africa are the most diversified
when compared with global isolates due to their ability to reproduce both clonally or
sexually, which can lead to recombinations and mutations in the genome and thus in
genotypic variability. Phylogenetic and population genetic analyses have indicated that
global VNI isolates descend from African strains and that pigeons facilitated their global
dispersal, which justifies the presence of ST93 in different continents, including the
North of Brazil [38,47,60–62].
Only 1 isolate of C. neoformans presented ST2, and this was not considered as
belonging to Amazonas because it was obtained from a patient in Rio de Janeiro
(Southeast Region). This is the first clinical report in Brazil, since it was only identified
in a single environmental sample in Minas Gerais, demonstrating that this subtype
occurs in low frequency in this region [38]. The same ST has already been identified
in Africa and the United States and shows a high prevalence in Germany [47,63,64].
Regarding the VGII isolates, we describe the identification of the new ST445
(whose alleles were already known) and two cases of meningoencephalitis by ST172
in patients coming from rural areas of Amazonas, being one from Manaus and the
other from the municipality of Jutaí in the Southwest of the state, and this is the first
report of this ST in the region, as it was only identified previously in a clinical strain
from São Paulo (southeastern Brazil) [26]. ST5 was isolated from a HIV-negative male
patient, who was a user of illicit drugs that died even when treated with liposomal
amphotericin. This ST was reported in Australia in a single veterinarian isolate and was
identified in Brazil only in the northern region in the states of Pará and Amazonas,
where it is one of the most frequent subtypes, probably because it is better adapted to
the local environmental conditions; however, there are no clinical data or evidence of
virulence related to this subtype [24,26].
Using goeBURST analysis, we also observed that ST5 is genetically close
(SLV) to the ST288 identified exclusively in Amazonas, suggesting that its origin is
local [26]. The aerial dispersion of propagules favored by climatic events and human
or animal migration are supposed mechanisms that justify the presence of a ST in
different regions as observed in this study, also contributing to the introduction of
53
genetically recombinant strains into new ecological niches with potential virulence to
develop outbreaks. In this small group of VGII isolates analyzed, three STs were
detected, complementing the high genetic diversity already described in Brazil, which
is attributed to the potential for recombination in the genome induced by sexual
reproduction events [24,26,65].
According to the ECVs, all isolates were considered sensitive to the three
antifungal agents evaluated, although C. gattii VGII presented geometric mean values
more accentuated for azoles, mainly to FLZ, with ST172 being identified with the
highest MIC (32 µg/ml). This Brazilian ST was recently identified, and there are no
other data reporting their reduced susceptibility to FLZ, ours being the first [26].
An association of the VGII genotype with a lower susceptibility to FLZ has been
widely described [25,66,67], even in Amazonas, where a disc-diffusion assay noted
the occurrence of two clinical isolates with FLZ resistance [33]. However, is important
to describe which VGII STs may be strongly associated with this reduced susceptibility
and if there are differences in the susceptibility profile of similar STs obtained from
different locations, since the data are scarce and still need broader investigations to
state an accurate correlation. Preliminary data were shown by Iqbal et al. (2010) [68],
who demonstrated that distinct subtypes can present significant differences in MIC, as
observed with the STs from the Pacific Northwest of the United States, being ST6
(VGIIc), ST7 (VGIIb) and ST20 (VGIIa), considered as the least susceptible to azoles.
The higher geometric mean of FLZ for C. gattii isolates, as well as the variability
in MIC values among identical STs, can be attributed to the mechanism of
heteroresistance. Subpopulations of cells of a given isolate, independent of the
pathogenic species, innately have the ability to duplicate chromosomes containing
genes of FLZ resistance. Thus, they become able to tolerate increasing concentrations
of this antifungal, featuring a survival mechanism of such agents against the stress
generated by the drug in vitro or in vivo, and evidence showed that heteroresistance
in C. gattii is more pronounced than in C. neoformans [69–71].
The VNI isolates from this study were totally susceptible to the antifungal
agents, and these data corroborate with the literature, including information obtained
on VNI strains from Brazil and with previous data of Amazonas [6,25,33,72]. However,
we demonstrated for the first time that ST93 strains from this state are sensitive to
54
AMB and to azoles, and these data are new for Brazil. Contradictory results were
obtained by Khayhan et. al (2013) [46] when analyzing the antifungal susceptibility of
52 Asian ST93 strains; they observed the occurrence of simultaneous resistance to
FLZ and to flucytosine in 5 isolates from Indonesia. Comparing these facts, it is
possible to note that similar STs may have different susceptibility profiles, probably due
to the environmental and climatic differences of their different regions of origin that may
influence the antifungal response [67].
Conclusion
In conclusion, C. neoformans VNI strains from Amazonas compose a
genetically homogeneous group of isolates that commonly presented ST93. This ST
showed a great clinical and epidemiological importance due to the frequent morbidity
and mortality associated with cryptococcal meningoencephalitis in individuals with Aids
in this state and probably in northern Brazil. Some authors speculate that the
establishment and predominance of some subtypes of C. neoformans in Brazil may
have been favored by isolated events of genetic recombination in its African ancestors,
which later spread to several continents and maintained a clonal expansion
mechanism. The identification of three STs of C. gattii among 4 isolates confirmed the
high genetic diversity of VGII strains in South America, being noted as a close genetic
relation of these subtypes with other Brazilian STs. The clinical features of the disease
among HIV and non-HIV patients were very similar, but the more evident inflammatory
response in immune-competent individuals was demonstrated to be a factor that
differentiates the clinical phenotype, assigned as one of the mechanisms that trigger
the visual deficit. Based on the MIC values obtained by in vitro conditions, all isolates
were considered as susceptible to the antifungal drugs evaluated, but the use of FLZ
deserves attention due to its limited ability to inhibit the growth of C. gattii strains, and
these data can be predictive of clinical failure.
Acknowledgments
55
We thank the medical staff of the FMT-HVD, and all participating patients for the clinical
and epidemiological data generated. We thank the Mycology and Mycobacteriology
laboratories of the National Research Institute of Amazonia (INPA) for assistance with
equipment and reagents. To Joycenéa da Silva Matsuda, Antônio Alcirley Balieiro and
Fernanda Rodrigues Fonseca of Lêonidas & Maria Deane Institute, Oswaldo Cruz
Foundation (ILMD, FIOCRUZ-AM) for help in using the software for statistical analysis
and on the elaboration of the map. In addition, we are also thankful to the Laboratory
of Functional Genomics and Bioinformatics of Oswaldo Cruz Institute (Fiocruz, RJ) for
the indispensable support in the DNA sequencing reactions.
References
1. Prado M, da Silva MB, Laurenti R, Travassos LR, Taborda CP. Mortality due to systemic mycoses as a primary cause of death or in association with AIDS in Brazil: A review from 1996 to 2006. Mem Inst Oswaldo Cruz. 2009;104: 513–521. doi:10.1590/S0074-02762009000300019
2. Park BJ, Wannemuehler KA, Marston BJ, Govender N, Pappas PG, Chiller TM. Estimation of the current global burden of cryptococcal meningitis among persons living with HIV/AIDS. AIDS. 2009;23: 525–530. doi:10.1097/QAD.0b013e328322ffac
3. Saraiva MDGG, Santos ECS, Saraceni V, Dos Rocha LLS, Monte RL, Albuquerque BC De, et al. Epidemiology of infectious meningitis in the state of Amazonas, Brazil. Rev Soc Bras Med Trop. 2015;48: 79–86. doi:10.1590/0037-8682-0116-2014
4. Oliveira RDSM De, Benzaken AS, Saraceni V, Sabidó M. Hiv/aids epidemic in the state of Amazonas: characteristics and trends from 2001 to 2012. Rev Soc Bras Med Trop. 2015;48: 70–78. doi:10.1590/0037-8682-0121-2013
5. Kwon-chung KJ, Bennett JE, Wickes BL, Meyer W, Cuomo CA, Wollenburg KR, et al. The Case for Adopting the “ Species Complex ” Nomenclature for the Etiologic Agents of Cryptococcosis. mSphere. 2017;2: 1–7. doi:10.1128/mSphere.00357-16
6. Alves GSB, Freire AKL, Bentes ADS, Pinheiro JF de S, de Souza JVB, Wanke B, et al. Molecular typing of environmental Cryptococcus neoformans/C. gattii species complex isolates from Manaus, Amazonas, Brazil. Mycoses. 2016;59: 509–15. doi:10.1111/myc.12499
7. Costa S, dos S Lazéra M, Santos WRA, Morales BP, Bezerra CCF, Nishikawa MM, et al. First isolation of cryptococcus gattii molecular type VGII and Cryptococcus neoformans molecular type VNI from environmental sources in the city of Belém, Pará, Brazil. Mem Inst Oswaldo Cruz. 2009;104: 662–664.
56
doi:10.1590/S0074-02762009000400023
8. Mazza M, Refojo N, Bosco-Borgeat ME, Taverna CG, Trovero AC, Rogé A, et al. Cryptococcus gattii in urban trees from cities in North-eastern Argentina. Mycoses. 2013;56: 646–650. doi:10.1111/myc.12084
9. Ellabib MS, Aboshkiwa MA, Husien WM, D’Amicis R, Cogliati M. Isolation, Identification and Molecular Typing of Cryptococcus neoformans from Pigeon Droppings and Other Environmental Sources in Tripoli, Libya. Mycopathologia. Springer Netherlands; 2016; doi:10.1007/s11046-016-9996-4
10. Velagapudi R, Hsueh YP, Geunes-Boyer S, Wright JR, Heitman J. Spores as infectious propagules of Cryptococcus neoformans. Infect Immun. 2009;77: 4345–4355. doi:10.1128/IAI.00542-09
11. Chen SCA, Slavin MA, Heath CH, Geoffrey Playford E, Byth K, Marriott D, et al. Clinical manifestations of cryptococcus gattii infection: Determinants of neurological sequelae and death. Clin Infect Dis. 2012;55: 789–798. doi:10.1093/cid/cis529
12. Tan ZR, Long XY, Li GL, Zhou JX, Long L. Spectrum of neuroimaging findings in cryptococcal meningitis in immunocompetent patients in China — A series of 18 cases. J Neurol Sci. Elsevier B.V.; 2016;368: 132–137. doi:10.1016/j.jns.2016.06.069
13. Charlier C, Nielsen K, Daou S, Brigitte M, Chretien F, Dromer F. Evidence of a role for monocytes in dissemination and brain invasion by Cryptococcus neoformans. Infect Immun. 2009;77: 120–127. doi:10.1128/IAI.01065-08
14. Giacomazzi J, Baethgen L, Carneiro LC, Millington MA, Denning DW, Colombo AL, et al. The burden of serious human fungal infections in Brazil. Mycoses. 2016;59: 145–150. doi:10.1111/myc.12427
15. Saúde S de vigilância em. Vigilância epidemiologica da Criptococose. In: Ministério da Saúde [Internet]. Brasília (DF), Brazil; 2012 pp. 1–18. Available: www.sgc.goias.gov.br/upload/arquivos/2012-05/proposta_ve-criptococose1.pdf
16. Costa MC, Santos JRA, Ribeiro MJA, Freitas GJC de, Bastos RW, Ferreira GF, et al. The absence of microbiota delays the inflammatory response to Cryptococcus gattii. Int J Med Microbiol. Elsevier GmbH.; 2016;306: 187–195. doi:10.1016/j.ijmm.2016.03.010
17. Saijo T, Chen J, Chen SCA, Rosen LB, Yi J, Sorrell TC, et al. Anti-granulocyte-macrophage colony-stimulating fator autoantibodies are a risk factor for central nervous system infection by Cryptococcus gatti in otherwise immunocompetent patients. 2mBio. 2014;5: e00912–14. doi:10.1128/mBio.00912-14
18. Trilles L, Lazéra MDS, Wanke B, Oliveira RV, Barbosa GG, Nishikawa MM, et al. Regional pattern of the molecular types of Cryptococcus neoformans and Cryptococcus gattii in Brazil. Mem Inst Oswaldo Cruz. 2008;103: 455–462. doi:10.1590/S0074-02762008000500008
19. Martins LMS, Wanke B, Lazéra M dos S, Trilles L, Barbosa GG, de Macedo RCL, et al. Genotypes of Cryptococcus neoformans and Cryptococcus gattii as agents of endemic cryptococcosis in Teresina, Piauí (northeastern Brazil).
57
Mem Inst Oswaldo Cruz. 2011;106: 725–730. doi:S0074-02762011000600012 [pii]
20. Byrnes EJ, Li W, Lewit Y, Ma H, Voelz K, Ren P, et al. Emergence and pathogenicity of highly virulent Cryptococcus gattii genotypes in the northwest United States. PLoS Pathog. 2010;6: e1000850. doi:10.1371/journal.ppat.1000850
21. Byrnes EJ, Bildfell RJ, Frank S a, Mitchell TG, Marr K a, Heitman J. Molecular evidence that the range of the Vancouver Island outbreak of Cryptococcus gattii infection has expanded into the Pacific Northwest in the United States. J Infect Dis. 2009;199: 1081–6. doi:10.1086/597306
22. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, et al. A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc Natl Acad Sci U S A. 2004;101: 17258–17263. doi:10.1073/pnas.0402981101
23. Gillece JD, Schupp JM, Balajee SA, Harris J, Pearson T, Yan Y, et al. Whole genome sequence analysis of Cryptococcus gattii from the Pacific Northwest reveals unexpected diversity. PLoS One. 2011;6: e28550. doi:10.1371/journal.pone.0028550
24. Carriconde F, Gilgado F, Arthur I, Ellis D, Malik R, Wiele N Van De, et al. Clonality and a -a Recombination in the Australian Cryptococcus gattii VGII Population - An Emerging Outbreak in Australia. PLoS One. 2011;6. doi:10.1371/journal.pone.0016936
25. Trilles L, Meyer W, Wanke B, Guarro J, Lazéra M. Correlation of antifungal susceptibility and molecular type within the Cryptococcus neoformans/C. gattii species complex. Med Mycol. 2011;50: 328–32. doi:10.3109/13693786.2011.602126
26. Souto ACP, Bonfietti LX, Ferreira-paim K, Trilles L. Population Genetic Analysis Reveals a High Genetic Diversity in the Brazilian Cryptococcus gattii VGII Population and Shifts the Global Origin from the Amazon Rainforest to the Semi-arid Desert in the Northeast of Brazil. 2016; 1–19. doi:10.1371/journal.pntd.0004885
27. Fraser JA, Giles SS, Wenink EC, Geunes-boyer SG, Wright JR, Diezmann S. Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature. 2005;437: 1360–1364. doi:10.1128/EC.1.5.704-718.2002
28. Meyer W, Marszewska K, Amirmostofian M, Igreja RP, Hardtke C, Methling K, et al. Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA - A pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis. 1999;20: 1790–1799. doi:10.1002/(SICI)1522-2683(19990101)20:8<1790::AID-ELPS1790>3.0.CO;2-2
29. Meyer W, Castañeda A, Jackson S, Huynh M, Castãneda E, Arechavala A, et al. Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg Infect Dis. 2003;9: 189–195. doi:10.3201/eid0902.020246
58
30. Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, St-Germain G, et al. AIDS patient death caused by novel Cryptococcus neoformans x C. gattii hybrid. Emerg Infect Dis. 2008;14: 1105–1108. doi:10.3201/eid1407.080122
31. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, et al. Unique hybrids between the fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 2006;6: 599–607. doi:10.1111/j.1567-1364.2006.00082.x
32. Meyer W, Aanensen DM, Boekhout T, Cogliati M, Diaz MR, Esposto MC, et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med Mycol. 2009;47: 561–570. doi:10.1080/13693780902953886.Consensus
33. Da Silva BK, Freire AK, Bentes ADS, Sampaio IDL, Santos LO, Dos Santos MS, et al. Characterization of clinical isolates of the Cryptococcus neoformans-Cryptococcus gattii species complex from the Amazonas State in Brazil. Rev Iberoam Micol. 2012;29: 40–3. doi:10.1016/j.riam.2011.05.003
34. Freire AKL, dos Santos Bentes A, de Lima Sampaio I, Matsuura ABJ, Ogusku MM, Salem JI, et al. Molecular characterisation of the causative agents of Cryptococcosis in patients of a tertiary healthcare facility in the state of Amazonas-Brazil. Mycoses. 2012;55: e145–50. doi:10.1111/j.1439-0507.2012.02173.x
35. Bentes ADS. Genotipagem de Cryptococcus neoformans e Cryptococcus gattii isolados de amostras ambientais coletadas em floresta nativa, rios e igarapés da cidade de Manaus - Brasil [Internet]. Universidade do Estado do Amazonas (UEA), Fundação de Medicina Tropical Dr. Heitor Vieira Dourado (FMT-HVD). 2014. Available: http://www.pos.uea.edu.br/data/area/dissertacao/download/20-1.pdf
36. Brito-Santos F, Barbosa GG, Trilles L, Nishikawa MM, Wanke B, Meyer W, et al. Environmental isolation of cryptococcus gattii VGII from indoor dust from typical wooden houses in the deep Amazonas of the rio Negro basin. PLoS One. 2015;10: 1–11. doi:10.1371/journal.pone.0115866
37. Alves GSB. Genotipagem de Cryptococcus neoformans e Cryptococcus gattii isolados de poeira domiciliar e avaliação da susceptibilidade a antifúngicos e da presença do antígeno em moradores de uma comunidade rural do Amazonas [Internet]. Universidade Federal do Amazonas (UFAM). 2016. Available: http://tede.ufam.edu.br/handle/tede/5325
38. Ferreira-Paim K, Andrade-Silva L, Fonseca FM, Ferreira TB, Mora DJ, Andrade-Silva J, et al. MLST-Based population genetic analysis in a global context reveals clonality amongst Cryptococcus neoformans var. grubii VNI isolates from HIV patients in Southeastern Brazil. PLoS Negl Trop Dis. 2017;11: e0005223. doi:10.1371/journal.pntd.0005223
39. Ferrer C, Colom F, Frasés S, Mulet E, Abad JL, Alió JL. Detection and identification of fungal pathogens by PCR and by ITS2 and 5.8S ribosomal DNA typing in ocular infections. J Clin Microbiol. 2001;39: 2873–2879. doi:10.1128/JCM.39.8.2873-2879.2001
59
40. Dunn IS, Blattner FR. Charons 36 to 40: multi enzyme, high capacity, recombination deficient replacement vectors with polylinkers and polystuffers. Nucleic Acids Res. 1987;15: 2677–2698.
41. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. EGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol. 2013;30: 2725–2729. doi:10.1093/molbev/mst197
42. Clinical and Laboratory Standard Institute (CLSI). Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts -Third Edition. CLSI document M27-A3. 2008.
43. Espinel-Ingroff A, Aller AI, Canton E, Castañón-Olivares LR, Chowdhary A, Cordoba S, et al. Cryptococcus neoformans-Cryptococcus gattii species complex: An international study of wild-type susceptibility endpoint distributions and epidemiological cutoff values for fluconazole, itraconazole, posaconazole, and voriconazole. Antimicrob Agents Chemother. 2012;56: 5898–5906. doi:10.1128/AAC.01115-12
44. Espinel-Ingroff A, Chowdhary A, Cuenca-Estrella M, Fothergill A, Fuller J, Hagen F, et al. Cryptococcus neoformans-Cryptococcus gattii species complex: an international study of wild-type susceptibility endpoint distributions and epidemiological cutoff values for amphotericin B and flucytosine. Antimicrob Agents Chemother. 2012;56: 3107–13. doi:10.1128/AAC.06252-11
45. Wiesner DL, Moskalenko O, Jennifer M. Cryptococcal Genotype Influences Immunological Response and Human Clinical Outcome after Meningitis. MbioAsmOrg. 2012;3: 1–10. doi:10.1128/mBio.00196-12.Updated
46. Khayhan K, Hagen F, Pan W, Simwami S, Fisher MC, Wahyuningsih R, et al. Geographically Structured Populations of Cryptococcus neoformans Variety grubii in Asia Correlate with HIV Status and Show a Clonal Population Structure. PLoS One. 2013;8: 1–14. doi:10.1371/journal.pone.0072222
47. Beale MA, Sabiiti W, Robertson EJ, Fuentes-Cabrejo KM, O´Hanlon SJ, Jarvis JN, et al. Genotypic diversity is associated with clinical outcome and phenotype in cryptococcal meningitis across Southern Africa. PLoS Negl Trop Dis. 2015;9: 1–18. doi:10.1371/journal.pntd.0003847
48. Jarvis JN, Bicanic T, Loyse A, Namarika D, Jackson A, Nussbaum JC, et al. Determinants of mortality in a combined cohort of 501 patients with HIV-associated cryptococcal meningitis: Implications for improving outcomes. Clin Infect Dis. 2014;58: 736–745. doi:10.1093/cid/cit794
49. Lessells RJ, Mutevedzi PC, Heller T, Newell M. Poor long-term outcomes for cryptococcal meningitis in rural South Africa. S Afr Med J. 2011;101: 251–2. Available: http://www.ncbi.nlm.nih.gov/pubmed/21786729
50. Rajasingham R, Meya DB, Boulware DR. Integrating cryptococcal antigen screening and pre-emptive treatment into routine HIV care. J Acquir Immune Defic Syndr. 2012;59: e85–91. doi:10.1097/QAI.0b013e31824c837e
51. Vidal JE, Toniolo C, Paulino A, Colombo A, dos Anjos Martins M, da Silva Meira C, et al. Asymptomatic cryptococcal antigen prevalence detected by lateral flow assay in hospitalised HIV-infected patients in São Paulo, Brazil.
60
Trop Med Int Heal. 2016;21: 1539–1544. doi:10.1111/tmi.12790
52. Mora DJ, da Cunha Colombo ER, Ferreira-Paim K, Andrade-Silva LE, Nascentes GAN, Silva-Vergara ML. Clinical, Epidemiological and Outcome Features of Patients with Cryptococcosis in Uberaba, Minas Gerais, Brazil. Mycopathologia. 2012. pp. 321–327. doi:10.1007/s11046-011-9504-9
53. Brizendine KD, Baddley JW, Pappas PG. Predictors of Mortality and Differences in Clinical Features among Patients with Cryptococcosis According to Immune Status. PLoS One. 2013;8. doi:10.1371/journal.pone.0060431
54. Lee Y, Wang J, Sun H, Chen Y. Comparisons of clinical features and mortality of cryptococcal meningitis between patients with and without human immunodeficiency virus infection. J Microbiol Immunol Infect. Elsevier Taiwan LLC; 2011;44: 338–45. doi:10.1016/j.jmii.2010.08.011
55. Merkler AE, Gaines N, Baradaran H, Schuetz AN, Lavi E, Simpson SA, et al. Direct Invasion of the Optic Nerves, Chiasm, and Tracts by Cryptococcus neoformans in an Immunocompetent Host. The Neurohospitalist. 2015;5: 217–222. doi:10.1177/1941874415569072
56. Moodley A, Naidoo N, Reitz D, Chetty N, Rae W. The Optic Nerve Compartment Syndrome in Cryptococcus -Induced Visual Loss. Neuro-Ophthalmology. 2013;37: 124–128. doi:10.3109/01658107.2013.792359
57. Palau AEB, Morgan ML, Foroozan R, Lee AG. Neuro-ophthalmic presentations and treatment of Cryptococcal meningitis-related increased intracranial pressure. Can J Ophthalmol. Elsevier; 2014;49: 473–477. doi:10.1016/j.jcjo.2014.06.012
58. Ghatalia PA, Vick A, Vattoth S, Roberson GH, Pappas PG. Reversible blindness in cryptococcal meningitis with normal intracranial pressure: Case report and review of the literature. Clin Infect Dis. 2014;59: 310–313. doi:10.1093/cid/ciu216
59. Portelinha J, Passarinho MP, Almeida AC, Costa JM. Bilateral optic neuropathy associated with cryptococcal meningitis in an immunocompetent patient. Case Reports. 2014;2014: bcr2013203451–bcr2013203451. doi:10.1136/bcr-2013-203451
60. Simwami SP, Khayhan K, Henk DA, Aanensen DM, Boekhout T, Hagen F, et al. Low diversity cryptococcus neoformans variety grubii multilocus sequence types from Thailand are consistent with an ancestral African origin. PLoS Pathog. 2011;7. doi:10.1371/journal.ppat.1001343
61. Litvintseva AP, Mitchell TG. Population genetic analyses reveal the African origin and strain variation of Cryptococcus neoformans var. grubii. PLoS Pathog. 2012;8: 8–11. doi:10.1371/journal.ppat.1002495
62. Litvintseva AP, Carbone I, Rossouw J, Thakur R, Govender NP, Mitchell TG. Evidence that the human pathogenic fungus Cryptococcus neoformans var. grubii may have evolved in Africa. PLoS One. 2011;6. doi:10.1371/journal.pone.0019688
63. Sanchini A, Smith IM, Sedlacek L, Schwarz R, Tintelnot K, Rickerts V.
61
Molecular typing of clinical Cryptococcus neoformans isolates collected in Germany from 2004 to 2010. Med Microbiol Immunol. 2014;203: 333–340. doi:10.1007/s00430-014-0341-6
64. Litvintseva AP, Thankur R, Vilgalys R, Mitchell TG. Multilocus Sequence Typing Reveals Three Genetic Subpopulations of Cryptococcus neoformans var. grubii (Serotype A), Including a Unique Population in Botswana. Genetics. 2006;172: 2223–2238. doi:10.1534/genetics.105.046672
65. Hagen F, Ceresini PC, Polacheck I, Ma H, van Nieuwerburgh F, Gabaldon T, et al. Ancient Dispersal of the Human Fungal Pathogen Cryptococcus gattii from the Amazon Rainforest. PLoS One. 2013;8. doi:10.1371/journal.pone.0071148
66. Herkert PF, Hagen F, de Oliveira Salvador GL, Gomes RR, Ferreira MS, Vicente VA, et al. Molecular characterisation and antifungal susceptibility of clinical Cryptococcus deuterogattii (AFLP6/VGII) isolates from Southern Brazil. Eur J Clin Microbiol Infect Dis. European Journal of Clinical Microbiology & Infectious Diseases; 2016;35: 1803–1810. doi:10.1007/s10096-016-2731-8
67. Chong HS, Dagg R, Malik R, Chen S, Carter D. In vitro susceptibility of the yeast pathogen cryptococcus to fluconazole and other azoles varies with molecular genotype. J Clin Microbiol. 2010;48: 4115–4120. doi:10.1128/JCM.01271-10
68. Iqbal N, DeBess EE, Wohrle R, Sun B, Nett RJ, Ahlquist AM, et al. Correlation of genotype and in vitro susceptibilities of Cryptococcus gattii strains from the Pacific Northwest of the United States. J Clin Microbiol. 2010;48: 539–544. doi:10.1128/JCM.01505-09
69. Sionov E, Chang YC, Garraffo HM, Kwon-Chung KJ. Heteroresistance to fluconazole in Cryptococcus neoformans is intrinsic and associated with virulence. Antimicrob Agents Chemother. 2009;53: 2804–2815. doi:10.1128/AAC.00295-09
70. Sionov E, Chang YC, Kwon-Chung KJ. Azole heteroresistance in Cryptococcus neoformans: Emergence of resistant clones with chromosomal disomy in the mouse brain during fluconazole treatment. Antimicrob Agents Chemother. 2013;57: 5127–5130. doi:10.1128/AAC.00694-13
71. Varma A, Kwon-Chung KJ. Heteroresistance of Cryptococcus gattii to fluconazole. Antimicrob Agents Chemother. 2010;54: 2303–2311. doi:10.1128/AAC.00153-10
72. Mlinarić-Missoni E, Hagen F, Chew WHM, Važić-Babić V, Boekhout T, Begovac J. In vitro antifungal susceptibilities and molecular typing of sequentially isolated clinical Cryptococcus neoformans strains from Croatia. J Med Microbiol. 2011;60: 1487–1495. doi:10.1099/jmm.0.031344-0
62
Fig 1.
63
Fig 2A.
64
Fig 2B.
65
Fig 2C.
66
Fig 2. Color legend.
67
Supporting information
S1 Table. Patients informations and molecular data of all isolates analysed.
Allelic profile
Patient code
(Gender/age)
HIV
infection Origin
Year of
diagnosis
Samples
obtained Genotypes CAP59 GPD1 IGS1 LAC1 PLB1 SOD1 URA5 ST
4. Zaidi M, Qureshi S, Shakoor S, Fatima S, Mir F. Abdominal Lymphonodular Cryptococcosis in an Immunocompetent Child. Case Rep Pediatr. Hindawi Publishing Corporation; 2015;2015:4.
5. Brizendine KD, Baddley JW, Pappas PG. Predictors of Mortality and Differences in Clinical Features among Patients with Cryptococcosis According to Immune Status. PLoS One. 2013;8(3).
6. Moreira TDA, Ferreira MS, Ribas RM, Borges AS. Criptococose: Estudo clínico-epidemiológico, laboratorial e das variedades do fungo em 96 pacientes. Rev Soc Bras Med Trop. 2006;39(3):255–8.
7. Lui G, Lee N, Ip M, Choi KW, Tso YK, Lam E, et al. Cryptococcosis in apparently immunocompetent patients. QJM - Mon J Assoc Physicians. 2006;99(3):143–51.
8. Lin YY, Shiau S, Fang CT. Risk factors for invasive Cryptococcus neoformans diseases: A case-control study. PLoS One. 2015;10(3):1–13.
9. Suwatanapongched T, Sangsatra W, Boonsarngsuk V, Watcharananan SP, Incharoen P. Clinical and radiologic manifestations of pulmonary cryptococcosis in immunocompetent patients and their outcomes after treatment. Diagnostic Interv Radiol. 2013;19(6):438–46.
10. Albuquerque AA, Junior VLP, Lazéra MDS. Cutaneous manifestation of cryptococcosis in a patient with acquired immunodeficiency syndrome ( AIDS ) - a case report. Rev Med e Saúde Brasília. 2012;1:137–42.
11. Chen S, Sorrell T, Nimmo G, Speed B, Currie B, Ellis D, et al. Epidemiology and host- and variety-dependent characteristics of infection due to Cryptococcus neoformans in Australia and New Zealand. Australasian Cryptococcal Study Group. Clin Infect Dis. 2000;31:499–508.
12. Lee Y, Wang J, Sun H, Chen Y. Comparisons of clinical features and mortality of cryptococcal meningitis between patients with and without human immunodeficiency virus infection. J Microbiol Immunol Infect. Elsevier Taiwan LLC; 2011;44(5):338–45.
13. Okamoto K, Hatakeyama S, Itoyama S, Nukui Y, Yoshino Y, Kitazawa T, et al. Cryptococcus gattii genotype VGIIa infection in man, Japan, 2007. Emerg Infect Dis. 2010;16(7):1155–7.
71
14. Jarvis JN, Bicanic T, Loyse A, Namarika D, Jackson A, Nussbaum JC, et al. Determinants of mortality in a combined cohort of 501 patients with HIV-associated cryptococcal meningitis: Implications for improving outcomes. Clin Infect Dis. 2014;58(5):736–45.
15. Mora DJ, da Cunha Colombo ER, Ferreira-Paim K, Andrade-Silva LE, Nascentes GAN, Silva-Vergara ML. Clinical, Epidemiological and Outcome Features of Patients with Cryptococcosis in Uberaba, Minas Gerais, Brazil. Mycopathologia. 2012. p. 321–7.
16. Park BJ, Wannemuehler KA, Marston BJ, Govender N, Pappas PG, Chiller TM. Estimation of the current global burden of cryptococcal meningitis among persons living with HIV/AIDS. AIDS. 2009;23(4):525–30.
17. Prado M, da Silva MB, Laurenti R, Travassos LR, Taborda CP. Mortality due to systemic mycoses as a primary cause of death or in association with AIDS in Brazil: A review from 1996 to 2006. Mem Inst Oswaldo Cruz. 2009;104(3):513–21.
18. Saúde S de vigilância em. Vigilância epidemiologica da Criptococose [Internet]. Ministério da Saúde. Brasília (DF), Brazil; 2012. p. 1–18. Available from: www.sgc.goias.gov.br/upload/arquivos/2012-05/proposta_ve-criptococose1.pdf
19. Saraiva MDGG, Santos ECS, Saraceni V, Dos Rocha LLS, Monte RL, Albuquerque BC De, et al. Epidemiology of infectious meningitis in the state of Amazonas, Brazil. Rev Soc Bras Med Trop. 2015;48(Suppl I):79–86.
20. Souza SLS De, Feitoza PVS, Araujo JR De, Andrade RV De, Ferreira LCDL, S.L.S. DS, et al. Causes of death among patients with acquired immunodeficiency syndrome autopsied at the Tropical Medicine Foundation of Amazonas. Rev Soc Bras Med Trop. 2008;41(3):247–51.
21. International Mycological Association. Mycobank Database [Internet]. 2016 [cited 2016 Mar 17]. Available from: http://www.mycobank.org/BioloMICS.aspx?Table=Mycobank&Rec=106784&Fields=All
22. Fonseca A, Boekhout T, Fell J. Cryptococcus Vuillemin (1901). The Yeats: A taxonomic study. Fifth edit. Kurtzman C, Fell J, Boekhout T, editors. Amsterdam: Elsevier; 2011. 1661-1745 p.
23. Kwon-chung KJ, Bennett JE, Wickes BL, Meyer W, Cuomo CA, Wollenburg KR, et al. The Case for Adopting the “ Species Complex ” Nomenclature for the Etiologic Agents of Cryptococcosis. mSphere. 2017;2(1):1–7.
24. Benham RW. The genus Cryptococcus. Bacteriol Rev. 1956;20(3):189–201.
25. Pedroso RS, Ferreira JC, Candido RC. The isolation and characterization of virulence factors of Cryptococcus spp. from saprophytic sources in the city of Ribeirão Preto, São Paulo, Brazil. Microbiol Res. 2009;164(2):221–7.
26. Matos CS, De Souza Andrade A, Oliveira NS, Barros TF. Microbiological characteristics of clinical isolates of Cryptococcus spp. in Bahia, Brazil: Molecular types and antifungal susceptibilities. Eur J Clin Microbiol Infect Dis.
72
2012;31(7):1647–52.
27. Johnston SA, Voelz K, May RC. Cryptococcus neoformans Thermotolerance to Avian Body Temperature Is Sufficient For Extracellular Growth But Not Intracellular Survival In Macrophages. Sci Rep. 2016;6:20977.
28. Kwon-Chung KJ. A New Genus, Filobasidiella, the Perfect State of Cryptococcus neoformans. Mycologia. 1975;67:1197–200.
29. Tscharke RL, Lazera M, Chang YC, Wickes BL, Kwon-Chung KJ. Haploid fruiting in Cryptococcus neoformans is not mating type α-specific. Fungal Genet Biol. 2003;39(3):230–7.
30. Fraser JA, Subaran RL, Nichols CB, Heitman J. Recapitulation of the sexual cycle of the primary fungal pathogen Cryptococcus neoformans var. gattii: Implications for an outbreak on Vancouver Island, Canada. Eukaryot Cell. 2003;2(5):1036–45.
31. Fraser JA, Giles SS, Wenink EC, Geunes-boyer SG, Wright JR, Diezmann S. Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature. 2005;437:1360–4.
32. Lin X, Litvintseva AP, Nielsen K, Patel S, Floyd A, Mitchell TG, et al. AD hybrids of Cryptococcus neoformans: Evidence of same-sex mating in nature and hybrid fitness. PLoS Genet. 2007;3(10):1975–90.
33. Franzot SP, Salkin IF, Casadevall A. Cryptococcus neoformans var. grubii: Separate varietal status for Cryptococcus neoformans serotype A isolates. J Clin Microbiol. 1999;37(3):838–40.
34. Retini C, Kozel TR, Pietrella D, Monari C, Bistoni F, Vecchiarelli A. Interdependency of interleukin-10 and interleukin-12 in regulation of T-cell differentiation and effector function of monocytes in response to stimulation with Cryptococcus neoformans. Infect Immun. 2001;69(10):6064–73.
35. Zaragoza O, Fries BC, Casadevall A. Induction of Capsule Growth in Cryptococcus neoformans by Mammalian Serum and CO 2 Induction of Capsule Growth in Cryptococcus neoformans by Mammalian Serum and CO 2. 2003;71(11):6155–64.
36. Fan W, Kraus PR, Boily M, Heitman J. Cryptococcus neoformans Gene Expression during Murine Macrophage Infection. Eukaryot Cell. 2005;4(8):1420–33.
37. Mansour MK, Vyas JM, Levitz SM. Dynamic virulence: Real-time assessment of intracellular pathogenesis links cryptococcus neoformans phenotype with clinical outcome. mBio. 2011. p. 1–3.
38. Alanio A, Vernel-Pauillac F, Sturny-Leclere A, Dromer F. Cryptococcus neoformans host adaptation: Toward biological evidence of dormancy. MBio. 2015;6(2):1–13.
39. Williamson PR. Laccase and melanin in the pathogenesis of Cryptococcus neoformans. Front Biosci. 1997;2(19):e99–107.
73
40. Eisenman HC, Nosanchuk JD, Webber JBW, Emerson RJ, Camesano TA, Casadevall A. Microstructure of cell wall-associated melanin in the human pathogenic fungus Cryptococcus neoformans. Biochemistry. 2005;44(10):3683–93.
41. Ganendren R, Carter E, Sorrell T, Widmer F, Wright L. Phospholipase B activity enhances adhesion of Cryptococcus neoformans to a human lung epithelial cell line. Microbes Infect. 2006;8(4):1006–15.
42. Olszewski M a, Noverr MC, Chen G-H, Toews GB, Cox GM, Perfect JR, et al. Urease expression by Cryptococcus neoformans promotes microvascular sequestration, thereby enhancing central nervous system invasion. Am J Pathol. 2004;164(5):1761–71.
43. Vu K, Tham R, Uhrig JP, Thompson GR, Pombejra SN, Jamklang M, et al. Invasion of the central nervous system by Cryptococcus neoformans requires a secreted fungal metalloprotease. MBio. 2014;5(3):1–13.
44. Charlier C, Nielsen K, Daou S, Brigitte M, Chretien F, Dromer F. Evidence of a role for monocytes in dissemination and brain invasion by Cryptococcus neoformans. Infect Immun. 2009;77(1):120–7.
45. Chang YC, Stins MF, Mccaffery MJ, Miller GF, Pare DR, Dam T, et al. Cryptococcal Yeast Cells Invade the Central Nervous System via Transcellular Penetration of the Blood-Brain Barrier Cryptococcal Yeast Cells Invade the Central Nervous System via Transcellular Penetration of the Blood-Brain Barrier. Infect Immun. 2004;72(9):4985–95.
46. Lindenberg ADSC, Chang MR, Paniago AMM, Lazéra MDS, Moncada PMF, Bonfim GF, et al. Clinical and epidemiological features of 123 cases of cryptococcosis in Mato Grosso do Sul, Brazil. Rev Inst Med Trop Sao Paulo. 2008;50(2):75–8.
47. Lazera MS, Salmito Cavalcanti M a, Londero a T, Trilles L, Nishikawa MM, Wanke B. Possible primary ecological niche of Cryptococcus neoformans. Med Mycol Off Publ Int Soc Hum Anim Mycol. 2000;38(5):379–83.
48. Ellabib MS, Aboshkiwa MA, Husien WM, D’Amicis R, Cogliati M. Isolation, Identification and Molecular Typing of Cryptococcus neoformans from Pigeon Droppings and Other Environmental Sources in Tripoli, Libya. Mycopathologia. 2016;
49. Ferreira AS, Sampaio A, Maduro AP, Silva I, Teles F, Martins MDL, et al. Genotypic diversity of environmental Cryptococcus neoformans isolates from Northern Portugal. Mycoses. 2013;6–12.
50. Costa S, dos S Lazéra M, Santos WRA, Morales BP, Bezerra CCF, Nishikawa MM, et al. First isolation of cryptococcus gattii molecular type VGII and Cryptococcus neoformans molecular type VNI from environmental sources in the city of Belém, Pará, Brazil. Mem Inst Oswaldo Cruz. 2009;104(4):662–4.
51. Galanis E, MacDougall L. Epidemiology of Cryptococcus gattii, British Columbia, Canada, 1999-2007. Emerg Infect Dis. 2010;16(2):251–7.
74
52. Harris JR, Lockhart SR, Debess E, Marsden-Haug N, Goldoft M, Wohrle R, et al. Cryptococcus gattii in the united states: Clinical aspects of infection with an emerging pathogen. Clin Infect Dis. 2011;53(12):1188–95.
53. Carriconde F, Gilgado F, Arthur I, Ellis D, Malik R, Wiele N Van De, et al. Clonality and a -a Recombination in the Australian Cryptococcus gattii VGII Population - An Emerging Outbreak in Australia. PLoS One. 2011;6(2).
54. Trilles L, Lazéra MDS, Wanke B, Oliveira RV, Barbosa GG, Nishikawa MM, et al. Regional pattern of the molecular types of Cryptococcus neoformans and Cryptococcus gattii in Brazil. Mem Inst Oswaldo Cruz. 2008;103(5):455–62.
55. Martins LMS, Wanke B, Lazéra M dos S, Trilles L, Barbosa GG, de Macedo RCL, et al. Genotypes of Cryptococcus neoformans and Cryptococcus gattii as agents of endemic cryptococcosis in Teresina, Piauí (northeastern Brazil). Mem Inst Oswaldo Cruz. 2011;106(6):725–30.
56. Nielsen K, De Obaldia AL, Heitman J. Cryptococcus neoformans mates on pigeon guano: Implications for the realized ecological niche and globalization. Eukaryot Cell. 2007;6(6):949–59.
57. Baltazar LDM. Primeiro isolamento ambiental de Cryptococcus gattii no Estado do Espírito Santo First isolation of Cryptococcus gattii from the environment in the State of Espírito Santo. Rev Soc Bras Med Trop. 2008;41(5):449–53.
58. Mazza M, Refojo N, Bosco-Borgeat ME, Taverna CG, Trovero AC, Rogé A, et al. Cryptococcus gattii in urban trees from cities in North-eastern Argentina. Mycoses. 2013;56(6):646–50.
59. Bentes ADS. Genotipagem de Cryptococcus neoformans e Cryptococcus gattii isolados de amostras ambientais coletadas em floresta nativa, rios e igarapés da cidade de Manaus - Brasil [Internet]. Universidade do Estado do Amazonas (UEA), Fundação de Medicina Tropical Dr. Heitor Vieira Dourado (FMT-HVD); 2014. Available from: http://www.pos.uea.edu.br/data/area/dissertacao/download/20-1.pdf
60. Alves GSB, Freire AKL, Bentes ADS, Pinheiro JF de S, de Souza JVB, Wanke B, et al. Molecular typing of environmental Cryptococcus neoformans/C. gattii species complex isolates from Manaus, Amazonas, Brazil. Mycoses. 2016;59:509–15.
61. Brito-Santos F, Barbosa GG, Trilles L, Nishikawa MM, Wanke B, Meyer W, et al. Environmental isolation of cryptococcus gattii VGII from indoor dust from typical wooden houses in the deep Amazonas of the rio Negro basin. PLoS One. 2015;10(2):1–11.
62. Alves GSB. Genotipagem de Cryptococcus neoformans e Cryptococcus gattii isolados de poeira domiciliar e avaliação da susceptibilidade a antifúngicos e da presença do antígeno em moradores de uma comunidade rural do Amazonas [Internet]. Universidade Federal do Amazonas (UFAM); 2016. Available from: http://tede.ufam.edu.br/handle/tede/5325
63. Kidd SE, Hagen F, Tscharke RL, Huynh M, Bartlett KH, Fyfe M, et al. A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on
75
Vancouver Island (British Columbia, Canada). Proc Natl Acad Sci U S A. 2004;101(49):17258–63.
64. Byrnes EJ, Li W, Lewit Y, Ma H, Voelz K, Ren P, et al. Emergence and pathogenicity of highly virulent Cryptococcus gattii genotypes in the northwest United States. PLoS Pathog. 2010;6(4):e1000850.
65. Byrnes EJ, Bildfell RJ, Frank S a, Mitchell TG, Marr K a, Heitman J. Molecular evidence that the range of the Vancouver Island outbreak of Cryptococcus gattii infection has expanded into the Pacific Northwest in the United States. J Infect Dis. 2009;199(7):1081–6.
66. Hagen F, Ceresini PC, Polacheck I, Ma H, van Nieuwerburgh F, Gabaldon T, et al. Ancient Dispersal of the Human Fungal Pathogen Cryptococcus gattii from the Amazon Rainforest. PLoS One. 2013;8(8).
67. Meyer W, Marszewska K, Amirmostofian M, Igreja RP, Hardtke C, Methling K, et al. Molecular typing of global isolates of Cryptococcus neoformans var. neoformans by polymerase chain reaction fingerprinting and randomly amplified polymorphic DNA - A pilot study to standardize techniques on which to base a detailed epidemiological survey. Electrophoresis. 1999;20(8):1790–9.
68. Meyer W, Castañeda A, Jackson S, Huynh M, Castãneda E, Arechavala A, et al. Molecular typing of IberoAmerican Cryptococcus neoformans isolates. Emerg Infect Dis. 2003;9(2):189–95.
69. Bovers M, Hagen F, Kuramae EE, Diaz MR, Spanjaard L, Dromer F, et al. Unique hybrids between the fungal pathogens Cryptococcus neoformans and Cryptococcus gattii. FEMS Yeast Res. 2006;6(4):599–607.
70. Bovers M, Hagen F, Kuramae EE, Hoogveld HL, Dromer F, St-Germain G, et al. AIDS patient death caused by novel Cryptococcus neoformans x C. gattii hybrid. Emerg Infect Dis. 2008;14(7):1105–8.
71. Cogliati M. Global Molecular Epidemiology of Cryptococcus neoformans and Cryptococcus gattii: An Atlas of the Molecular Types. Scientifica (Cairo). 2013;2013:23.
72. Da Silva BK, Freire AK, Bentes ADS, Sampaio IDL, Santos LO, Dos Santos MS, et al. Characterization of clinical isolates of the Cryptococcus neoformans-Cryptococcus gattii species complex from the Amazonas State in Brazil. Rev Iberoam Micol. 2012;29(1):40–3.
73. Freire AKL, dos Santos Bentes A, de Lima Sampaio I, Matsuura ABJ, Ogusku MM, Salem JI, et al. Molecular characterisation of the causative agents of Cryptococcosis in patients of a tertiary healthcare facility in the state of Amazonas-Brazil. Mycoses. 2012;55(3):e145–50.
74. Meyer W, Aanensen DM, Boekhout T, Cogliati M, Diaz MR, Esposto MC, et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med Mycol. 2009;47(6):561–70.
75. Litvintseva AP, Thankur R, Vilgalys R, Mitchell TG. Multilocus Sequence Typing Reveals Three Genetic Subpopulations of Cryptococcus neoformans
76
var. grubii (Serotype A), Including a Unique Population in Botswana. Genetics. 2006;172(4):2223–38.
76. Khayhan K, Hagen F, Pan W, Simwami S, Fisher MC, Wahyuningsih R, et al. Geographically Structured Populations of Cryptococcus neoformans Variety grubii in Asia Correlate with HIV Status and Show a Clonal Population Structure. PLoS One. 2013;8(9):1–14.
77. Umeyama T, Ohno H, Minamoto F, Takagi T, Tanamachi C, Tanabe K, et al. Determination of epidemiology of clinically isolated cryptococcus neoformans strains in Japan by Multilocus sequence typing. Jpn J Infect Dis. 2013;66(1):51–5.
78. Beale MA, Sabiiti W, Robertson EJ, Fuentes-Cabrejo KM, O´Hanlon SJ, Jarvis JN, et al. Genotypic diversity is associated with clinical outcome and phenotype in cryptococcal meningitis across Southern Africa. PLoS Negl Trop Dis [Internet]. 2015;9(6):1–18. Available from: http://dx.doi.org/10.1371/journal.pntd.0003847
79. Kaocharoen S, Ngamskulrungroj P, Firacative C, Trilles L, Piyabongkarn D, Banlunara W, et al. Molecular Epidemiology Reveals Genetic Diversity amongst Isolates of the Cryptococcus neoformans/C. gattii Species Complex in Thailand. PLoS Negl Trop Dis. 2013;7(7):1–9.
80. Singer LM, Meyer W, Firacative C, Thompson GR, Samitz E, Sykes JE. Antifungal drug susceptibility and phylogenetic diversity among Cryptococcus isolates from dogs and cats in North America. J Clin Microbiol. 2014;52(6):2061–70.
81. Danesi P, Firacative C, Cogliati M, Otranto D, Capelli G, Meyer W. Multilocus sequence typing (MLST) and M13 fingerprinting revealed heterogeneity amongst Cryptococcus species obtained from Italian veterinary isolates. FEMS Yeast Res. 2014;1–13.
82. Ferreira-Paim K, Andrade-Silva L, Fonseca FM, Ferreira TB, Mora DJ, Andrade-Silva J, et al. MLST-Based population genetic analysis in a global context reveals clonality amongst Cryptococcus neoformans var. grubii VNI isolates from HIV patients in Southeastern Brazil. PLoS Negl Trop Dis. 2017;11(1):29.
83. Desnos-Ollivier M, Patel S, Raoux-Barbot D, Heitman J, Dromer F. Cryptococcosis Serotypes Impact Outcome and Provide Evidence of Cryptococcus neoformans Speciation. MBio. 2015;6(3):e00311–5.
84. Lizarazo J, Escandón P, Agudelo CI, Firacative C, Meyer W, Castan E. Retrospective Study of the Epidemiology and Clinical Manifestations of Cryptococcus gattii Infections in Colombia from 1997 – 2011. PLoS One. 2014;8(11).
85. Dou HT, Xu YC, Wang HZ, Li TS. Molecular epidemiology of Cryptococcus neoformans and Cryptococcus gattii in China between 2007 and 2013 using multilocus sequence typing and the DiversiLab system. Eur J Clin Microbiol Infect Dis. 2015;34(4):753–62.
77
86. Hagen F, Colom MF, Swinne D, Tintelnot K, Iatta R, Montagna MT, et al. Autochthonous and dormant Cryptococcus gattii infections in Europe. Emerg Infect Dis. 2012;18(10):1618–24.
87. Souto ACP, Bonfietti LX, Ferreira-Paim K, Trilles L, Martins M, Ribeiro-Alves M, et al. Population Genetic Analysis Reveals a High Genetic Diversity in the Brazilian Cryptococcus gattii VGII Population and Shifts the Global Origin from the Amazon Rainforest to the Semi-arid Desert in the Northeast of Brazil. PLoS Negl Trop Dis. 2016;10(8):1–19.
88. Engelthaler DM, Hicks ND, Gillece JD, Engelthaler DM, Hicks ND, Gillece JD, et al. Cryptococcus gattii in North American Pacific Northwest : Whole-Population Genome Analysis Provides Insights into Species Evolution and Dispersal. MBio. 2014;5.
89. Fortes ST, Lazéra M dos S, Nishikawa MM, Macedo RCL, Wanke B. First isolation of Cryptococcus neoformans var . gattii from a native jungle tree in the Brazilian Amazon rainforest. Mycoses. 2001;44:137–40.
90. Simwami SP, Khayhan K, Henk DA, Aanensen DM, Boekhout T, Hagen F, et al. Low diversity cryptococcus neoformans variety grubii multilocus sequence types from Thailand are consistent with an ancestral African origin. PLoS Pathog. 2011;7(4).
91. Trilles L, Meyer W, Wanke B, Guarro J, Lazéra M. Correlation of antifungal susceptibility and molecular type within the Cryptococcus neoformans/C. gattii species complex. Med Mycol. 2011;50(3):328–32.
92. Wiesner DL, Moskalenko O, Jennifer M. Cryptococcal Genotype Influences Immunological Response and Human Clinical Outcome after Meningitis. MbioAsmOrg. 2012;3(5):1–10.
93. Chong HS, Dagg R, Malik R, Chen S, Carter D. In vitro susceptibility of the yeast pathogen cryptococcus to fluconazole and other azoles varies with molecular genotype. J Clin Microbiol. 2010;48(11):4115–20.
94. Iqbal N, DeBess EE, Wohrle R, Sun B, Nett RJ, Ahlquist AM, et al. Correlation of genotype and in vitro susceptibilities of Cryptococcus gattii strains from the Pacific Northwest of the United States. J Clin Microbiol. 2010;48(2):539–44.
95. Ferrer C, Colom F, Frasés S, Mulet E, Abad JL, Alió JL. Detection and identification of fungal pathogens by PCR and by ITS2 and 5.8S ribosomal DNA typing in ocular infections. J Clin Microbiol. 2001;39(8):2873–9.
96. Dunn IS, Blattner FR. Charons 36 to 40: multi enzyme, high capacity, recombination deficient replacement vectors with polylinkers and polystuffers. Nucleic Acids Res. 1987;15(6):2677–98.
97. Biosystems A. DNA Sequencing by Capillary Electrophoresis. Appl Biosyst Chem Guid. 2009;310.
98. Francisco AP, Bugalho M, Ramirez M, Carriço JA. Global optimal eBURST analysis of multilocus typing data using a graphic matroid approach. BMC Bioinformatics [Internet]. 2009;10(1):152. Available from:
78
http://www.biomedcentral.com/1471-2105/10/152
99. Clinical and Laboratory Standard Institute (CLSI). Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts -Third Edition. CLSI document M27-A3. 2008. 40 p.
100. Espinel-Ingroff A, Chowdhary A, Cuenca-Estrella M, Fothergill A, Fuller J, Hagen F, et al. Cryptococcus neoformans-Cryptococcus gattii species complex: an international study of wild-type susceptibility endpoint distributions and epidemiological cutoff values for amphotericin B and flucytosine. Antimicrob Agents Chemother. 2012;56(6):3107–13.
101. Espinel-Ingroff A, Aller AI, Canton E, Castañón-Olivares LR, Chowdhary A, Cordoba S, et al. Cryptococcus neoformans-Cryptococcus gattii species complex: An international study of wild-type susceptibility endpoint distributions and epidemiological cutoff values for fluconazole, itraconazole, posaconazole, and voriconazole. Antimicrob Agents Chemother. 2012;56(11):5898–906.
79
7 ANEXOS 7.1 Anexo A - Primers dos sete lócus analisados pelo mlst e suas respectivas temperaturas de amplificação.
pb= pares de bases; Cu = Cobre; Zn = Zinco; F (Foward) = primer senso; R (Reverse) = antisenso; min = minutos; seg = segundos. Adaptado
de Meyer et al. (2009)72.
Lócus (pb)
Produto gênico Iniciadores Condições de amplificação
CAP59 (559)
Proteína capsular (fator de virulência)
CAP59 F 5′ CTCTACGTCGAGCAAGTCAAG 3′ CAP59 R 5′ TCCGCTGCACAAGTGATACCC 3′
94°C por 3 min / 40 ciclos: 94 °C por 30 seg, 56 °C por 30 seg, 72 °C por 1 min / 72 °C por 6 min
LAC1 (469)
Lacase (fator de virulência)
LAC1 F 5′ AACATGTTCCCTGGGCCTGTG 3′ LAC1 R 5′ ATGAGAATTGAATCGCCTTGT 3′
94 °C por 3 min / 40 ciclos: 94 °C por 30 seg, 58 °C por 30 seg, 72 °C por 1 min / 72 °C por 6 min
PLB1 (532)
Fosfolipase (fator de virulência)
PLB1 F 5′ CTTCAGGCGGAGAGAGGTTT 3′ PLB1 R 5′ GATTTGGCGTTGGTTTCAGT 3′
94°C por 3 min / 40 ciclos: 94°C por 45 seg, 61°C por 45 seg, 72°C por 1 min / 72 °C por 6 min
URA5 (601)
Orotidina monofosfato pirofosforilase
URA5 F 5′ ATGTCCTCCCAAGCCCTCGAC 3′ URA5 R 5′ TTAAGACCTCTGAACACCGTACTC 3′
94°C por 3 min / 40 ciclos: 94°C por 45 seg, 63°C por 1 min, 72°C por 2 min / 72 °C por 6 min
GPD1 (543)
Gliceraldeído-3-fosfato desidrogenase
GPD1 F 5′ CCACCGAACCCTTCTAGGATA 3′ GPD1 R 5′ CTTCTTGGCACCTCCCTTGAG 3′
94°C por 3 min / 40 ciclos: 94°C por 45 seg, 63°C por 1 min, 72°C por 2 min / 72 °C por 6 min
SOD1CN (700)
Cu, Zn superóxido dismutase
Primers para Cryptococcus neoformans SOD1CN F 5′AAGCCTCTCATCCATATCTT 3′
SOD1CN R 5′TTCAACCACGAATATGTA 3′ 94°C por 3 min / 40 ciclos: 94°C por 30 seg, 52°C
por 30 seg, 72°C por 1.5 min / 72 °C por 6 min
SOD1CG (700)
Primers for Cryptococcus gattii SOD1CG F 5′ GATCCTCACGCCATTACG 3′
SOD1CG R 5′ GAATGATGCGCTTAGTTGGA 3′
IGS1 (723)
Espaço intergênico do RNA ribossomal
IGS1 F 5′ ATCCTTTGCAGACGACTTGA 3′ IGS1 R 5′ GTGATCAGTGCATTGCATGA 3′
94°C por 3 min / 40 ciclos: 94°C por 30 seg, 60°C por 30 seg, 72°C por 1 min / 72 °C por 6 min
80
7.2 Anexo B – Parecer do CEP da FMT-HVD
81
7.3 Anexo C - Termo de Consentimento Livre e Esclarecido (TCLE)
82
83
84
85
86
7.4 Anexo D - Formulário aplicado para entrevista e coleta de dados clínico-epidemiológicos e laboratoriais
Prontuário: Código do paciente: Entrada na FMT-HVD: Veio de outro hospital?
Tempo nesta moradia: Tipo de residência: Alvenaria Madeira sem pintura Madeira com pintura
ATIVIDADES OU EXPOSIÇÕES DE RISCO
Construção civil Visita a cavernas Criação de aves em domicílio Exposição a fezes de Pombo Agricultura Mineração
Morador de rua Jardinagem Carpintaria Marcenaria Nenhuma dessas condições Trabalha em Demolições Mora próximo a madeireira Contato com Galinheiro Visita a Áreas Endêmicas (Austrália, Canadá, . Costa do Pacífico EUA, Nordeste Brasileiro)
Outros:
FATORES DE RISCO PRÉ-EXISTENTES
Alcoolismo Tabagismo Uso de drogas ilícitas Diabetes mellitus Cirrose HAS Hepatite Qual____________ Transplante Qual:_______________________________ Gravidez Neoplasia Qual: ______________________________
Doença cardiovascular Doença renal crônica TB Leucemia Linfoma Doença auto-imune Qual:_____________________ Uso de anti-TNF Qual:___________________________ Data Início ___/___/___ Data Término ___/___/___ Uso de corticoesteróides
87
Qual:________________________Data Início ___/___/___ Data Término ___/___/___ Outro Imunossupressor Qual:________________________
HIV: Sim Não Uso da TARV: Regular Irregular Não iniciada Esquema TARV: Data Início: ___/___/___
Data em que foi diagnosticado com HIV: ___/___/___ A criptococose foi a doença definidora de AIDS? Sim Não
Outro fator de risco? Qual? Não apresentou nenhum fator de risco (imunocompetente)
MANIFESTAÇÕES CLÍNICAS
Cefaleia Febre Náuseas Vômitos Anisocoria Convulsão Desorientação Tosse Dispnéia Perda Ponderal >10% <10% Tontura Dor Torácica Déficit de memória Bradicardia Hipertensão Zumbido Fotofobia Estrabismo Amaurose Diplopia Déficit Focal Diminuição Acuidade Auditiva Diminuição Acuidade Visual Papiledema Descerebração (extensão de membros superiores e inferiores) Desvio conjugado do olhar Rigidez de nuca Síndrome Cerebelar
ANÁLISE PELO LABORATÓRIO DE MICOLOGIA DE AMOSTRAS BIOLÓGICAS SUCESSIVAS
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado
89
Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
90
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
Tipo de Amostra: Data de entrada: : ___/___/___ N⁰ da Requisição: N⁰ de identificação da Amostra: Resultado do exame direto com tinta nanquim: Negativo Raros Frequentes Numerosos Incontáveis Resul. da cultura em Ágar Níger: Negativa Positiva / Quant. De UFC´s: CGB: C.neoformans C. gattii Não realizado Contag. de cels. em 10 µL de LCR não centrifugado (nanquim) – Gemulantes: Não gemulantes: Total: Quant. Cels em 1 mL:
TRATAMENTO
SEQUELAS DESENVOLVIDAS DURANTE A INFECÇÃO Fase de indução
Diminuição da capacidade mental Hidrocefalia Amaurose Início Antifúngico utilizado Dose Fim do trat
Diminuição da acuidade visual Paralisia de nervos cranianos ___/___/___ ___/___/___
RECORRÊNCIA DA CRIPTOCOCOSE DURANTE O TRATAMENTO Fase de consolidação
Recaída (Cultura + após 6 meses de tratamento) Sim Não Data___/___/___
Início Antifúngico utilizado Dose Fim do trat
___/___/___ ___/___/___
DESFECHO CLÍNICO Fase de manutenção
Transferido (Data: ___/___/___) Óbito (Data: ___/___/___) Início Antifúngico utilizado Dose Fim do trat
91
Alta hospitalar (Data: ___/___/___) Em atendi (Data: ___/___/___) ___/___/___
___/___/___
Foram realizadas punções de alívio: Sim Não / Quantas: / Quantas amostras de LCR apresentaram cultivo positivo?