Type IV Pilus Genes pilA and pilC of Pseudomonas …jb.asm.org/content/182/8/2184.full.pdfmotility, and by electron microscopy. The pilC mutant had no pili and was defective in twitching

JOURNAL OF BACTERIOLOGY,0021-9193/00/$04.0010

Apr. 2000, p. 2184–2190 Vol. 182, No. 8

Copyright © 2000, American Society for Microbiology. All Rights Reserved.

Type IV Pilus Genes pilA and pilC of Pseudomonas stutzeriAre Required for Natural Genetic Transformation, and pilA

Can Be Replaced by Corresponding Genes fromNontransformable Species

STEFAN GRAUPNER,1 VERENA FREY,1 ROZITA HASHEMI,1 MICHAEL G. LORENZ,2

GUDRUN BRANDES,3 AND WILFRIED WACKERNAGEL1*

AG Genetik, Fachbereich Biologie, Universitat Oldenburg, D-26111 Oldenburg,1 Marine Mikrobiologie, FachbereichBiologie/Chemie, Zentrum fur Umweltforschung und Technologie, Universitat Bremen, D-28359 Bremen,2 and

Medizinische Hochschule Hannover, Abteilung Zellbiologie, D-30625 Hannover,3 Germany

Received 5 October 1999/Accepted 27 January 2000

Pseudomonas stutzeri lives in terrestrial and aquatic habitats and is capable of natural genetic transforma-tion. After transposon mutagenesis, transformation-deficient mutants were isolated from a P. stutzeri JM300strain. In one of them a gene which coded for a protein with 75% amino acid sequence identity to PilC ofPseudomonas aeruginosa, an accessory protein for type IV pilus biogenesis, was inactivated. The presence of typeIV pili was demonstrated by susceptibility to the type IV pilus-dependent phage PO4, by occurrence of twitchingmotility, and by electron microscopy. The pilC mutant had no pili and was defective in twitching motility.Further sequencing revealed that pilC is clustered in an operon with genes homologous to pilB and pilD of P.aeruginosa, which are also involved in pilus formation. Next to these genes but transcribed in the oppositeorientation a pilA gene encoding a protein with high amino acid sequence identity to pilin, the structuralcomponent of type IV pili, was identified. Insertional inactivation of pilA abolished pilus formation, PO4plating, twitching motility, and natural transformation. The amounts of 3H-labeled P. stutzeri DNA that werebound to competent parental cells and taken up were strongly reduced in the pilC and pilA mutants. Remark-ably, the cloned pilA genes from nontransformable organisms like Dichelobacter nodosus and the PAK and PAOstrains of P. aeruginosa fully restored pilus formation and transformability of the P. stutzeri pilA mutant (alongwith PO4 plating and twitching motility). It is concluded that the type IV pili of the soil bacterium P. stutzerifunction in DNA uptake for transformation and that their role in this process is not confined to the species-specific pilin.

The soil bacterium Pseudomonas stutzeri is capable of natu-ral genetic transformation (10). This phenomenon involves thebinding of extracellular DNA to the bacterial cell, the activeuptake of the bound DNA, and the heritable integration of itsgenetic information. Natural transformation has been ob-served in bacterial species from various taxonomic and trophicgroups, including Proteobacteria, cyanobacteria, and Archae-obacteria, and is considered a major mechanism of horizontalgene transfer encompassing chromosomal and plasmid DNA(25, 45, 46).

The physiological state in which cells are transformable istermed competence and is reached in the late log phase ofbroth-grown cultures of P. stutzeri (22). Competence is alsoachieved in media prepared from aqueous extracts of varioussoils (23, 24). During these studies, it was found that P. stutzeriresponds to limitations of single nutrients like C, N, or P by anup-to-290-fold stimulation of transformation (23, 24). Otherstudies showed that P. stutzeri cells can take up DNA ad-sorbed on the surface of sand grains (22). Further, P. stutzeriis naturally transformable by broad-host-range plasmids likeRSF1010 (3), even when these plasmids do not contain insertsof chromosomal P. stutzeri DNA (9). More recently, the trans-

formation of P. stutzeri in nonsterile soil by added DNA or byDNA released from bacteria in the soil was demonstrated (42).Initial observations suggested that P. stutzeri preferentiallytakes up DNA of its own species (10, 22), but recent studiesshow that DNA from other prokaryotic or eukaryotic sourcesis taken up with efficiency similar to that with which P. stutzeriDNA is taken up (N. Weger, R. Hashemi, and W. Wackerna-gel, unpublished data).

In an attempt to identify the genetic determinants for com-petence and transformability and to provide the basis for stud-ies on the regulation of their expression, we have isolatedtransformation-deficient mutants of P. stutzeri after transposonand insertion mutagenesis. Here, we report on mutants whichdemonstrate that P. stutzeri has genes for the formation of typeIV pili (50) and that these are essential for genetic transfor-mation of P. stutzeri. In particular, we show that insertionalinactivation of the newly identified gene for the structuralprotein component of pili, pilA, and another new gene neces-sary for pilus formation, pilC, abolished transformation bychromosomal and plasmid DNA through the prevention ofcompetence-specific DNA binding.

MATERIALS AND METHODS

Bacterial strains and culture conditions. The bacterial strains and plasmidsused are listed in Table 1. P. stutzeri and Escherichia coli were grown on Luria-Bertani (LB) agar plates or in LB liquid medium (37). Incubations were at 37°C.If necessary, LB medium was supplemented with ampicillin (1 g liter21 for P.stutzeri; 100 mg liter21 for E. coli), gentamicin (10 mg liter21), kanamycin (60 mgliter21), streptomycin (1 g liter21 for P. stutzeri; 100 mg liter21 for E. coli),

* Corresponding author. Mailing address: AG Genetik, FachbereichBiologie, Universitat Oldenburg, Postfach 2503, D-26111 Oldenburg,Germany. Phone: 49-(0)441-7983298. Fax: 49-(0)441-7985606. E-mail:[email protected].

2184

on May 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

rifampin (20 mg liter21) or nalidixic acid (50 mg liter21). The minimal mediumfor P. stutzeri was minimal pyruvate (MP) agar medium (23).

DNA manipulations and plasmid and strain constructions. Plasmids andgenomic DNA were prepared by using Qiagen columns (Qiagen, Hilden, Ger-many) according to the instructions of the manufacturer. Electrocompetent cellsof P. stutzeri and E. coli were prepared according to the methods of Pembertonand Penfold (33) and Dower et al. (13), respectively. A gene bank of JM375 wasobtained by partial digestion of chromosomal DNA with PstI, ligation of frag-ments of about 6 to 12 kb to RSF1010d (Table 1), and transformation of P.stutzeri APS121 by electroporation (12.5 kV cm21, 25 mF, 200 V; Gene Pulser;Bio-Rad Laboratories, Richmond, Calif.). The subclone pCOM81a was con-structed by treatment of pCOM81 with EcoRI and NdeI and subsequent ligationresulting in a 7.7-kb deletion. The plasmid was electroporated into Tf81. PlasmidpST81 was obtained by partial restriction of chromosomal Tf81 DNA with SacI,ligation, and transformation of E. coli SF8recA. The pilA complementing plasmidpUCA1 was constructed by PCR amplification of the pilA gene from chromo-somal LO15 DNA using the primers PILAPRO4 (59CATGCCGGCATACTAGACAT39) and PILA4 (59TTAGGAGCACTTGCCTGGCTTGTAC 39), ligationto SmaI-treated pUCP19, and transformation of E. coli XL10. For constructionof Tf300, pUCA1 was treated with BglII and ligated to a gentamicin resistancegene from pUCGm DNA (40). For mutant constructions, integration of insertionmutant alleles was by homologous recombination during plate transformation.

Transposon mutagenesis of P. stutzeri. Transposon mutagenesis of P. stutzeriwas performed essentially according to the method of Simon et al. (43) usingcells from the mobilizing E. coli strain S17-1 carrying pSUP102GmTn5B20 asdonor cells and from LO15 as recipient cells. After conjugation on a filter for16 h at 37°C, the cells were resuspended in 0.9% NaCl and plated on LB agarsupplemented with rifampin, nalidixic acid, and kanamycin.

DNA sequencing. DNA sequencing was performed by the dideoxynucleotidechain termination method (38) with a cycle sequencing kit (GATC, Constance,Germany) and thermosequenase (Amersham, Braunschweig, Germany). Thesequencing products were separated on a 1500 Long Run DNA Sequencer

(GATC) and directly blotted onto a positively charged nylon membrane accord-ing to the instructions of the manufacturer. For sequencing of the pilABCDregion, pCOM81a and pST81 were used.

Plate transformation of P. stutzeri. (i) Qualitative plate transformation. Themethod of Hahn et al. (18) was adapted to P. stutzeri. P. stutzeri colonies werereplica plated onto MP agar supplemented with kanamycin, rifampin, and nali-dixic acid. The plates contained a low concentration of histidine (0.5 mg liter21)sufficient for growth of about two generations (for integration and expression ofthe his1 allele) and were streaked with 2 mg of chromosomal DNA of JM375(his1). Clones which formed his1 colonies within 2 days were considered trans-formation proficient; nongrowing clones were suspected to be transformation-deficient.

(ii) Quantitative plate transformation. The quantitative plate transformationprocedure was performed according to the method of Lorenz and Wackernagel(23), except that 10 mg of JM375 DNA ml21 was used and incubation of the cellson a fresh LB agar plate with DNA was overnight at 37°C.

Transformation in liquid culture. Competent cells were prepared and storedat 280°C as described previously (22). The cells were thawed at room temper-ature and aerated at 37°C for 2 to 3 h. Culture samples of 0.25 ml were mixedwith 0.25 mg of transforming his1 DNA from a concentrated stock solution andincubated for 90 min at 37°C. Then DNase I was added (final concentration, 100mg ml21). After incubation for 15 min at 37°C the cells were plated on LB (viablecount) and MP (his1 transformants) agar. The frequency of transformation wasdefined as the number of his1 colonies per viable count.

Plating of PO4 and determination of twitching motility. Plaque formation ofPO4 on P. stutzeri was performed in a spot test as described by Bradley (8).Twitching motility was determined by inspecting single colonies of P. stutzeri forspreading zones on LB agar after incubation in a humid atmosphere at 37°C for10 days.

DNA binding and uptake of competent cells. Purified transforming DNAisolated from P. stutzeri JM375 (his1) was labeled with 3H-deoxythymidinetriphosphate (specific activity, 63 Ci/mmol) by nick translation using the kit of

TABLE 1. Bacterial strains and plasmids used in this study

Strain or plasmid Relevant genotype or characteristic(s) Source or reference

StrainsE. coli

S17-1 recA 44SF8recA recA56 17XL10 recA; Tcr Stratagene

P. stutzeriAPS121 recA::Tn5; Kmr 54JM375 Rif r Smr 10JM302 hisX 10, 43LO15 JM302, Rif r Nalr This study

LO15(pRSF1010d) This studyLO15(pUCP19) This study

Tf81 LO15pilC::pSUP102GmTn5B20 This studyTf81(pRSF1010d) This studyTf81(pCOM81) This studyTf81(pCOM81a) This study

Tf300 LO15pilA::Gmr This studyTf300(pUCP19) This studyTf300(pAW102-O) This studyTf300(pAW103-K) This studyTf300(pAW107-Dn) This studyTf300(pUCA1) This study

PlasmidspRSF1010 Smr Sur 3pRSF1010d pRSF1010 with an 800-bp PstI deletion inactivating the Sur gene This studypCOM81 pRSF1010d carrying 10.8 kb of chromosomal JM375 DNA This studypCOM81a pCOM81 subclone carrying 3.1 kb of chromosomal JM375 DNA This studypSUP102GmTn5B20 Kmr Gmr 44pSI1 his1 Smr 43pST81 About 40 kb of religated chromosomal DNA of Tf81 including insertion

of pSUP102GmTn5B20This study

pUCP19, pUCP18 oricolE1 oripRO1600 Apr 40pAW102-O pUCP19 carrying pilA1 of P. aeruginosa PAO 53pAW103-K pUCP19 carrying pilA1 of P. aeruginosa PAK 53pAW107-Dn pUCP18 carrying pilA1 of D. nodosus 53pUCA1 pUCP19 carrying pilA1 of LO15 This studypUCA1Gm pUCA1 with a Gmr insertion in pilA1 This studypUCGm Apr Gmr 41

VOL. 182, 2000 TYPE IV PILI AND TRANSFORMATION OF P. STUTZERI 2185

on May 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

Promega (Madison, Wis.). The DNA was purified by filtration on Microcon-100(Amicon, Witten, Germany). The specific radioactivity of the DNA was 7 3 106

cpm/mg. The DNA fragments had a mean size of about 20 kb, as determined bygel electrophoresis. A competent cell suspension stored at 280°C was thawed atroom temperature and aerated for 2 to 3 h at 37°C. To 0.5 ml of cell suspension,0.5 mg of 3H-DNA (in a 1-ml volume) was added and aeration was continued for90 min. The cells of 0.5-ml samples either treated with DNase I (100 mg/ml for15 min at 37°C) or not treated were sedimented through 1 ml of 10% glycerol for15 min at 15,000 3 g. The cell pellet was resuspended in 0.4 ml of wash buffer(0.5% NaCl, 10 mM Tris HCl [pH 7.5]) and again sedimented through 10%glycerol. This was done a third time. The cells were then resuspended in 1 ml ofwash buffer, and the radioactivity associated with the cells was determined in aliquid scintillation counter. The cell number was determined in a 5-ml sample ina counting chamber under the light microscope to relate radioactivity to thenumber of recovered cells.

Electron microscopy. Sample grids with Formvar film were touched to micro-colonies grown after 12 to 15 h at 37°C on LB agar plates. The grids were floatedfor 10 min on a drop of 1% uranyl acetate for staining. After air drying for 15min, transmission electron microscopy was performed with a Zeiss JM109Aelectron microscope.

Nucleotide sequence accession number. The nucleotide sequence of the pil-ABCD region has been deposited in the EMBL database under accession no.AJ132364.

RESULTS

Isolation of transformation-deficient mutants. After trans-poson mutagenesis about 3.3 3 104 Kmr mutants of LO15(hisX) were screened for transformation deficiency by a qual-itative replica plate transformation assay. The putative trans-formation-deficient clones were examined for their UV sensi-tivity to discriminate possible recombination-deficient mutantswhich were assumed to be detected by their repair deficiency.Additionally, the clones were subjected to a screening for ex-tracellular DNase activity according to the method of Basse etal. (4) to exclude the possibility that the transformation defi-ciency resulted from increased DNase production. Finally, themutants were electroporated with pSI1 (42) carrying the hisXgene. Those mutants which then did not grow on histidine-freeminimal medium were assumed to have a transposon insertionin another his gene. Such mutants were found, suggesting thatthe genes for histidine biosynthesis are not clustered on the P.stutzeri genome. With the 39 mutants remaining after thesetests a quantitative plate transformation test was performed.Compared to that of the LO15 cells, the transformation fre-quencies of the various mutants ranged from 0.1 to less than0.00003.

Identification of a pilC insertion mutant. One mutant (Tf81)was not transformable with chromosomal DNA (Table 2) orwith plasmid DNA (Weger et al., unpublished data). StrainTf81 was used in complementation studies with 6- to 12-kbJM375 chromosomal DNA fragments present in plasmids of aP. stutzeri gene bank. Clones of Tf81 obtained by electropora-tion with gene bank plasmids were screened for the ability tobe naturally transformed by chromosomal his1 DNA. A genebank plasmid which restored transformability of Tf81(pCOM81) (Table 2) had an insert of about 10.8 kb. Subclon-ing of insert fragments revealed that a 3.1-kb fragment fullycomplemented Tf81. Sequencing of the insert showed that itcovered a complete open reading frame (ORF) of 405 tripletswhich was probably transcribed from the sulfonamide resis-tance gene promoter of the vector pRSF1010. The deducedamino acid sequence displayed two transmembrane helices andhad 75% amino acid identity to PilC of Pseudomonas aerugi-nosa, which is a highly hydrophobic accessory protein in typeIV pilus biogenesis (29). Sequencing of genomic DNA of Tf81confirmed that in this strain pilC was inactivated by transposoninsertion (see below). This suggested that P. stutzeri has typeIV pili and that they might be necessary for genetic transfor-mation. The formation of type IV pili by P. stutzeri LO15 and

Tf81 was tested with the pilus-dependent phage PO4 (8). Asshown in Table 2, the phage plated on LO15 cells, indicatingthat these had intact pili, and did not plate on strain Tf81.Complementation of Tf81 with pCOM81 or pCOM81a re-stored plating of PO4 (Table 2).

Electron microscopic examination of LO15 revealed thepresence of pili which were about 6 nm thick and 1 to 2 mmlong (Fig. 1) resembling the type IV pili of P. aeruginosa. Piliwere mainly found at the cell poles. The pili were absent fromcells of the Tf81 mutant (Fig. 1), indicating that pilC is requiredfor pilus biogenesis. The PO4 plating test was applied to theother transformation-deficient mutants. Of these mutants, 32were resistant to PO4 and 6 were not.

Twitching motility. We noticed that extended incubation ofP. stutzeri LO15 colonies at 37°C in a humid atmosphere pro-duced a thin growth halo around the colonies (Fig. 2). Thisresembled the phenomenon of twitching motility seen beforewith strains of P. stutzeri (19) and other type IV pilus-produc-ing strains (19, 50, 54). The growth halo was absent in culturesof strain Tf81, the pilC mutant (Fig. 2). In cultures of Tf81 withpCOM81 or pCOM81a, twitching motility was fully restored(Table 2).

Characterization of pilB, pilD, and orfX. The nucleotide se-quences of the insert in pCOM81a upstream and downstreamof pilC showed incomplete ORFs with deduced amino acidsequences similar to PilB and PilD of P. aeruginosa. Since thegene bank plasmid contained no further chromosomal DNAbeyond the partial pilB and pilD genes, we used a new strategyto obtain the missing DNA. Previously, we had noticed thatTf81 was not only kanamycin resistant, as expected from theTn5B20 insertion, but also gentamicin resistant. This could beexplained if not only the transposon but also its vectorpSUP102Gm, containing a gentamicin resistance gene (43),had been inserted into the chromosome. Such events occurwhen a Tn5-containing plasmid dimerizes and then cointe-grates by transposase action. This leads to various types oftransposition cointegrates in the host chromosome (6). PCRanalyses indicated that in the P. stutzeri mutant Tf81, transpo-sition from the presumably dimeric plasmid was mediated bytwo IS50R elements, resulting in a chromosomal insertion ofthe vector with two IS50R elements at the borders and one

TABLE 2. Transformation frequencies, PO4 sensitivities,and twitching motilities of P. stutzeri

Straina

Relevant pil allele Transfor-mation

frequencyb

PO4plating

behaviorc

TwitchingmotilitydChromo-

some Plasmid

LO15 pil1 1 1 1Tf81 pilC #0.00003 2 2Tf81(pCOM81) pilC pilC1 1.1 1 1Tf81(pCOM81a) pilC pilC1 1.1 1 1Tf300 pilA #0.00019 2 2Tf300(pUCA1) pilA pilA1 0.9 (1) 1

a As controls, the vectors corresponding to the plasmids with the pilC1 orpilA1 gene were introduced into LO15, Tf81, or Tf300, generatingLO15(pRSF1010d), LO15(pUCP19), Tf81(pRSF1010d), and Tf300(pUCP19).These strains exhibited transformation frequencies, PO4 plating behaviors, andtwitching motilities similar to those exhibited by the corresponding strains lack-ing vector plasmids.

b Transformation frequencies obtained by plate transformation are given rel-ative to that obtained with LO15 (2 3 1025).

c Phage titer was 108 phages ml21, and 0.02-ml volumes were spotted. 1,confluent lysis of cells; (1), single plaques, 2, no visible plaques.

d 1, twitching motility was observed; 2, twitching motility was not observedafter 10 days of incubation on LB agar plates.

2186 GRAUPNER ET AL. J. BACTERIOL.

on May 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

internal IS50L element. By partial restriction of chromosomalTf81 DNA with SacI (which cleaves only once inpSUP102GmTn5B20), ligation, and transformation of E. coli,plasmids mediating resistance to kanamycin and gentamicinwere obtained. One plasmid, named pST81, with a size ofabout 40 kb was used for the sequencing of regions adjacent topilC. Before that, the transposon insertion site was identified tobe about in the middle of pilC (nucleotide [nt] position 2528),verifying the complementation of Tf81 by pCOM81a. Then,the remaining parts of pilB and pilD were sequenced. Thededuced PilB and PilD protein sequences had 79.5% and79.0% amino acid identity to PilB and PilD of P. aeruginosa,which are accessory proteins in type IV pilus biogenesis (29).The probably cytoplasmically located PilB protein of P. stutzericontains a conserved ATP or GTP binding site at nt positions5438 to 5461. The PilD protein is probably integrated in theinner membrane by six membrane-spanning sequences. Down-stream of pilD a gene named orfX was sequenced which codesfor a conserved hypothetical protein with unknown functionfound in many other species. Mutants of Neisseria gonorrhoeaecontaining an insertion in orfX exhibited a severely restrictedgrowth phenotype but expressed pili and were naturally trans-formable (14).

Identification of pilA. The sequence upstream of pilB con-tained an ORF of 420 nt oriented opposite to pilB. The derivedprotein had 50.3% amino acid identity to fimA of Xanthomo-

nas campestris, which is a type IV pilin (31). The sequence alsohad high similarity to pilin genes of other species that all sharea short hydrophilic leader peptide and the characteristic hy-drophobic N-terminal region starting with a phenylalanine inthe mature protein (2). The PilA protein of P. stutzeri containsa putative ATP or GTP binding site motif at nt positions 5438to 6461, unusual for pilin proteins. It is not clear whether thissite is functional in ATP or GTP hydrolysis or in which pro-cesses this would be involved.

A defective pilA allele was constructed by insertion of agentamicin resistance gene into the BglII site of pUCA1 toyield pUCA1Gm (Table 1). The mutant allele was naturallytransformed into the chromosome of an LO15 cell to yield thepilA::Gmr strain Tf300. The strain was PO4 resistant, did notshow twitching motility (Table 2), and had no pili visible in theelectron microscope (Fig. 1). Strain Tf300 was deficient fortransformation with chromosomal DNA (Table 2) and plasmidDNA (Weger et al., unpublished data). All defects of Tf300were complemented by plasmid pUCA1 (Table 2), althoughthe PO4 plating efficiency was lower than that observed forLO15. Overexpression of pilA in P. aeruginosa was previouslyobserved to reduce PO4 plating (54). These findings would beconsistent with pilA providing the structural protein for type IVpilus biogenesis.

The pilA gene of P. aeruginosa is under the control of a s54

promoter (32). A putative s54 promoter consensus sequence ispresent in the P. stutzeri sequence at nt positions 5065 to 5081.Upstream, a putative NifA-like recognition sequence (nt posi-tions 5007 to 5023) is present that might be a transcriptionalactivator binding site characteristic for s54 promoters (20). ThepilA gene of P. stutzeri presumably starts at nt position 5126,preceded by a typical ribosome binding site, and ends at ntposition 5546, followed by a perfect inverted repeat sequenceof 13 nucleotides (DG, 228.7 kcal mol21) that could functionas a rho-independent transcription terminator.

DNA binding and uptake. In transformation-deficient mu-tants of Acinetobacter sp. strain BD4 with defects in genescoding for pilin-like and accessory proteins for pilus biogene-sis, the binding of DNA was abolished (21, 36). We measuredthe interaction of 3H-labeled chromosomal P. stutzeri DNAwith LO15 cells. In previous experiments we had shown thatthe kinetics of DNA binding, uptake (measured as the fractionof DNase I-resistant DNA associated with the cells), and trans-formant formation were parallel and reached a plateau afterabout 90 min of incubation of competent cells with DNA(Weger et al., unpublished data). When the cells were taken

FIG. 1. Transmission electron microscopic visualization of type IV pili. From left to right, the three images show strain LO15 (pil1), the pilC mutant Tf81, and thepilA mutant Tf300. Magnification, 338,000. On each of the three cells, the polar flagellum is also visible.

FIG. 2. Twitching motility of P. stutzeri on agar plates. Cells were streaked onLB agar and incubated for 10 days in a humid atmosphere at 37°C. On the leftside is LO15 (pil1) and on the right side is the pilC mutant Tf81.

VOL. 182, 2000 TYPE IV PILI AND TRANSFORMATION OF P. STUTZERI 2187

on May 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

from the competence peak (reached at a culture density ofabout 0.5 3 109 to 1 3 109 cells/ml), DNA binding of about 150pg/5 3 108 cells was found (Table 3) and about one-third of theDNA associated with the cells was taken up into a DNaseI-resistant state within 90 min. The DNA concentration of 1mg/ml in these experiments was below saturation and corre-sponded to the concentration used in normal transformationexperiments. DNA binding, DNA uptake, and transformationwere drastically reduced when cells were allowed to grow fur-ther or to stationary phase (Table 3). These findings suggestedcompetence-specific binding and uptake of DNA by LO15cells. In contrast, cells of pilA and pilC mutants, grown to thephase in which maximum competence of LO15 was observed,bound roughly eight- and sixfold less DNA, respectively, anduptake was reduced about fourfold (Table 3). Even with sta-tionary-phase cells of the pilA and pilC mutants, some DNAbinding and uptake were seen as with LO15. Apparently, cellsof the parental strain and the pil mutants bind low amounts ofDNA irrespective of competence and a part of this DNA is notdegradable by DNase I. The data in Table 3 indicate thatmature pilin or type IV pilus formation is necessary for thetransformation-related binding and uptake of DNA by P.stutzeri.

Complementation of pilA by heterologous genes coding forpilin. Watson et al. showed that twitching motility and PO4plating can be partially restored in P. aeruginosa by heterolo-gous pilA (54). To investigate whether a pilA defect of P.stutzeri can be complemented by foreign structural genes for

type IV pili, Tf300 was transformed with plasmids carrying thepilin genes of P. aeruginosa PAK, P. aeruginosa PAO, or Di-chelobacter nodosus (54). The foreign pilin genes supportedtwitching motility and partially restored PO4 plating (Table 4).

Additionally, pili were seen in the electron microscope(Weger et al., unpublished data). This supported the sugges-tion made above that PilA of P. stutzeri is the structural proteinof the pilus and that in P. stutzeri the processes of twitchingmotility and PO4 plating are not dependent on the species-specific pilin.

Even more interesting is the finding that the transformationdeficiency of Tf300 was effectively complemented by the threeheterologous genes (Table 4). This is the first time that genesfrom nontransformable species were shown to function in re-placing a protein essential for DNA uptake of a naturallytransformable species.

DISCUSSION

The characterization of the first transformation-deficientmutant isolated from P. stutzeri following transposon mutagen-esis revealed that a gene essential for type IV pilus biogenesiswas inactivated. This gene was termed pilC. The deduced pro-tein was highly similar to PilC of P. aeruginosa and that of thecorresponding proteins involved in pilus biogenesis, proteinsecretion, and DNA uptake of other bacteria (2). The pilCmutant of P. stutzeri did not plate the type IV pilus-dependentphage PO4, was defective in the pilus-mediated phenomenon

TABLE 3. Binding and uptake of 3H-thymidine-labeled DNA by cells of LO15 and transformation-deficient mutants

Strain CultureaNo. of pg of DNA/5 3 108 cellsb

n Transformationfrequencyc

Bound Taken up

LO15 Competent 152.3 6 41.0 41.0 6 28.3 6 2 3 1024

Postcompetent 20.0 6 8.2 4.9 6 1.3 3 3 3 1027

Overnight 7.7 6 5.4 6.7 6 2.7 4 #5 3 1028

Tf300 (pilA) Competent 17.9 6 5.5 10.4 6 3.9 8 #2 3 1028

Overnight 13.3 6 8.1 5.2 6 2.6 2 ND

Tf81 (pilC) Competent 26.7 6 11.5 10.0 6 2.2 6 #2 3 1028

Overnight 6.4 6 1.4 4.8 6 0.7 2 ND

a Competent cultures were from the late logarithmic growth phase and had titers of about 5 3 108 cells/ml, postcompetent cell cultures had titers of about 3 3 109

cells/ml, and overnight cultures had titers of about 8 3 109 cells/ml; cell titers were adjusted with culture supernatant to concentrations of 5 3 108 to 8 3 108 cells/ml.b The data shown are averages 6 standard deviations (n 5 3 to 8) or deviations from the mean (n 5 2).c his1 transformants were obtained by liquid transformation (see Materials and Methods) at a concentration of 1 mg of chromosomal his1 DNA/ml of culture; ND,

not determined in these experiments because strains were transformation deficient.

TABLE 4. Transformation frequencies, PO4 sensitivities, and twitching motilities of Tf300 complemented withdifferent heterologous genes coding for pilin

StrainaRelevant genotype Transformation

frequencybPO4 platingbehavior c

Twitchingmotilityd

Chromosome Plasmide

LO15a pilA1 1 1 1Tf300a pilA #0.00019 2 2Tf300 pilA pAW102-O 1.4 (1) 1Tf300 pilA pAW103-K 0.3 (1) 1Tf300 pilA pAW107-Dn 0.8 (1) 1

a As controls, the vector corresponding to the plasmids with the heterologous pilA1 genes was introduced into LO15 and Tf300, generating LO15(pUCP19) andTf300(pUCP19). These strains exhibited transformation frequencies, PO4 plating behaviors, and twitching motilities similar to those exhibited by the correspondingstrains lacking vector plasmids.

b Transformation frequencies are given relative to that obtained with LO15 (2 3 1025).c Phage titer was 108 phages ml21, and 0.02-ml volumes were spotted. 1, confluent lysis of cells; (1), single plaques; 2, no visible plaques.d 1, twitching motility was observed; 2, twitching motility was not observed after 10 days of incubation on LB agar plates.e pAW102-O carried pilA1 of P. aeruginosa PAO, pAW103-K carried pilA1 of P. aeruginosa PAK, and pAW107-Dn carried fimA1 of D. nodosus.

2188 GRAUPNER ET AL. J. BACTERIOL.

on May 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

of twitching motility, and had no pili visible in the electronmicroscope. It was further found that pilC of P. stutzeri islocated in a cluster of pil genes including pilB and pilD and thata prepilin-coding gene, pilA, is located next to pilB and tran-scribed in the opposite direction. This arrangement of genes isidentical to that in P. aeruginosa (29). In this organism, pilB,pilC, and pilD code for accessory proteins for pilus genesis, ofwhich PilD is the prepilin peptidase necessary for processing ofprepilin to pilin and methylation of the N-terminal phenylala-nine (30, 49). Insertional inactivation of pilA in P. stutzeriabolished pilus formation, twitching motility, PO4 plating, andtransformability. These defects were reversed by providing thecloned pilA gene in trans, indicating the absence of a polareffect of the insertion (Table 4). From these observations andthe fact that heterologous genes for pilus structural proteinsrestored pilus formation (verified by electron microscopy) inthe pilA mutant, it is concluded that the soil bacterium P.stutzeri has type IV pili, with pilA coding for the structuralprotein.

So far, predominantly pathogenic bacteria including N. gon-orrhoeae, Neisseria meningitidis, P. aeruginosa, D. nodosus,Moraxella spp., and Legionella pneumophila were shown tohave type IV pili (48, 50), which are thought to mediate adhe-sion to epithelial cells, which is believed to be a key step in theinitiation of infections (5, 44). Recently, the bacterium Azoar-cus was shown to have type IV pili which are essential for theestablishment of bacteria on the root surface of rice seedlingsand for adhesion to the mycelium of an ascomycete (11). It isnot clear whether pili have a function in interactions of the soilbacterium P. stutzeri with host organisms.

Our studies with pilA and pilC mutants show that for naturaltransformation of P. stutzeri expression of pilA and pilC isrequired. The function of PilC may be limited to the export ofprocessed PilA, but it is conceivable that other proteins nec-essary for competence are also dependent on PilC for export.From our data we cannot distinguish whether only the exportof mature pilin or the formation of pili is required for compe-tence. This question also remains open when looking at othertransformable gram-negative bacteria which form type IV pili.On the one hand, nonpiliated mutants of N. gonorrhoeae (15,41), N. meningitidis (51), Moraxella liquefaciens (7), and Legion-ella pneumophila (47) have lost transformability or give 1,000-fold lower transformation frequencies. On the other hand,strains of an Acinetobacter sp. defective in genes coding fortype IV prepilin-like and accessory proteins were transforma-tion deficient but fully piliated (21, 35). Further, proteins hav-ing remarkable levels of amino acid sequence identity to thoseof pilin and accessory proteins PilB, PilC, and PilD are re-quired for competence of Haemophilus influenzae (12) and thegram-positive bacteria Bacillus subtilis (1, 28), S. pneumoniae(34) and S. gordonii (26). However, the proteins do not pro-mote pilus formation in these bacteria.

The role of pili or pilin in DNA uptake is not yet clear. Inextension of the phage PO4 infection theory of Bradley (8), ithas been hypothesized that in Neisseria pilus retraction wouldtranslocate DNA into the periplasmic space (16). In Acineto-bacter, the pilin-like and accessory proteins are necessary forbinding of DNA by competent cells (21, 35). Our studies withradiolabeled DNA suggest that also in P. stutzeri PilA proteinor pili are required for competence-specific binding of DNAand are probably also involved in its transport into a DNase-resistant state. That the mere formation of pili from pilin is notsufficient for successful DNA uptake is concluded from thetransformation deficiency of a pilT mutant which is hyperpili-ated (Weger et al., unpublished data). The mutant cells aredefective in twitching motility and PO4 infection, suggesting

that retractable pili are necessary for these processes and DNAuptake. In Neisseria, the piliated pilT strains were also defectivein DNA uptake and twitching motility (55). The Neisseria pilido not bind DNA (27). Thus, our presently favored model ofDNA uptake by P. stutzeri (and perhaps other transformablegram-negative organisms) would include pilus-mediated bind-ing of DNA to a receptor protein not exposed to DNA in theabsence of pilus formation. Binding is followed by retraction ofthe pilus, with concomitant translocation of DNA (perhapstogether with the putative DNA binding protein) into a DNaseI-resistant state. This could be the periplasmic space. Recentstudies show that the pilin-like proteins of B. subtilis (encodedby comGC, comGD, comGE, and comGG) direct DNA to thecompetence-specific DNA binding protein ComEA (36). Fromthe periplasm, DNA is translocated through the cytoplasmicmembrane.

Substitution of the P. stutzeri pilA gene by the correspondinggenes from three nontransformable bacteria caused transfor-mation, pilus formation, twitching motility, and PO4 infection.This underlines the necessity of functional pili for DNA uptakeand, at the same time, indicates the absence of species speci-ficity of pilin for DNA internalization and other functions. Italso suggests that the presumptive ATP or GTP binding siteobserved in the amino acid sequence of the P. stutzeri PilAprotein is not involved in transformation, since the heterolo-gous proteins do not have such a site. The fact that several ofthe transformation-deficient mutants isolated from P. stutzeriare not defective for pilus biogenesis indicates that other genefunctions are additionally required for transformation. Whenthese genes are identified it will be interesting to see whethercomplements to them are lacking in P. aeruginosa and otherpseudomonads, which lack could explain why these organismsare not transformable.

ACKNOWLEDGMENTS

We thank Georg Basse, Marcus Wittstock, Uta Remmers, and RalfMarienfeld for help during experiments on the isolation and charac-terization of transposon mutants. We are grateful to David Dubnauand Tøne Tønjum, who provided valuable information, to J. Mattickfor strains and plasmids, to Stephen Lory for phage PO4, and to E.Ungewickel for help.

This work was supported by the Deutsche Forschungsgemeinschaftand the Fonds der Chemischen Industrie.

REFERENCES

1. Albano, M., R. Breitling, and D. Dubnau. 1989. Nucleotide sequence andgenetic organization of the Bacillus subtilis comG operon. J. Bacteriol. 171:5386–5404.

2. Alm, R. A., and J. S. Mattick. 1997. Genes involved in the biogenesis andfunction of type-4 fimbriae in Pseudomonas aeruginosa. Gene 192:89–98.

3. Bagdasarian, M., R. Lurz, B. Ruckert, F. C. H. Franklin, M. M. Bagdasar-ian, J. Frey, and K. N. Timmis. 1981. Specific-purpose cloning vectors. II.Broad host range, high copy number, RSF1010-derived vectors, and a host-vector system for gene cloning in Pseudomonas. Gene 16:237–247.

4. Basse, G., M. G. Lorenz, and W. Wackernagel. 1994. A biological assay forthe sensitive and quantifiable detection of extracellular microbial DNases. J.Microbiol. Methods 20:137–147.

5. Beachey, E. H. 1981. Bacterial adherence: adhesin-receptor interactions me-diating the attachment of bacteria to mucosal surfaces. J. Infect. Dis. 143:325–345.

6. Berg, D. E. 1989. Transposon Tn5, p. 185–210. In D. E. Berg and M. M.Howe (ed.), Mobile DNA. American Society for Microbiology, Washington,D.C.

7. Bøvre, K., and L. O. Frøholm. 1970. Correlation between the fimbriated stateand competence of genetic transformation in Moraxella nonliquefaciensstrains. Acta Pathol. Microbiol. Scand. Sect. B 78:526–528.

8. Bradley, D. E. 1973. A pilus-dependent Pseudomonas aeruginosa bacterio-phage with a long noncontractile tail. Virology 51:489–492.

9. Bruns, S., K. Reipschlager, M. G. Lorenz, and W. Wackernagel. 1992. Char-acterization of natural transformation of the soil bacteria Pseudomonasstutzeri and Acinetobacter calcoaceticus by chromosomal and plasmid DNA,

VOL. 182, 2000 TYPE IV PILI AND TRANSFORMATION OF P. STUTZERI 2189

on May 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from

p. 115–126. In M. J. Gauthier (ed.), Gene transfers and environment.Springer, New York, N.Y.

10. Carlson, C. A., L. S. Pierson, J. J. Rosen, and J. L. Ingraham. 1983. Pseudo-monas stutzeri and related species undergo natural transformation. J. Bac-teriol. 153:93–99.

11. Dorr, J., T. Hurek, and B. Reinhold-Hurek. 1998. Type IV pili are involvedin plant-microbe and fungus-microbe interactions. Mol. Microbiol. 30:7–17.

12. Dougherty, B. A., and H. O. Smith. 1999. Identification of Haemophilusinfluenzae Rd transformation genes using cassette mutagenesis. Microbiol-ogy 145:401–409.

13. Dower, W. J., J. F. Miller, and C. W. Ragsdale. 1988. High efficiency trans-formation of E. coli by high voltage electroporation. Nucleic Acids Res.16:6127–6145.

14. Freitag, N. E., H. S. Seifert, and M. Koomey. 1995. Characterization of thepilF-pilD pilus-assembly locus of Neisseria gonorrhoeae. Mol. Microbiol. 16:575–586.

15. Frøholm, L. O., K. Jyssum, and K. Bøvre. 1973. Electron microscopical andcultural features of Neisseria meningitidis competence variants. Acta Pathol.Microbiol. Immunol. Scand. Sect. B 81:525–537.

16. Fussenegger, M., T. Rudel, R. Barten, R. Ryll, and T. F. Meyer. 1997.Transformation competence and type IV pilus biogenesis in Neisseria gon-orrhoeae—a review. Gene 192:125–134.

17. Graupner, S., and W. Wackernagel. 1996. Identification of multiple plasmidsreleased from recombinant genomes of Hansenula polymorpha by transfor-mation of Escherichia coli. Appl. Environ. Microbiol. 62:1839–1841.

18. Hahn, J., M. Albano, and D. Dubnau. 1987. Isolation and characterization ofTn917lac-generated competence mutants of Bacillus subtilis. J. Bacteriol.169:3104–3109.

19. Henrichson, J. 1983. Twitching motility. Annu. Rev. Microbiol. 37:81–93.20. Kustu, S., E. Santero, J. Keener, D. Propham, and D. Weiss. 1989. Expres-

sion of s54 (ntrA)-dependent genes is probably united by a common mech-anism. Microbiol. Rev. 53:367–376.

21. Link, C., S. Eickernjager, D. Porstendorfer, and B. Averhoff. 1998. Identifi-cation of a novel gene, comC, required for DNA binding and uptake inAcinetobacter sp. strain BD413. J. Bacteriol. 180:1592–1595.

22. Lorenz, M. G., and W. Wackernagel. 1990. Natural genetic transformation ofPseudomonas stutzeri by sand-adsorbed DNA. Arch. Microbiol. 154:380–385.

23. Lorenz, M. G., and W. Wackernagel. 1991. High frequency of natural genetictransformation of Pseudomonas stutzeri in soil extract supplemented with acarbon/energy and phosphorus source. Appl. Environ. Microbiol. 57:1246–1251.

24. Lorenz, M. G., and W. Wackernagel. 1992. Stimulation of natural genetictransformation of Pseudomonas stutzeri in extracts of various soils by nitro-gen or phosphorus limitation and influence of temperature and pH. Microb.Releases 2:1–4.

25. Lorenz, M. G., and W. Wackernagel. 1994. Bacterial gene transfer by naturalgenetic transformation in the environment. Microbiol. Rev. 58:563–602.

26. Lunsford, R. D., and A. G. Roble. 1997. comYA, a gene similar to comGA ofBacillus subtilis, is essential for competence-factor-dependent DNA trans-formation in Streptococcus gordonii. J. Bacteriol. 179:3122–3126.

27. Mathis, L. S., and J. J. Scocca. 1984. On the role of pili in transformation ofNeisseria gonorrhoeae. J. Gen. Microbiol. 130:3165–3173.

28. Mohan, S., J. Aghion, N. Guillen, and D. Dubnau. 1989. Molecular cloningand characterization of comC, a late competence gene of Bacillus subtilis. J.Bacteriol. 171:6043–6051.

29. Nunn, D., S. Bergman, and S. Lory. 1990. Products of three accessory genes,pilB, pilC, and pilD, are required for biogenesis of Pseudomonas aeruginosapili. J. Bacteriol. 172:2911–2919.

30. Nunn, D. N., and S. Lory. 1991. Product of the Pseudomonas aeruginosa genepilD is a prepilin leader peptidase. Proc. Natl. Acad. Sci. USA 88:3281–3285.

31. Ojanen-Reuhs, T., N. Kalkkinen, B. Westerlund-Wikstrom, J. van Doorn, K.Haahtela, E. L. Nurmiaho-Lassila, K. Wengelnik, U. Bonas, and T. K.Korhonen. 1997. Characterization of the fimA gene encoding bundle-form-ing fimbriae of the plant pathogen Xanthomonas campestris pv. vesicatoria.J. Bacteriol. 179:1280–1290.

32. Pasloske, B. L., D. S. Drummond, L. S. Frost, and W. Paranchych. 1989. Theactivity of the Pseudomonas aeruginosa pilin promoter is enhanced by an

upstream regulatory site. Gene 81:25–34.33. Pemberton, J. M., and R. J. Penfold. 1992. High-frequency electroporation

and maintenance of pUC- and pBR-based cloning vectors in Pseudomonasstutzeri. Curr. Microbiol. 25:25–29.

34. Pestova, E. V., and D. A. Morrison. 1998. Isolation and characterization ofthree Streptococcus pneumoniae transformation-specific loci by use of a lacZreporter insertion vector. J. Bacteriol. 180:2701–2710.

35. Porstendorfer, D., U. Drotschmann, and B. Averhoff. 1997. A novel compe-tence gene, comP, is essential for natural transformation of Acinetobacter sp.strain BD413. Appl. Environ. Microbiol. 63:4150–4157.

36. Provvedi, R., and D. Dubnau. 1999. ComEA is a DNA receptor for trans-formation of competent Bacillus subtilis. Mol. Microbiol. 31:271–280.

37. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: alaboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, ColdSpring Harbor, N.Y.

38. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing withchain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463–5467.

39. Schweizer, H. P. 1991. Escherichia-Pseudomonas shuttle vectors derived frompUC18/19. Gene 97:109–112.

40. Schweizer, H. P. 1993. Small broad-host-range gentamicin resistance genecassettes for site-specific insertion and deletion mutagenesis. BioTechniques15:831–834.

41. Seifert, H. S., R. S. Ajioka, D. Paruchuri, F. Heffron, and M. So. 1990.Shuttle mutagenesis of Neisseria gonorrhoeae: pilin null mutations lowerDNA transformation competence. J. Bacteriol. 172:40–46.

42. Sikorski, J., S. Graupner, M. G. Lorenz, and W. Wackernagel. 1998. Naturaltransformation of Pseudomonas stutzeri in non-sterile soil. Microbiology 144:569–576.

43. Simon, R., J. Quandt, and W. Klipp. 1989. New derivatives of transposonTn5 suitable for mobilization of replicons, generation of operon fusions andinduction of genes in gram-negative bacteria. Gene 80:161–169.

44. Smith, H. 1984. The biochemical challenge of microbial pathogenicity.J. Appl. Bacteriol. 47:395–404.

45. Solomon, J. M., and A. D. Grossman. 1996. Who’s competent and when?Regulation of natural genetic competence in bacteria. Trends Genet. 12:150–155.

46. Steward, J. S., and C. A. Carlson. 1986. The biology of natural transforma-tion. Annu. Rev. Microbiol. 40:211–235.

47. Stone, B. J., and Y. A. Kwaik. 1999. Natural competence for DNA transfor-mation by Legionella pneumophila and its association with expression of typeIV pili. J. Bacteriol. 181:1395–1402.

48. Stone, B. J., and Y. A. A. Kwaik. 1998. Expression of multiple pili by Legion-ella pneumophila: identification and characterization of a type IV pilin geneand its role in adherence to mammalian and protozoan cells. Infect. Immun.66:1768–1775.

49. Strom, M. S., D. N. Nunn, and S. Lory. 1993. A single bifunctional enzyme,PilD, catalyzes cleavage and N-methylation of proteins belonging to the typeIV pilin family. Proc. Natl. Acad. Sci. USA 90:2404–2408.

50. Strom, M. S., and S. Lory. 1993. Structure-function and biogenesis of thetype IV pili. Annu. Rev. Microbiol. 47:565–596.

51. Tønjum, T., N. E. Freitag, E. Namork, and M. Koomey. 1995. Identificationand characterization of pilG, a highly conserved pilus-assembly gene inpathogenic Neisseria. Mol. Microbiol. 16:451–464.

52. Vosman, B., and K. J. Hellingwerf. 1991. Molecular cloning and functionalcharacterization of a recA analog from Pseudomonas stutzeri and construc-tion of a Pseudomonas stutzeri recA mutant. Antonie Leeuwenhoek 59:115–123.

53. Wall, D., and D. Kaiser. 1999. Type IV pili and cell motility. Mol. Microbiol.32:1–10.

54. Watson, A. A., J. S. Mattick, and R. A. Alm. 1996. Functional expression ofheterologous type IV fimbriae in Pseudomonas aeruginosa. Gene 175:143–150.

55. Wolfgang, M., P. Lauer, H. S. Park, L. Brossay, J. Hebert, and M. Koomey.1998. PilT mutations lead to simultaneous defects in competence for naturaltransformation and twitching motility in piliated Neisseria gonorrhoeae. Mol.Microbiol. 29:321–330.

2190 GRAUPNER ET AL. J. BACTERIOL.

on May 30, 2018 by guest

http://jb.asm.org/

Dow

nloaded from