Transdifferentiation of bone marrow stromal cells into neuron-like cells

PLEASE SCROLL DOWN FOR ARTICLE

This article was downloaded by: [Canadian Research Knowledge Network]On: 20 May 2009Access details: Access Details: [subscription number 770885181]Publisher Informa HealthcareInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,37-41 Mortimer Street, London W1T 3JH, UK

CytotherapyPublication details, including instructions for authors and subscription information:http://www.informaworld.com/smpp/title~content=t713656803

Transdifferentiation of bone marrow stromal cells into cholinergic neuronalphenotype: a potential source for cell therapy in spinal cord injuryMajid Naghdi a; Taki Tiraihi a; Seyed Alireza Mesbah Namin b; Jalil Arabkheradmand c

a Department of Anatomical Sciences, b Department of Clinical Biochemistry, Tarbiat Modares University,Tehran, Iran c Neuroscience Center, Khatam Al- Anbia hospital, Tehran, Iran

First Published:April2009

To cite this Article Naghdi, Majid, Tiraihi, Taki, Namin, Seyed Alireza Mesbah and Arabkheradmand, Jalil(2009)'Transdifferentiation ofbone marrow stromal cells into cholinergic neuronal phenotype: a potential source for cell therapy in spinal cordinjury',Cytotherapy,11:2,137 — 152

To link to this Article: DOI: 10.1080/14653240802716582

URL: http://dx.doi.org/10.1080/14653240802716582

Full terms and conditions of use: http://www.informaworld.com/terms-and-conditions-of-access.pdf

This article may be used for research, teaching and private study purposes. Any substantial orsystematic reproduction, re-distribution, re-selling, loan or sub-licensing, systematic supply ordistribution in any form to anyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representation that the contentswill be complete or accurate or up to date. The accuracy of any instructions, formulae and drug dosesshould be independently verified with primary sources. The publisher shall not be liable for any loss,actions, claims, proceedings, demand or costs or damages whatsoever or howsoever caused arising directlyor indirectly in connection with or arising out of the use of this material.

http://www.informaworld.com/smpp/title~content=t713656803

http://dx.doi.org/10.1080/14653240802716582

http://www.informaworld.com/terms-and-conditions-of-access.pdf

Transdifferentiation of bone marrow stromal cellsinto cholinergic neuronal phenotype: a potential

source for cell therapy in spinal cord injury

Majid Naghdi1*, Taki Tiraihi1, Seyed Alireza Mesbah Namin2

and Jalil Arabkheradmand3

1Department of Anatomical Sciences, 2Department of Clinical Biochemistry, Tarbiat Modares University, Tehran, Iran,

and 3Neuroscience Center, Khatam Al- Anbia hospital, Tehran, Iran

Background aims

Cholinergic neurons are very important cells in spinal cord injuries

because of the deficits in motor, autonomic and sensory neurons. In this

study, bone marrow stromal cells (BMSC) were evaluated as a source

of cholinergic neurons in a rat model of contusive spinal cord injury.

Methods

BMSC were isolated from adult rats and transdifferentiated into

cholinergic neuronal cells. The BMSC were pre-induced with

b-mercaptoethanol (BME), while the induction was done with nerve

growth factor (NGF). Neurofilament (NF)-68, -160 and -200

immunostaining was used for evaluating the transdifferentiation of

BMSC into a neuronal phenotype. NeuroD expression, a marker for

neuroblast differentiation, and Oct-4 expression, a marker for stemness,

were evaluated by reverse transcriptase (RT)-polymerase chain

reaction (PCR). Choline acetyl transferase (ChAT) immunoreactivity

was used for assessing the cholinergic neuronal phenotype. Anti-

microtubule-associated protein-2 (MAP-2) and anti-synapsin

I antibodies were used as markers for the tendency for synptogenesis.

Finally, the induced cells were transplanted into the contused spinal

cord and locomotion was evaluated with the Basso-Beattie-Bresnahan

(BBB) test.

Results

At the induction stage, there was a decline in the expression of NF-68

associated with a sustained increase in the expression of NF-200,

NF-160, ChAT and synapsin I, whereas MAP-2 expression was

variable. Transplanted cells were detected 6 weeks after their injection

intraspinally and were associated with functional recovery.

Conclusions

The transdifferentiation of BMSC into a cholinergic phenotype is

feasible for replacement therapy in spinal cord injury.

Keywords

Bone marrow stromal cells, cholinergic neurons, regeneration, spinal

cord injury, transplantation.

IntroductionCholine acetyltransferase (ChAT) immunoreactive neu-

rons have been evaluated in the postnatal life of rats,

where ChAT-immunoreactive neurons were subdivided

into two main types: somatic motoneurons and sympa-

thetic pre-ganglionic cells. Small ChAT-immunoreactive

neurons were also noticed around the central canal,

while immunoreactive neurons were detected at birth in

the laminae of the dorsal horn. Each type of ChAT-

immunoreactive neurons was reported to achieve adult

levels of staining intensity at different times during

development [1]. In adult rats, ChAT-immunoreactive

motoneurons are located in the medial, central and

lateral motor columns of the ventral horn; small ChAT-

immunoreactive neurons are clustered around the central

canal at the central gray matter, whereas intermediate

Correspondence to: Taki Tiraihi, Department of Anatomical Sciences, School of Medical Sciences, Tarbiat Modares University, PO Box 14155-

4838, Tehran, Iran. E-mail: [email protected], [email protected]

*Present address: Shiraz University of Medical Sciences (SUMS), Namazi Hospital.

Cytotherapy (2009) Vol. 11, No. 2, 137�152

– 2009 ISCT DOI: 10.1080/14653240802716582

Downloaded By: [Canadian Research Knowledge Network] At: 15:26 20 May 2009

gray matter consists of partition neurons, which are

medium to large ChAT-immunoreactive multipolar cells.

At autonomic spinal levels, ChAT-immunoreactive pre-

ganglionic sympathetic or parasympathetic neurons are

intermingled with extensions of the partition neurons.

Moreover, ChAT-immunoreactive neurons have been

noticed in the dorsal horn [2].

The spinal cord contusion model in rats has been

documented as a useful model for human spinal cord

injury, from functional, electrophysiologic and high-

resolution magnetic resonance imaging aspects [3], as

well as histology [4,5]. While cell death has been

reported in spinal motoneurons following the spinal

cord contusion model in rats, dysfunction of the choli-

nergic neurons of the autonomic nervous system with

blood pressure dysregulation, disorders in voiding, defe-

cation and reproduction have also been documented

[6,7]. These problems are caused by the destruction of

brain pathways that control spinal autonomic neurons

lying caudal to the lesion [8], resulting in loss of pre-

ganglionic neurons [9] with progressive retrograde death

[10].

Cell-based therapy for neurologic diseases with neu-

ronal loss has been carried out in different animal models

[11]. Several sources of cells have been suggested for this

modality of treatment, including embryonic stem cells

and adult stem cells, which hold tremendous promise for

replacement therapy for a variety of neurodegenerative

diseases [12]. Webber & Minger [13] revealed the possible

differentiation of stem cells into a wide range of cell

types, making stem cells a valuable source for cell-based

replacement therapy. For example, regarding Parkinson’s

disease, dopaminergic neurons derived from stem cells

resulted in improvement in diseased animals [14]. The

differentiation of spinal neural progenitors into a choli-

nergic phenotype has been documented, and the survival

of transplanted progenitor cells in the host tissue reported

[15]. Human fetal neural stem cells have also improved

behavioral test in rats with spinal cord injury [16];

moreover, cholinergic neurons derived from human

neural stem cells innervated the muscle of motoneuron-

deficient rats [17]. However, we have found no report

regarding transdifferentiation of bone marrow stromal

cells (BMSC) into a cholinergic phenotype.

The purpose of this study was to develop a protocol for

transdifferentiating BMSC into cholinergic neurons and

evaluate the functional recovery of animals treated with

the transdifferentiated cells.

MethodsCell preparation and cell characterization

The femurs and tibias from 6�8-week-old Sprague�Dawley

rats were removed and dissected. The proximal and distal

ends were cut, and the bone marrow (BM) flushed out with

5 mL alpha-modified Eagle medium (aMEM; Gibco,

Paisley, UK) supplemented with 10% fetal bovine serum

(FBS; Gibco). The whole marrow cells were cultured for 24

h in aMEM medium supplemented with 10% FBS as well

as penicillin and streptomycin (Gibco), then the non-

adherent cells were removed and washed with phosphate-

buffered saline (PBS). As confluency of the cells reached

about 80%, the cells were detached with a 0.25% trypsin,

0.04% EDTA solution and reseeded (at a density of 8000

cells/cm2) in plastic flasks. Anti-fibronectin antibody (Ab)

was used for characterizing the BMSC [18]. The cells were

split 1:3 and passaged up to five times for subsequent

experiments, and the culture medium was changed every

other day until the cells became confluent. The viability of

the cultured cells, which was about 95%, was assessed

before seeding.

Cell transdifferentiation

A two-stage induction protocol (1/6), where the initial

stage (pre-induction, 1 day) proceeded to the next stage

(induction, 6 days), was used. In order to select an optimal

pre-induction method, two pre-inducers were examined:

b-mercaptoethanol (BME) and dimethyl sulfoxide

(DMSO). The selection of the pre-inducer was based on

the results of the expression of four sets of genes. The first set

was Oct-4 gene, a stemness marker, which was detected by

reverse transcriptase�polymerase chain reaction (RT-PCR).

The second set was the neuronal differentiation genes,

including neurofilament (NF)-68, NF-160 and NF-200,

which were detected by immunocytochemistry. NeuroD

gene was evaluated by RT-PCR. The third set was synap-

togenesis genes, including microtubule-associated protein-2

(MAP-2) and synapsin I, which were detected by immuno-

cytochemistry. The fourth set was the cholinergic neuron

marker (ChAT), which was detected by immunocytochem-

istry as well. The culturing medium was changed with

serum-free media containing either 1 mM BME or 2%

DMSO, which were incubated for 24 h. Based on the findings

138 M. Naghdi et al.


of the markers, BME was selected as an optimal pre-inducer.

For the pre-induction stage, the cells were treated with

aMEM medium containing 1 mM BME (Sigma, St Louis,

MO, USA) for 24 h. For the induction stage, nerve growth

factor (NGF) (100 ng/mL) was used as cholinergic neuron

inducer, and the cells were incubated for 6 days.

Two negative controls were included in the study. The

first control was uninduced BMSC, which were used

without pre-induction and induction. The second control

consisted of BMSC treated with BME for 7 days. All the

proneural, neural, synaptic and cholinergic markers were

checked in this group at days 1 and 7.

Immunocytochemistry

For all immunocytochemical staining, a negative control

was used by staining with secondary Ab only. The

immunocytochemical evaluation was done at the following

time-points: before pre-induction, pre-induction (day 1)

Figure 1. A phase-contrast photomicrograph of culture BMSC. (A) Primary culture of BMSC (scale bar 100 mM); (B) cultured BMSC after 5

passages (scale bar 50 mM); (C) pre-induced BMSC with BME (scale bar 30 mM); (D) pre-induced BMSC with DMSO (scale bar 30 mM).

Table I. The means and SEM of the percentages of immunoreactive cells stained with different markers, showing the

following time-points: after pre-induction with BME (day 1) and induction with NGF (days 3, 5 and 7)

Marker Day 1 Day 3 Day 5 Day 7

NF-68 81.9891.63 58.7291.48 34.0292.1 11.0299.69

NF-160 58.8091.77 73.3891.57 81.4691.81 85.7492.09

NF-200 15.7291.01 22.4691.2 46.8491.24 55.4090.52

MAP-2 70.6095.56 65.4893.01 8.6890.80 84.1092.55

Synapsin I 21.6292.29 26.3891.82 49.2892.61 79.8494.60

ChAT 4.6690.7827 41.6490.12 75.1891.28 81.7491.52

There were statistically significant differences between the means of the percentages of immunoreactive cells except in the following comparisons: at day 1, when

ChAT was compared with NF-200 and MAP-2 compared with NF-68; at day 3, synapsin with NF-200; at day 5, ChAT with MAP-2 and NF-160, MAP-2

with NF-160, and synapsin with NF-200; and at day 7, ChAT with MAP-2, synapsin and NF-160, MAP-2 with synapsin, and NF-160, NF-68 and

synapsin with NF-160. Also in the following comparisons: when ChAT at day 5 was compared with ChAT of day 7; MAP-2 at day 1 with MAP-2 at days 3

and 5; MAP-2 at day 5 with MAP-2 at day 7; NF-200 at day 1 with NF-200 at days 3 and 7; NF-160 at day 3 with NF-160 at days 5 and 7; and synapsin

at day 3 with synapsin at day 1.

Differentiation of marrow stromal cells into cholinergic neurons 139


and induction (days 3, 5 and 7 of the experiment). The

counting was done at 200�magnification by using a

random table for selecting the fields; a total of 200 cells

was counted and the percentage of immunoreactive cells

estimated. A Zeiss Axiophot (Oberkochen, Germany) with

Intervideo WinDVR3 software was used. Cells located at

the upper and left sides of the selected fields were

excluded from the counting.

Characterization of BMSC

The cells were washed with PBS three times, fixed with

acetone for 15 min and washed with PBS again. The cells

Figure 3. A photomicrograph of immunocytochemistry for the negative control stained with rabbit anti-mouse secondary Ab conjugated with FITC

and counterstained with ethidium bromide (left panel); the right represents the phase contrast (scale bar 20 mM).

Figure 2. (A) A photomicrograph of immunohistochemistry for fibronectin used for characterizing the BMSC before pre-induction at the fifth

passage, immunostained with anti-fibronectin Ab (primary Ab) followed by incubation with FITC-conjugated secondary Ab and counterstained with

ethidium bromide. (B) A phase-contrast of the same image (scale bar 20 mM). (C) After 7 days pre-induction (1 day) and induction (6 days), the

cells showed negative immunoreactivity to anti-fibronectin Ab; (D) phase-contrast of the same image (scale bar 20 mM).



were treated with 0.3% Triton X-100 for 1 h, and the non-

specific Ab reaction was blocked with 10% normal goat

serum for 30 min at room temperature (RT). This was

followed by incubation with monoclonal mouse anti-

fibronectin Ab (Chemicon, International, Temecula, CA,

USA) for 2 h (1:300 dilution) and anti-mouse fluorescein

isothiocyanate (FITC)-conjugated Ab (Chemicon) for 1 h

(1:100 dilution) at RT. The labeled cells were visualized

using a fluorescence microscope and photographed digi-

tally (Zeiss Axiophot).

Neuronal differentiation marker

In order to evaluate neurofilament immunoreactivity, pre-

induced cells were fixed with 4% paraformaldehyde

(Merck, Damstadt, Germany) and immunocytochemistry

carried out according to the above-mentioned method,

with a monoclonal mouse anti-NF-200 Ab (1:400 dilution;

Chemicon), a monoclonal mouse anti-NF-160 Ab (dilu-

tion 1:300; Chemicon) and a monoclonal mouse anti-NF-

68 Ab (dilution 1:300; Chemicon). This was followed by

incubation with a secondary Ab, anti-mouse FITC-con-

jugated Ab (dilution 1:100; Chemicon) for 1 h at RT.

Synaptogenesis gene expression

Synaptogenesis gene expression included MAP-2 and

synapsin I, which were evaluated using polyclonal rabbit

anti-MAP-2 (dilution 1:500; Chemicon) and polyclonal

rabbit anti-synapsin I (dilution 1:400; Chemicon) as

primary Ab, followed by secondary anti-rabbit FITC-

conjugated Ab (dilution 1:100; Chemicon) for 1 h at RT.

Each experiment was replicated at least five times in order

to ensure reproducibility.

Neuronal type marker

The cholinergic neuron marker was ChAT. This was

evaluated using a monoclonal mouse anti-ChAT Ab

(dilution 1:300; Chemicon) and followed by incubation

with a secondary anti-mouse FITC conjugated Ab (dilu-

tion 1:100; Chemicon) for 1 h at RT.

RT-PCR

Expression of the following genes was included in the

study: Oct-4 (accession number NM-001009178), a marker

for BMSC stemness, using AAGCTGCTGAAACAGAAG

AGG as a forward primer and ACACGGTTCTCAATGC

TAGTC as a reverse primer; NeuroD (accession number

XM-341822), a neuroblast marker, using AAGCACCAGA

TGGCACTGTC as a forward primer and CAGGACTT

GCATTCGATACAC as a reverse primer; and b2-micro-

globulin (accession number NM-012512), an internal

control, using CCGTGATCTTTCTGGTGCTT as a

forward primer and TTTTGGGCTCCTTCAGAGTG

as a reverse primer.

The total RNA was extracted using an RNX plusTM

kit according to the manufacturer’s recommendations

(Cinnagen, Tehran, Iran). Briefly, 1 mL RNX plus was

added to a tube containing 1�2 million homogenized

cells, and the mixture incubated at RT for 5 min.

Figure 4. A histogram showing the effect of the pre-inducers BME (white columns) and DMSO (black columns) on BMSC, with the percentages of

NF-68, NF-160, NF-200, ChAT, MAP-2 and synapsin I immunoreactive cells. The results show no statistical differences in the mean percentages

of NF-160 and NF-200 immunoreactive cells, while the percentage of NF-68 immunoreactive cells pre-induced with BME was significantly higher

than that of DMSO. Accordingly, the expressions of ChAT, MAP-2 and synapsin I were higher in the BME-treated BMSC. The statistical

analysis showed that there were no statistical differences in the means of the percentages of immunoreactive cells in ChAT, NF-160 and NF-200.

The means of the percentages of immunoreactive cells in MAP-2, synapsin I and NF-68 were significantly higher in BME than in DMSO,

represented by an asterisk.



Chloroform was added to the solution and centrifuged

for 15 min at 12 000 g. The upper phase was then

transferred to another tube and an equal volume of

isopropanol was added. The mixture was centrifuged for

15 min at 12 000 g and the resulting pellet washed in

70% ethanol and dissolved in diethyl pyrocarbonate

(DEPC)-treated water. The purity and integrity of the

extracted RNA were evaluated by optical density

measurements (260/280 nm ratio) and examined using

electrophoresis on an agarose gel.

Figure 5. Photomicrographs of immunocytochemistry for the neurofilaments used for characterizing the transdifferentiated BMSC at day 1 after

pre-induction with BME. The right panels represent the phase-contrast of the immunostained cells. (A) Immunostained cells with anti-NF-68 Ab,

which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (B) phase-contrast of the same image (scale bar 50

mM). (C) Immunostained cells with anti-NF-160 Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide);

(D) phase-contrast of the same image (scale bar 50 mM). (E) Immunostained cells with anti-NF-200 Ab, which reacted with FITC-conjugated

secondary Ab (counter stained with ethidium bromide); (F) phase-contrast of the same image (scale bar 50 mM).



One microgram of the total RNA was used as a template

in a 20-mL volume cDNA synthesis reaction containing

0.5 mg oligodT(18). This solution was first denaturated at

708C for 5 min and chilled on ice immediately. Then a

mixture of 20 U ribonuclease inhibitor, 1 mM dNTPs, 5�buffer supplied by the manufacturer and deionized water

Figure 6. Photomicrographs of immunocytochemistry for the other markers used for characterizing the transdifferentiated BMSC at day 1 after

pre-induction with BME. The right panels represent the phase-contrast of the immunostained cells. (A) Immunostained cells with anti-synapsin I

Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (B) phase-contrast of the same image (scale bar 50

mM). (C) Immunostained cells with anti-MAP-2 Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide);

(D) phase-contrast of the same image (scale bar 10 mM). (E) Immunostained cells with anti-ChAT Ab, which reacted with FITC-conjugated

secondary Ab (counterstained with ethidium bromide); (f) phase-contrast of the same image (scale bar 50 mM).



(nuclease free) up to 19 mL was added and the new mixture

incubated at 378C for 5 min; 200 U RevertAidTM M-MuLV

reverse transcriptase (Fermentas, Graiciuno, Lithuania) was

added to the reaction and the tube incubated in a

thermocycler (BIO RAD, Hercules, CA, USA) at 428C for

60 min and 708C for 10 min.

PCR was performed using 2 mL synthesized cDNA

with 1.25 U Taq polymerase (Cinnagen), 1.5 mM MgCl2,

Figure 7. Photomicrographs of immunohistochemistry for the neurofilaments used for characterizing the transdifferentiated BMSC at day 7 (the

end of induction). The right panels represent the phase-contrast of the immunostained cells. (A) Immunostained cells with anti-NF-68 Ab, which

reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (B) phase-contrast of the same image (scale bar 50 mM). (C)

Immunostained cells with anti-NF-160 Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide), note

neurite extensions can be seen; (D) phase-contrast of the same image (scale bar 50 mM). (E) Immunostained cells with anti-NF-200 Ab, which

reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (F) phase-contrast of the same image (scale bar 50 mM).



200 mM dNTPs, 1 mM of each primer, 10� buffer

supplied by the company and deionized distilled water in

a 50-mL total reaction volume. All common components

were added into the master mix and then aliquoted into

tubes. The cycling conditions were as follows: initial

denaturation at 948C for 5 min, followed by 35 cycles at

948C for 30 s, 56�588C (depending on the primers)

for 30 s, 728C for 45 s and a final extension of 728C for

5 min.

Each experiment was repeated at least three times in

order to ensure reproducibility.

The size of the digested products was checked with

1.5% agarose gel electrophoresis.

A semi-quantitative analysis was done using UVI Tech

software, where the ratio of band density of NeuroD to that

of b2-microglobulin for assessing NeuroD gene expression

was calculated.

The control in Oct-4 was undifferentiated BMSC. Two

controls were included for NeuroD: undifferentiated

BMSC and embryonic rat spinal cord.

Cell selection for transplantation

Data were obtained from the time�course using immuno-

cytochemical and RT-PCR studies, and cells at day 3 of

the experiment (the cells were pre-induced with BME for

1 day and induced with NGF for 2 days) were selected for

transplantation.

Cell labeling

Cells were labeled with bromodeoxyuridine (BrdU) by

adding 0.1 mM BrdU (Sigma) into the culture medium

before pre-induction (48�72 h), then were pre-induced for

1 day and induced for 2 days. The incorporation of BrdU

was confirmed by immunocytochemistry [19].

Animals

Adult female Sprague�Dawley rats (230�250 g) were

purchased from the Razi Institute, Tehran, Iran. Spinal

cord contusion was done using the New York Weighting

drop device (NYW) [20]. Briefly, the animals were

anesthetized with ketamine (80 mg/kg) and xylazine

(10 mg/kg) and a laminectomy carried out at T13. With

this method, the vertebral column is stabilized prior to the

injury. A 10-g weight rod, 2.5 mm in diameter, is dropped

from a height of 2.5 cm onto the dura matter of the spinal

cord. After injury, the muscle was sutured over the

laminectomy site and the skin closed. Post-operatively,

the rats received a 5-mL injection of Ringer lactate

subcutaneously and injections of ceftazoline (50 mg/kg)

twice a day for 3 days, and Tramadol (20 mg) intramuscu-

larly for 2 days.

Four groups of rats were included in the study: sham

operated (SO); untreated controls injected with normal

saline (NS) (9 mL: 3 mL at the epicenter, 3 mL above and 3

mL below the epicenter); undifferentiated BMSC (UB)

(300 000 cells in 9 mL: 100 000 in 3 mL at the epicenter,

100 000 in 3 mL above and 100 000 in 3 mL below the

epicenter); and transdifferentiated cholinergic-like neu-

rons (TC) (300 000 cells in 9 mL: 100 000 in 3 mL at the

epicenter, 100 000 in 3 mL above and 100 000 in 3 mL below

the epicenter). Seven days after laminectomy in NS and

contusion injury in UB and TC, the rats were anesthetized

and the surgical site re-opened for relevant treatment. The

Figure 8. An electrophorogram showing the expression of Oct-4 gene

(upper panel) in the untreated BMSC, C. The BMSC were pre-

induced with BME for 24 h, Pr, and then induced with NGF for 3, 5

and 7 days, I3, I5 and I7, respectively. L represents the DNA ladder. O

and M represent Oct-4 and b2-microglobulin bands, respectively. The

lower panel shows an electrophorogram of the expression of NeuroD

gene in untreated BMSC, C. BMSC were pre-induced with BME for

24 h, Pr, then induced with NGF for 3, 5 and 7 days, I3, I5 and I7,

respectively. S represents the expression profile of NeuroD in the

embryonic spinal cord as a positive control. L represents the DNA

ladder. N and M represent NeuroD and b2-microglobulin bands,

respectively.



wounds of the animals were closed and the animals

maintained for 6 weeks. A BBB behavioral test was carried

out before the experiment and weekly during the experi-

ment. The wounds in the SO group were re-opened and

sutured. Statistical analysis was done using one-way

analysis of variance (ANOVA) and Tukey’s test post-hoc.

A one-sample Kolmogorov�Smirnov test was used to

evaluate the normality of the data.

Figure 9. Photomicrographs of immunohistochemistry for ChAT, MAP-2 and synapsin I, used for characterizing the transdifferentiated BMSC

day 7 (the end of induction). (A) Immunostained cells with anti-ChAT Ab, which reacted with FITC-conjugated secondary Ab (counterstained with

ethidium bromide), note neurite extensions can be seen; (B) phase-contrast of the same image (scale bar 20 mM). (C) Immunostained cells with anti-

MAP-2 Ab, which reacted with FITC-conjugated secondary Ab (counterstained with ethidium bromide); (D) phase-contrast of the same image

(scale bar 20 mM). (E) Immunostained cells with anti-synapsin I Ab, which reacted with FITC-conjugated secondary Ab (counterstained with

ethidium bromide), note neurite extensions can be seen; (F) phase-contrast of the same image (scale bar 20 mM).



ResultsResults of in vitro study

The viability of the BMSC isolated from the rat femurs

was 95%; after five passages of BMSC, 95% of the

subcultured cells (Figure 1) were immunoreactive for

fibronectin (Figure 2). The negative control for immuno-

cytochemical staining is presented in Figure 3; the

cultured cells were stained with a secondary Ab conjugated

with FITC and counterstained with ethidium bromide and

the image showed no autofluoresence or non-specific

staining. The BMSC untreated control showed no im-

munoreactive cells for all the markers used in the

immunostaining. The data obtained from the other

negative control group (BMSC treated with BME for

7 days) showed no immunoreactivity to ChAT, synapsin I,

MAP-2, NF-160 and NF-200, while only 2% of the cells

showed immunoreactivity for NF-68. However, the viabi-

lity of the cells in this control was low (50%).

The immunocytochemistry of BMSC transdifferentia-

tion into neuronal-like cells was assessed with NF-200,

NF-160 and NF-68, which were used as neuronal markers.

MAP-2 and synapse I were used as synaptogenesis

markers, while ChAT was the cholinergic neuron marker.

Another set of genes was used as markers for BMSC

conversion into neuronal phenotype, including Oct-4

(BMSC stemness) and NeuroD (neuroblast marker) in

both the pre-induction and induction stages.

Pre-induction stage

Figure 4 shows a comparative study between the two pre-

inducers BME and DMSO. At the pre-induction stage, the

mean percentage of immunoreactive cells (MPIC) of

different markers, including NF-68, NF-160, NF-200,

ChAT, MAP-2 and synapsin I, was evaluated. The MPIC

of NF-160 and NF-200 showed no significant differences

between BME and DMSO, while ChAT showed significant

differences between them. Other markers, including

MAP-2 and synapsin I as well as NF-68, showed

significant statistical differences between the two pre-

inducers. The immunocytochemical staining of these

markers using BME as pre-inducer is presented in Figures

5 and 6.

Induction stage

A time�course (1, 3, 5 and 7 days) was applied in order to

evaluate the induction with NGF (time-points at days 3, 5

and 7) following pre-induction with BME (time-point at

day 1). Statistical analysis of the different time-points of

the differentiation showed normality of data. Table I shows

the means and standard error of the means (SEM) of the

percentages of the immunoreactive cells for NF-200, NF-

160, NF-68, ChAT, MAP-2 and synapsin I. The table

shows the means and SEM of each of the above markers. A

sustained increase was noticed in the expression of NF-

200, NF-160, ChAT and synapsin I, but the level of NF-68

decreased while the level of MAP-2 expression was

variable. The neuronal differentiation markers (NF-68,

NF-160 and NF-200) showed significant differences

except when NF-68 at day 1 was compared with NF-160

at days 5 and 7, NF-68 at day 3 with NF-200 at day 7 and

NF-160 at day 1, and NF-68 at day 7 with NF-200 at day

1. The percentages of the immunoreactive cells to synapsin

I at day 3 showed no significant difference from that of

day 1, while comparisons of synapsin I immunostaining at

other time-points were significant. Accordingly, MAP-2 at

day 1 showed no significant difference with days 3 and 5,

nor day 5 with day 7. On the other hand, comparisons

of time-points of MAP-2 with synapsin I was significant

except for synapsin I at day 7 with MAP-2 at days 1, 5

and 7. Comparisons of different time-points of ChAT

showed significant differences except for time-point day 5

with day 7.

Figure 7 represents the immunoreactivity of markers for

BMSC pre-induced with BME and induced with NGF.

Figure 8 demonstrates the electrophoresis of Oct-4 and

NeuroD in the untreated, pre-induced and induced

Figure 10. A photomicrograph of an animal subjected to contusion

injury using the NYW technique, which shows a cavity, C, in the

spinal cord at the epicenter 4 weeks after injury (scale bar 225 mM).



BMSC. Expression of cells induced with NGF was

analyzed at days 3, 5 and 7. Semi-quantitative NeuroD

expression was assessed using densitometry of the electro-

phoresis NeuroD expression band. The mean ratio of

NeuroD band density to that of b2-microglobulin (NDRB)

was obtained at days 3, 5 and 7. At day 1 using BME only

as pre-inducer (negative control), NDRB was 1.290.4, at

day 3 (pre-induction 1 day and induction for 2 days) it was

1.190.2, at day 5 (pre-induction 1 day and induction for 4

days) it was 0.990.1, and at day 7 (pre-induction 1 day and

induction for 6 days) it was 0.790.3. The results of the

time�course showed that there was a general declining

trend in NeuroD expression that was not statistically

significant. The immunoreactivity of the induced cells to

ChAT, MAP-2 and synapsin I is presented in Figure 9.

Result of the animal model

Figure 10 shows the post-injury cavitation in the spinal

cord, and the immunoreactive cells for BrdU-labeled

cholinergic-like neurons transplanted in a rat with a

contusive spinal cord are shown in Figure 12. The

histogram represents the results of the BBB scores in the

groups used in the study, including NS, UB and TC, which

showed significantly lower scores than those of SO. The

Figure 12. A histogram showing the BBB scores of the animal groups used in the study: the sham-operated group (SO) is shown by the white

column; the untreated control group injected with normal saline (NS) (9 mL: 3 mL at the epicenter, 3 mL above and 3 mL below the epicenter) is

shown by the solid black column; the undifferentiated BMSC transplantation group (UB) (300 000 cells in 9 mL: 100 000 in 3 mL at the epicenter,

100 000 in 3 mL above and 100 000 in 3 mL below the epicenter) is shown by a dotted pattern; the transdifferentiated cholinergic-like neuron

transplantation group (TC) (300 000 cells in 9 mL: 100 000 in 3 mL at the epicenter, 100 000 in 3 mL above and 100 000 in 3 mL below the

epicenter) is shown by a cross-hatched pattern. The scoring was done at the day of the injection (D0), 1 week after the injection (W1) and at 2, 3, 4,

5 and 6 weeks after the injection, W2, W3, W4, W5 and W6, respectively. SO shows significant differences from the other groups; ‘a’ represents a

significant difference with NS, ‘b’ represents a significant difference with UB. The significance level was PB0.05.

Figure 11. A photomicrograph of immunocytochemistry for BrdU-labeled cholinergic-like neurons (arrow heads) delivered intraspinally. The

labeled cells were incubated with mouse anti-BrdU monoclonal Ab and reacted with rabbit anti-mouse secondary Ab conjugated with FITC (left

panel). The right panel shows the phase-contrast image of the same field of the injured spinal cord at the end of the experiment (scale bar 50 mM).



BBB scores of the animals in TC were significantly higher

than those for UB during the third and fourth weeks. and

no significant difference was noticed with those of UB in

other weeks. The scores in the NS group were significantly

lower than those of TC at the second, third, fourth, fifth

and sixth weeks, while they were significantly lower than

the UB group at the sixth week (Figure 12).

DiscussionSpinal cord injury is a devastating and debilitating

condition, with social impacts and costly financial burdens

[21]. The growing interest in BMSC is justified because of

their availability as an autologous source for transplanta-

tion [22,23]. Moreover, Harvey & Chopp have suggested

advantages of using BMSC in the treatment of brain injury

[24], because BMSC can be delivered as an autologous

graft, so avoiding immunologic rejection, and can be

administered intravenously, minimizing complications.

Transdifferentiation of embryonic stem cells into

a cholinergic neuronal phenotype was reported by

Soundararajan et al. [25], while others have reported

differentiation of embryonic stem cells into spinal moto-

neurons [26] and specification of human embryonic stem

cells into motoneurons [27].

Differentiation of neural stem cells into a cholinergic

phenotype has also been documented [28]. BMSC trans-

differentiation into a neuronal phenotype was reported by

Woodbury et al. [29] and other investigators have con-

firmed these findings [30�33]. Two methods for pre-

induction have been compared in order to optimize the

differentiation protocol. The results of pre-induction

showed that the percentage of NF-68 immunoreactive

cells, a marker for neuroblast, was higher with BME than

DMSO. This indicates that BME is more efficient at

transdifferentiating BMSC into neuroblasts [34], because

the expression of NF-68 was reported to occur at the

beginning of the neuronal differentiation, while NF-160

was expressed during neurite formation, which was then

followed by NF-200 expression, which is consistent with

the finding of this investigation [35].

Accordingly, other makers, such as MAP-2 and synapsin

I, have confirmed these findings. Both BME and DMSO

have shown that fewer cells tend to express NF-200, which

indicates that the majority of cells have transdifferentiated

into neuroblasts [36�39]. BME alone [29] or in combina-

tion with retinoic acid has been used as a pre-induction

agent in transdifferentiating BMSC into a neuronal

phenotype [40�42].

The markers of synaptogenesis, MAP-2, located at the

pre-synaptic and post-synaptic sides [43], and synapsin I,

at the pre-synaptic side only [44,45], were not equivalent.

This may indicate that the synapses are not efficiently

formed. The profile of MAP-2 and synapsin I expression at

the pre-induction stage is consistent with immaturity of

the differentiating cells [46�48]. The pattern of MAP-2

and synapsin I expression is consistent with ChAT

expression, which is low at the pre-induction stage. The

results of this investigation show that there is a decline in

the expression of NT-68 in BMSC differentiated into a

neuronal phenotype, which is consistent with the findings

of Chiu et al. [49].

Lu et al. [50] reported that BME activity in the cultured

BMSC was an artifact, while Hung et al. [36] reported that

the induction of BMSC into a neuronal phenotype was not

a stable process, with transdifferentiated cells reverting to

the original phenotype. However, in this investigation

NGF was used following pre-induction and resulted in

progressive transdifferentiation of the pre-induced cells

into a neuronal phenotype with an 80% yield of

differentiation of BMSC into cholinergic neuron-like cells.

Moreover, NGF is a strong neuroprotectant [51] that can

protect the cells injured by BME. On the one hand, BME

has been reported to inhibit neuronal oxidative stress by

increasing glutathione levels, on the other hand Ni et al.

[40] reported that glutathione could substantially increase

the activity of ChAT, resulting in alteration of neurite

outgrowth patterns. In addition, an in vivo study on the

effect of NGF on the developing nervous system reported

an increase in the expression of genes regulating the

synthesis of acetylcholine ([52]), which is consistent with

the results of this investigation.

The pattern of expression of Oct-4, a marker for BMSC

stemness, is consistent with other investigations [18,53],

while the pre-induced BMSC with NGF resulted in early

expression of the neuronal marker NeuroD, which is

confirmed by other investigations [54,55]. Other investi-

gators have reported Oct-4 expression by adult neural

stem cells following treatment with retinoic acid [28].

Therefore, the pattern of Oct-4 expression in uninduced

BMSC followed by Oct-4 suppression in induced cells is

consistent with the suppression of NeuroD. NeuroD is a

basic helix loop helix (b-HLH) protein, which is con-

sidered a neuronal determination gene [54,55]. The



expression of NeuroD has been reported to induce a

neuronal phenotype by increasing Neurogenin1 expres-

sion in mesenchymal stromal cells: The expression of

NeuroD has been reported to induce a neuronal pheno-

type by increasing Neurogenin1 expression in mesenchy-

mal stromal cells, which results in exit of the mesencymal

stromal cells from their cell cycle and terminally differ-

entiated into a neuronal phenotype; the expression of

NeuroD in the induced BMSC is in agreement with other

studies [56]. The expression of NeuroD in rat embryonic

spinal cord (used as a positive control in this study) is

consistent with other investigations that have reported the

expression of NeuroD in embryonic spinal cord [57].

Cholinergic neurons are important in the spinal cord

because they are involved in sensory as well as somatic

and visceral motility [1,2]. Li et al. [58] transplanted NGF

gene-modified BMSC in a rat model of Alzheimer’s

disease, which resulted in the differentiation of these cells

into cholinergic neurons and improvement in the model.

This is consistent with our results. Moreover, the trans-

plantation of the transdifferentiated BMSC into a choli-

nergic phenotype initially (at the third and fourth weeks)

enhanced the locomotive activity of rats with contusive

spinal cord injury, showing significantly higher BBB scores

than those of undifferentiated BMSC; no significant

differences were subsequently noticed at the fifth and

sixth weeks. This may indicate the need of transdiffer-

entiated cells for NGF in order to sustain their cholinergic

activity in vivo.

AcknowledgementsWe are grateful to Mrs H. H. AliAkbar for editing the

manuscript. Also, we are deeply indebted to Mr G. R. Kaka

for his co-operation in this investigation. The project was

supported in part by Janbazan Medical and Engineering

Center. We are grateful for Tarbiat Modares University,

The Office of Assistant of President for Scientific Research

and Technology.

Declaration of interest: The authors report no conflicts of

interest. The authors alone are responsible for the content

and writing of the paper.

References

1 Phelps PE, Barber RP, Houser CR, Crawford GD, Salvaterra

PM, Vaughn JE. development of neurons containing choline

acetyltransferase in rat spinal cord: an immunocytochemical

study. J Comp Neurol. 1984;229:347�61.

2 Barber RP, Phelps PE, Houser CR, Crawford GD, Salvaterra

PM, Vaughn JE. The morphology and distribution of neurons

containing choline acetyltransferase in the adult rat spinal cord:

an immunocytochemical study. J Comp Neurol 1984;229:329�46.

3 Metz GA, Curt A, van de Meent H, Klusman I, Schwab ME,

Dietz V. Validation of the weight-drop contusion model in rats: a

comparative study of human spinal cord injury. J Neurotrauma

2000;17:1�17.

4 Basso DM, Beattie MS, Bresnahan JC. Graded histological and

locomotor outcomes after spinal cord contusion using the NYU

weight-drop device versus transection. Exp Neurol 1996;139:

244�56.

5 Behrmann DL, Bresnahan JC, Beattie MS, Shah BR. Spinal cord

injury produced by consistent mechanical displacement of the

cord in rats: behavioral and histologic analysis. J Neurotrauma

1992;9:197�217.

6 Grossman SD, Rosenberg LJ, Wrathall JR. Temporal�spatial

pattern of acute neuronal and glial loss after spinal cord

contusion. Exp Neurol 2001;168:273�82.

7 Collazos-Castro JE, Soto VM, Gutierrez-Davila M, Nieto-

Sampedro M. Motoneuron loss associated with chronic locomo-

tion impairments after spinal cord contusion in the rat. J

Neurotrauma 2005;22:544�58.

8 Llewellyn-Smith IJ, Weaver LC, Keast JR. Effects of spinal cord

injury on synaptic inputs to sympathetic preganglionic neurons.

Prog Brain Res 2006;152:11�26.

9 McLachlan EM, Brock JA. Adaptations of peripheral vasocon-

strictor pathways after spinal cord injury. Prog Brain Res 2006;

152:289�97.

10 Hoang TX, Havton LA. Novel repair strategies to restore

bladder function following cauda equina/conus medullaris

injuries. Prog Brain Res 2006;152:195�204.

11 Lindvall O, Kokaia Z. Stem cells for the treatment of

neurological disorders. Nature 2006;441(7097):1094�6.

12 Yu D, Silva GA. Stem cell sources and therapeutic approaches

for central nervous system and neural retinal disorders.

Neurosurg Focus. 2008;24:E11.

13 Webber DJ, Minger SL. Therapeutic potential of stem cells in

central nervous system regeneration. Curr Opin Investig Drugs

2004;5:714�9.

14 Astradsson A, Cooper O, Vinuela A, Isacson O. Recent advances

in cell-based therapy for Parkinson disease. Neurosurg Focus.

2008;24(3�4):E6.

15 Tzeng SF. Neural progenitors isolated from newborn rat spinal

cords differentiate into neurons and astroglia. J Biomed Sci

2002;9:10�6.

16 Tarasenko YI, Gao J, Nie L, Johnson KM, Grady JJ, Hulsebosch

CE et al. Human fetal neural stem cells grafted into contusion-

injured rat spinal cords improve behavior. J Neurosci Res

2007;85:47�57.

17 Gao J, Coggeshall RE, Tarasenko YI, Wu P. Human neural stem

cell-derived cholinergic neurons innervate muscle in moto-

neuron deficient adult rats. Neuroscience 2005;131:257�62.



18 Movaghar B, Tiraihi T, Mesbah-Namin SA. Transdifferentiation

of bone marrow stromal cells into Schwann cell phenotype using

progesterone as inducer. Brain Res 2008;1208:17�24.

19 Khalatbary AR, Tiraihi T. Localization of bone marrow stromal

cells in injured spinal cord treated by intravenous route depends

on the hemorrhagic lesions in traumatized spinal tissues. Neurol

Res 2007;29:21�6.

20 Basso DM, Beattie MS, Bresnahan JC. A sensitive and reliable

locomotor rating scale for open field testing in rats.

J Neurotrauma 1995;12:1�21.

21 Ackery A, Tator C, Krassioukov A. A global perspective on

spinal cord injury epidemiology. J Neurotrauma 2004;21:1355�70.

22 Lee JB, Kuroda S, Shichinohe H, Yano S, Kobayashi H, Hida

K et al. A pre-clinical assessment model of rat autogeneic bone

marrow stromal cell transplantation into the central nervous

system. Brain Res Brain Res Protoc 2004;14:37�44.

23 Enzmann GU, Benton RL, Talbott JF, Cao Q , Whittemore SR.

Functional considerations of stem cell transplantation therapy

for spinal cord repair. J Neurotrauma 2006;23:479�95.

24 Harvey RL, Chopp M. The therapeutic effects of cellular

therapy for functional recovery after brain injury. Phys Med

Rehabil Clin N Am 2003;14(Suppl 1):S143�51.

25 Soundararajan P, Lindsey BW, Leopold C, Rafuse VF. Easy and

rapid differentiation of embryonic stem cells into functional

motoneurons using sonic hedgehog-producing cells. Stem Cells

2007;25:1697�706.

26 Wichterle H, Lieberam I, Porter JA, Jessell TM. Directed

differentiation of embryonic stem cells into motor neurons. Cell

2002;110:385�97.

27 Li XJ, Du ZW, Zarnowska ED, Pankratz M, Hansen LO, Pearce

RA et al. Specification of motoneurons from human embryonic

stem cells. Nat Biotechnol 2005;23:215�21.

28 Takahashi J, Palmer TD, Gage FH. Retinoic acid and neuro-

trophins collaborate to regulate neurogenesis in adult-derived

neural stem cell cultures. J Neurobiol 1999;38:65�81.

29 Woodbury D, Schwarz EJ, Prockop DJ, Black IB. Adult rat and

human bone marrow stromal cells differentiate into neurons. J

Neurosci Res 2000;61:364�70.

30 Sanchez-Ramos J, Song S, Cardozo-Pelaez F, Hazzi C, Stedeford

T, Willing A et al. Adult bone marrow stromal cells differentiate

into neural cells in vitro. Exp Neurol 2000;164:247�56.

31 Munoz-Elıas G, Woodbury D, Black IB. Marrow stromal cells,

mitosis, and neuronal differentiation: stem cell and precursor

functions. Stem Cells 2003;21:437�48.

32 Garcıa R, Aguiar J, Alberti E, de la Cuetara K, Pavon N. Bone

marrow stromal cells produce nerve growth factor and glial cell

line-derived neurotrophic factors. Biochem Biophys Res Commun

2004;316:753�4.

33 Rismanchi N, Floyd CL, Berman RF, Lyeth BG. Cell death and

long-term maintenance of neuron-like state after differentiation

of rat bone marrow stromal cells: a comparison of protocols.

Brain Res 2003;991:46�55.

34 Carden MJ, Trojanowski JQ , Schlaepfer WW, Lee VM. Two-

stage expression of neurofilament polypeptides during rat

neurogenesis with early establishment of adult phosphorylation

patterns. J Neurosci 1987;7:3489�504.

35 Lariviere RC, Julien JP. Functions of intermediate filaments in

neuronal development and disease. J Neurobiol 2004;58:131�48.

36 Hung SC, Cheng H, Pan CY, Tsai MJ, Kao LS, Ma HL. In vitro

differentiation of size-sieved stem cells into electrically active

neural cells. Stem Cells 2002;20:522�9.

37 Abouelfetouh A, Kondoh T, Ehara K, Kohmura E. Morpholo-

gical differentiation of bone marrow stromal cells into neuron-

like cells after co-culture with hippocampal slice. Brain Res 2004;

1029:114�9.

38 Park S, Lee KS, Lee YJ, Shin HA, Cho HY, Wang KC et al.

Generation of dopaminergic neurons in vitro from human

embryonic stem cells treated with neurotrophic factors. Neurosci

Lett 2004;359:99�103.

39 Ishiuchi S, Nakazato Y, Iino M, Ozawa S, Tamura M, Ohye C. In

vitro neuronal and glial production and differentiation of human

central neurocytoma cells. J Neurosci Res 1998;51:526�35.

40 Ni L, Wen Y, Peng X, Jonakait GM. Antioxidants N-acetylcys-

teine (NAC) and 2-mercaptoethanol (2-ME) affect the survival

and differentiative potential of cholinergic precursors from the

embryonic septal nuclei and basal forebrain: involvement of ras

signaling. Brain Res Dev Brain Res 2001;130:207�16.

41 Kim TS, Nakagawa T, Kita T, Higashi T, Takebayashi S,

Matsumoto M et al. Neural connections between embryonic

stem cell-derived neurons and vestibular hair cells in vitro. Brain

Res 2005;1057:127�33.

42 Kondo T, Johnson SA, Yoder MC, Romand R, Hashino E. Sonic

hedgehog and retinoic acid synergistically promote sensory fate

specification from bone marrow-derived pluripotent stem cells.

Proc Natl Acad Sci USA 2005;102:4789�94.

43 Sheng M. Molecular organization of the postsynaptic specializa-

tion. Proc Natl Acad Sci USA 2001;98:7058�61.

44 Fernandez-Chacon R, Sudhof TC. Genetics of synaptic vesicle

function: toward the complete functional anatomy of an

organelle. Annu Rev Physiol 1999;61:753�76.

45 Zhai RG, Vardinon-Friedman H, Cases-Langhoff C, Becker B,

Gundelfinger ED, Ziv NE et al. Assembling the presynaptic

active zone: a characterization of an active one precursor vesicle.

Neuron 2001;29:131�43.

46 Kitamura C, Shirai K, Inoue M et al. Changes in the subcellular

distribution of microtubule-associated protein 1B during synap-

togenesis of cultured rat cortical neurons. Cell Mol Neurobiol

2007;27:57�73.

47 Finley MF, Kulkarni N, Huettner JE. Synapse formation and

establishment of neuronal polarity by P19 embryonic carcinoma

cells and embryonic stem cells. J Neurosci 1996;16:1056�65.

48 Ma W, Liu QY, Jung D, Manos P, Pancrazio JJ, Schaffner AE et al.

Central neuronal synapse formation on micropatterned surfaces.

Brain Res Dev Brain Res 1998;111:231�43.

49 Chiu FC, Feng L, Chan SO, Padin C, Federoff JH. Expression of

neurofilament proteins during retinoic acid-induced differentia-

tion of P19 embryonal carcinoma cells. Brain Res Mol Brain Res

1995;30:77�86.



50 Lu P, Blesch A, Tuszynski MH. Induction of bone marrow

stromal cells to neurons: differentiation, transdifferentiation, or

artifact? J Neurosci Res 2004;77:174�91.

51 Koike T, Tanaka S. Evidence that nerve growth factor

dependence of sympathetic neurons for survival in vitro may

be determined by levels of cytoplasmic free Ca2�. Proc Natl Acad

Sci USA 1991;88:3892�6.

52 Aloe L, Alleva E, Bohm A, Levi-Montalcini R. Aggressive

behavior induces release of nerve growth factor from mouse

salivary gland into the bloodstream. Proc Natl Acad Sci USA

1986;83:6184�7.

53 Lamoury FM, Croitoru-Lamoury J, Brew BJ. Undifferentiated

mouse mesenchymal stem cells spontaneously express neural

and stem cell markers Oct-4 and Rex-1. Cytotherapy 2006;8:

228�42.

54 von Bohlen Und Halbach O. Immunohistological markers for

staging neurogenesis in adult hippocampus. Cell Tissue Res

2007;329:409�20.

55 Gallo R, Zazzeroni F, Alesse E, Mincione C, Borello U, Buanne

P, D’Eugenio R et al. REN: a novel, developmentally regulated

gene that promotes neural cell differentiation. J Cell Biol

2002;158:731�40.

56 Kim SS, Yoo SW, Park TS, Ahn SC, Jeong HS, Kim JW et al.

Neural induction with neurogenin1 increases the therapeutic

effects of mesenchymal stem cells in the ischemic brain. Stem

Cells 2008;26:2217�28.

57 Lee JK, Cho JH, Hwang WS, Lee YD, Reu DS, Suh-Kim H.

Expression of neuroD/BETA2 in mitotic and postmitotic

neuronal cells during the development of nervous system. Dev

Dyn 2000;217:361�7.

58 Li LY, Li JT, Wu QY, Li J, Feng ZT, Liu S et al. Transplantation

of NGF-gene-modified bone marrow stromal cells into a rat

model of Alzheimer’s disease. J Mol Neurosci 2008;34:157�63.



Transdifferentiation of bone marrow stromal cells into neuron-like cells

Documents