Top Banner
Transcription vs. Translation Making Proteins
16

Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Mar 27, 2015

Download

Documents

Nicholas Cullen
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Transcription vs. Translation

Making Proteins

Page 2: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

from to to make up

Reviewing RNASection 12-3

also called which functions to also called also called which functions towhich functions to

can be

RNA

Messenger RNA Ribosomal RNA Transfer RNA

mRNA Carry instructions rRNACombine

with proteins tRNABring

amino acids toribosome

DNA Ribosome Ribosomes

Page 3: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Transcription

• RNA polymerase binds to DNA and separates the DNA strand.

• Then RNA polymerase then uses one strand of DNA as a template from which nucleotides are assembled into a strand of RNA

Page 4: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

RNADNA

RNApolymerase

TranscriptionSection 12-3

Adenine (DNA and RNA)Cystosine (DNA and RNA)Guanine(DNA and RNA)Thymine (DNA only)Uracil (RNA only)

Page 5: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

How does RNA read DNA?

• What is a codon?– Three nucleotides

• How does the RNA know where to start?– DNA polymerase only binds to promoters

• Specific codon that signifies the beginning of a sequence (AUG or methionine)

• How does the RNA know when to stop?– Specific codons that signify the end of a

protein chain (there are 3 of them)

Page 6: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Transcription Video

Click Here

Page 7: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Transcription Activity

• The following is a DNA code. Translate them into RNA and then into a protein chain using page 303 in your textbook:

• DNA= TAC CGA TTA GCG ATG AGT AGA ACT

• RNA= AUG GCU AAU CGC UAC UCA UCU UGA

• Start Alanine Asparagine Arginine Tyrosine Serine Serine Stop

Page 8: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Transcription vs. Translation

Making Proteins

Page 9: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

from to to make up

Reviewing RNASection 12-3

also called which functions to also called also called which functions towhich functions to

can be

RNA

Messenger RNA Ribosomal RNA Transfer RNA

mRNA Carry instructions rRNACombine

with proteins tRNABring

amino acids toribosome

DNA Ribosome Ribosomes

Page 10: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Reviewing Transcription

• Making mRNA from Copying DNA• How is it different from DNA Replication?

DNA Replication TranscriptionCopies both strands making 2

new DNA moleculesCopies one strand of DNA

making 1 mRNA

Uses DNA Polymerase Uses RNA polymerase

Happens when cell splits Happens all the time

Page 11: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Translation

• Cell uses information from mRNA to produce proteins

– tRNA brings amino acids to the mRNA chain

– Anticodon on tRNA binds to codon on mRNA

– Amino Acids are bonded to each other in a process called elongation

Page 12: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.
Page 13: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Section 12-3

Page 14: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Translation Video

Click HERE

Page 15: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Activity

• Transcribe and then Translate the following DNA code into a protein chain.

• ATTACACCGCATATACTAAC

Page 16: Transcription vs. Translation Making Proteins. fromtoto make up Reviewing RNA Section 12-3 also calledwhich functions toalso called which functions to.

Homework

• Explain the entire process for creating a protein (transcriptions and translation)– Use the following DNA code to help you:

• TCTACGCAAAGACCTTAGCATATAACACTTAG

– Use pictures or drawings to illustrate what is happening in each step

– Use the following vocab words:• RNA polymerase, Codon, Anticodon, Elongation,

DNA, mRNA, tRNA, amino aicd, protein