Transcription • The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template – Separates storage from use – Provides a control point for regulation – Amplification step (can make many RNA copies) RNA DNA H 5’-…TGAGTCA CTGTACGCTATATAAGGC…GATCGCCTCAGGAACCACCATGCT…-3’ 3’-…ACTCAGTGACATGCGATATATTCCG…CTAGCGGAGTCCTTGGTGGTACGA…-5’
36
Embed
Transcription The synthesis of a ribonucleic acid (RNA) polymer from a deoxyribonucleic acid (DNA) template –Separates storage from use –Provides a control.
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Transcription• The synthesis of a ribonucleic acid (RNA) polymer from a
deoxyribonucleic acid (DNA) template
– Separates storage from use– Provides a control point for regulation– Amplification step (can make many RNA copies)
• Start polymerizing nucleotides one at a time into an RNA strand that is complementary to the template DNA strand– Template DNA is “read” in 3’ --> 5’ direction– The RNA transcript is synthesized in 5’ --> 3’ direction
RNAn + NTP --> RNAn+1 + pyrophosphate (PPi)
PPi --> 2 inorganic phosphate (Pi)– A short 10-12nt region of RNA-DNA hybrid is created and
• Respond to “stop” signal sequences indicating the end of the gene– stop synthesis (a pause in the polymerization reaction)– release the RNA transcript product– Release RNAp from the DNA
• RNAp “core” enzyme (no promoter specificity)– 5 subunits capable of binding DNA & RNA synthesis
• Sigma factors target RNAp to different types of promoters – Sigma70 is for “housekeeping” and most other genes
-35 element “TTGACA”
-10 element “TATAAT”– Sigma32 is for “heat shock” genes
• Chaperone genes induced in response to excess heat
BACTERIA:
• BIND
• UNWIND
• INITIATE• ELONGATE
without sigma
BACTERIA
• TERMINATE– Rho-dependent
• Rho protein (helicase) unwinds RNA-DNA duplex causing release of finished RNA transcript
– Rho-independent• Rho protein is not required• DNA “terminator” sequence
causes RNAp to pause, release from DNA and release RNA transcript
Rho
Txn in eukaryotes• Three different RNAp enzymes: RNApI, RNApII, RNApIII
• All eukaryotic RNAs require additional processing steps after synthesis to yield the mature RNA
• Primary RNA transcripts are often called “pre-RNAs”
Txn in eukaryotes: RNApI• 100s of copies of the large ribosomal RNA (rRNA) genes in most genomes
– Large numbers needed to yield large amounts of RNA• Copies are grouped into clusters called rDNA
– For example, humans have 5 rDNA clusters– rDNA clusters are grouped within the nucleus to form the nucleoli
• Nucleoli are the site of rRNA synthesis, processing and ribosome assembly
18S 5.8S 28S 18S 5.8S 28S 18S 5.8S 28S
Txn in eukaryotes: RNApI• RNApI molecules, densely packed on DNA template• Very high rate of rRNA synthesis• pre-rRNA must be processed to yield mature rRNA
18S 5.8S 28S 18S 5.8S 28S 18S 5.8S 28S
Txn in eukaryotes: RNApIII• RNApIII can recognize as “promoter” sequences, regions
internal to the transcription unit– Specific General Transcription Factors (GTFs) enable promoter binding
• TFIID, TFIIA, TFIIB, TFIIF, TFIIE, TFIIH• TATA box, at -24 to -32 matches closely to “TATATAA”
– TFIID contains the TATA Binding Protein (TBP)
RNApII txn
BIND
• TFIID, via TBP, binds TATA box DNA sequence
• TFIIA & TFIIB add next, assemble with some DNA sequence selectivity
• A TFIIF-RNApII complex binds
• TFIIE & TFIIH bind to complete the “pre-initiation complex”
RNApII txn
UNWIND
• TFIIH contains a helicase subunit for unwinding the promoter region
INITIATE
• Synthesize 10-12nts
ELONGATE
• TFIIH contains two kinase subunits that phosphorylate the C-terminal Domain (CTD) of RNApII
CTD repeat: YSPTSPS
• Breaks contacts w/ promoter
RNApII transcript processing• mRNA structure
– 5’-end is “capped”
• Capping enzymes bind to phospho-CTD of RNApII
• Unusual 5’ -- 5’ linkage of 7-methylG-PPP
• Protects 5’-end from exonucleases
• Enhances nuclear export
• Enhances mRNA tln
RNApII transcript processing• mRNA structure
– 5’-untranslated region (UTR)• Regulation of translation (TLN) and stability
– Coding region• Sequence of nucleotides continuously encoding a protein• Also called an ‘open reading frame’ (ORF)
– 3’-UTR• Regulation of translation (TLN) and stability
• mRNA structure– 3’-end is polyadenylated
• Requires a large protein complex– (e.g. CPSF, CStF)
• Recognizes 5’-AAUAAA-3’ sequence in primary transcript
• Cleaves pre-RNA ~20nt downstream of AAUAAA
• PolyA polymerase adds 50-250 adenosines at new 3’-end
– Protects 3’-end from exonucleases
TERMINATE• Recognition of AAUAAA coupled
with RNApII destabilization• Cleavage effectively releases
pre-RNA from RNApII• RNApII with reduced processivity
falls off DNA template
RNApII transcript processing• Primary transcripts for protein coding genes (hnRNAs)
are much larger than their corresponding mRNAs
• Heteronuclear RNAs– Localized to the cell nucleus– Contain “exon” sequences– Contain “intron” sequences
• mRNAs– Localized to the cell cytoplasm– Contain only “exon” sequences
• RNA splicing– Removal of introns– Joining exons together
RNApII transcript processing: splicing• Exons can be either protein coding or 5’-/3’-UTR sequences
– Exons contribute to the final mRNA product– ~150nts each
• Intervening sequences between exons are introns– Introns must be removed to yield the final mRNA product– ~3500nts each
RNApII transcript processing: splicing• Specific RNA sequences demarcate the exon/intron borders
– Subunits of the “spliceosome” recognize these “exon junctions”
• The spliceosome catalyzes two reactions that eliminate the intron and join upstream and downstream exons together
• How does the cell machinery determine which exons to splice together?
– Which ones should be made?
Exon 1 Exon 2 Exon 3 Exon 4
Exon 1 Exon 2 Exon 3 Exon 4
Exon 1 Exon 3 Exon 4
Exon 1 Exon 2 Exon 4
??
?
?
• Spliceosomes are assembling on pre-RNA during Elongation– Provides mechanism to avoid confusing which exons go together– Sequential assembly of spliceosomes as pre-RNA is synthesized helps
assure no exon/intron junctions are accidentally missed
Alternative splicing• Not all exons have “ideal” exon/intron splicing sequences
– Not all are efficiently recognized by spliceosome
– Exonic Splicing Enhancer (ESE) sequences• Binding factors can promote use of an exon/intron junction