TRANSCRIPTION PROFILING OF LOW TEMPERATURE RESPONSIVE GENE(S) OF Cicer microphyllum

TRANSCRIPTION PROFILING OF LOW TEMPERATURE

RESPONSIVE GENE(S) OF Cicer microphyllum

THESIS

SUBMITTED FOR THE AWARD OF THE DEGREE OF

DOCTOR OF PHILOSOPHY

IN BIOTECHNOLOGY

TO

DEPARTMENT OF BIOTECHNOLOGY,

KUMAUN UNIVERSITY, NAINITAL, UTTARAKHAND, INDIA

BY

RUPESH KUMAR SINGH

Under the Supervision of

Dr. Veena Pande Dr. Zakwan Ahmed

Head, Department of Biotechnology Director, DIBER (DRDO)

Kumaun University, Nainital Haldwani, Nainital

2010

ACKNOWLEDGEMENTS

With an exorbitant sense of gratitude, I express my sincere thanks to Dr. Veena Pande, my supervisor

and Head, Department of Biotechnology, Kumaun University, Nainital, for giving me a splendid opportunity

to do my research work and encourage me to accomplish my task with zeal.

This work was carried out at the Division of Molecular Biology and Genetic Engineering, Defence

Institute of Bio Energy Research, Defence Research and Development Organization, Haldwani, Nainital,

Uttarakhand, India. Dr. Zakwan Ahmed, Director DIBER and my co-supervisor is greatly thanked for

introducing me to the field of cold acclimation of plants. I can never forget his constant encouragement and

persuasiveness during the course of my work.

I am indebted to my group officer Dr. S. Anandhan for guiding me so patiently and also for his

generous help throughout my studies in this project at DIBER. He is the person who gave me opportunity to

start research work in this field as well as his valuable time in the laboratory.

Dr. Mohommad Arif, Dr. Meenal Rathore, Dr. D. Goyarey, Dr. S. M. Gupta, Dr. Maya Kumari, Dr.

Atul Grover, Dr Vikas Yadav Patade, Mrs. K.L. Pandey and Mrs. Pramila Shah of DIBER are thanked for

giving me their valuable time in the laboratory and for offering me good ideas during this study.

I also want to thank all JRFs/SRFs of this lab and friends for their kind help and support during this

work. I particularly thank all past and present members of DIBER group and it has been a pleasure working

with all of you. I am thankful to all who helped me directly or indirectly in completing this Ph.D. thesis work.

Director DIHAR, Leh is gratefully acknowledged for kind provision of seeds.

My heartfelt thanks are to my parents, brother and sister for their kind support during my studies.

For financial support (from 19-12-05 to 18-12-10), DRDO, Ministry of Defence is gratefully

acknowledged.

Date: 02.12.2010 (Rupesh Kumar Singh)

CERTIFICATE

This is to certify that the work incorporated in the Ph.D. thesis entitled

“Transcription Profiling of Low Temperature Responsive Gene(s) of Cicer

microphyllum” is a record of bonafide research carried out by Mr. Rupesh Kumar

Singh, under my supervision and no part of the thesis has been submitted for any

other degree or diploma.

Mr. Rupesh Kumar Singh has put in more than two hundred days of research

work in the Molecular Biology and Genetic Engineering Division, Defence Institute

of Bio Energy Research, Haldwani, Nainital, Uttarakhand, under my supervision.

(Zakwan Ahmed)

02

CERTIFICATE

I have pleasure in forwarding the thesis of Mr. Rupesh Kumar Singh

entitled “Transcription Profiling of Low Temperature Responsive Gene(s) of

Cicer microphyllum” for the degree of Doctor of Philosophy in Biotechnology.

The work presented embodies the original work of the candidate. Mr.

Rupesh Kumar Singh has put in more then two hundred days of research under

my supervision.

(Veena Pande)

CONTENTS

1. INTRODUCTION 1-5

2. REVIEW OF LITERATURE 6-30

3. MATERIALS AND METHODS 31-50

4. RESULTS 51-70

5. DISCUSSION 71-86

6. SUMMARY 87-89

REFERENCES I-XXIV

APPENDICES I-V

Publications and Award

Research paper:

Rupesh Kumar Singh, S. Anandhan, Shweta singh, Vikas Yadav Patade, Zakwan Ahmed

and Veena Pande (2010). Metallothionin like gene from Cicer microphyllum is regulated by

multiple abiotic stress. Protoplasma (In press).

Abstract

Rupesh Kumar Singh, Mohammad Aslam, S. Anandhan, Veena Pande and Zakwan

Ahmed (2009).Isolation of low temperature stress regulated genes from Cicer microphyllum by

SSH. International conference on grain legumes, value addition and trade held at Indian Institute

of Pulses Research, Kanpur (14-02-2010 to 16-02-2010).

Award

Best poster award in International Conference on grain legumes, value addition and trade held at

Indian Institute of Pulses Research Kanpur during 14-02-2009 to 16-02-2009.

Conferences attended

1- International Conference on grain legumes, value addition and trade (Poster presentation)

during 14-02-2009 to 16-02-2009 at Indian Institute of Pulses Research, Kanpur, India.

2- 5th World congress on Cellular and molecular Biology (Oral presentation) during 02-11-09

to 06 -11-09 at Devi Ahilya University, Indore, India.

ABBREVIATIONS

ABA abscisic acid

ABP actin binding protein

ABRE ABA responsive elements

APX ascorbate peroxidase (EC 1.11.1.11)

BLAST Basic Local Alignment Search Tool

bp base pair

CAT catalase (EC 1.11.1.6)

cDNA complementary DNA

cm centimeter

CaM calmodulin

CBL calcineurin-like protein

CBF CRT/DRE binding factor

CDPK calcium dependent protein kinase

CIPK CBL-interacting protein kinase

COR cold responsive

CRT C-repeat

CRT calreticulin

DHN dehydrin

DNA deoxyribonucleic acid

DRE dehydration responsive element

DREB DRE binding protein

ER endoplasmic reticulum

EDTA ethylene diamine tetra acetic acid

EST Expressed Sequence Tag

FT freezing tolerance

GB glycine betaine

h hour

Kb kilo bases

kD kilodalton

LEA late embryogenesis abundant

LT low temperature

LT50 lethal temperature for 50% of the tissues

LTRE low-temperature-responsive element

MAP microtubule associated protein

MAPK mitogen-activated protein kinase

mRNA messenger RNA

mg milligram

min min

ml milliliter

mm millimeter

mM millimolar

oC Degree Celcius

PCR Polymerase Chain Reaction

PEG Polyethylene glycol

PVP polyvinyl pyrrolidone

PC phosphatidylcholine

PLD phospholipase D

PM plasma membrane

ROS reactive oxygen species

rpm revolutions per minute

RT Reverse transcription

SSH suppression subtractive hybridization

SAMK stress-activated protein

TAE Tris Acetate EDTA

Taq Thermus aquaticus

Tris hydroxymethyl aminomethane

U Unit

LIST OF TABLES

S. No. Content Page No.

1. ESTs exhibited significant homology with previously reported genes in gene bank 54-56

2. Fold change in transcript abundance of cmMet-2 in different tissues 61

3. Fold change in transcript abundance of cmMet-2 in different time interval in aerial

parts in response to cold stress exposure at 4oC

62

4. Fold change in transcript abundance of cmMet-2 in different tissues in response to

cold stress exposure at 4oC for 24 h (fold change is calculated over the control of

same tissue)

63

5. Fold change in transcript abundance of putative wound induced gene during low

temperature stress in different time intervals (0, 6, 12 and 24 h). Each treatment

replicated three times

68

6. Fold change in transcript abundance of putative wound induced gene in response to

SA spray (Mock, 10 and 50 M). Each treatment replicated three times

69

11

LIST OF FIGURES

S. No. Content Page No.

1. Plant of Cicer microphyllum grown in natural habitat (A) as well as in the

laboratory (B). 31

2. Total RNA isolated from control as well as stressed plant leaves. 52

3. Results of SSH using cDNA from cold stressed leaves as testers and that from

control leaves as drivers. Lane 1 & 2: unsubtracted cDNA, lane 3 & 4: After

first round of subtraction, lane 5&6: Forward-subtracted cDNA and reverse

subtracted cDNA, lane M: DNA ladder mix marker. 52

4. Screening of insert size by colony PCR. Lane M: 1 kb DNA ladder, lane 1-19:

PCR product. 53

5. Differential screenings of these clones by dot analysis, arrow blot ( ) represents

same clone differentially expressed in low temperature (4°C) stress. 53

6. Comparison of deduced amino acid sequences of C. micropyllum with other

reported plant MT-like protein sequences. 57

7. Phylogenetic tree constructed based on metallothionein protein sequences of C.

microphyllum and other known plant MT-like protein sequences. 57

8. Polymerase chain reaction of metallothionine gene using genomic DNA and

cDNA. Lane M: 100 bp DNA ladder, lane a: Amplification of metallothionin

gene from cDNA, lane b: Amplification of metallothionin gene from genomic

DNA, lane c: Negative control and lane d: Positive control. 58

9. Southern blot hybridization for metallothionin gene in Cicer microphyllum

genomic DNA digested with three different restriction enzymes. Lane a- EcoRI

, lane b- BamHI and lane c: Mbo1. 59

10. Whole plant in situ hybridization of Cicer microphyllum. (a) Negative control,

(b) Plant hybridized with biotin labeled cmMET cDNA as probe. 60

12

11. Fold change in transcript abundance of cmMet-2 in different tissues (YS-Young

shoot; MS- Mature Shoot; RT- Root). Error bars indicates SE 61

12. Log fold change in transcript abundance of cmMet-2 in different time interval in

aerial parts in response to cold stress exposure at 4oC. Error bars indicates SE.

62

13. Log fold change in transcript abundance of cmMet-2 in different tissues in

response to cold stress exposure at 4oC for 24 h (fold change is calculated over

the control of same tissue) YS-Young shoot; MS-Mature Shoot; RT-root. Error

bars indicates SE. 63

14. A. Northern blot analysis of cmMet-2 mRNA expression levels in 15 days old

seedlings treated with different concentrations of ABA (Lane a- 10µM ABA,

lane b- 20 µM ABA, lane c- 30 µM ABA and lane d- 50 µM ABA) samples

collected after 24 h. B. Total RNA sample on formamide gel stained with

ethidium bromide. 64

15. A. Northern blot analysis of cmMet-2 mRNA expression levels in 15 days old

seedlingstreated with 100µM PEG (Lane 1- control, Lane-2 stressed tissue for

24 hours). B. Total RNA sample on formamide gel stained with ethidium

bromide. 64

16. A. Northern blot analysis of cmMet-2 mRNA expression levels in 15 days old

seedlings treated with 1.0µM Zinc sulphate (Lane 1- control, Lane-2 stressed

tissue for 24 hours). B.Total RNA sample on formamide gel stained with

ethidium bromide. 65

17. Nucleotide sequence and its translated amino acid sequence of the putative

wound induced gene of Cicer microphyllum 65

18. A. Northern blot analysis of wound induced mRNA expression levels in 15

days old seedlings treated with different time interwals of low temperature

stress. (Lane 1-0 h, lane 2- 3 h, lane 3 -6 h and lane 4- 12 h) B. Total RNA

sample on formamide gel stained with ethidium bromide. 66

13

19. Whole plant in situ hybridization of Cicer microphyllum.

(a) Negative control (b) Positive control hybridized with biotin labeled 26rDNA

sequence as probe (c) Uninduced plant hybridized with biotin labeled wound

induced cDNA as probe (d) Stressed plant (4°C / 24 hours) hybridized with

biotin labeled wound induced cDNA as probe.

67

20. Fold change in transcript abundance of putative wound induced gene during

low temperature stress in different time intervals (0, 6, 12 and 24 h). All values

were normalized with respect to level of house keeping control 26rDNA

expression. Error bars indicates SE. 68

21. Fold change in transcript abundance of putative wound induced gene in

response to SA spray (Mock, 10 and 50 M). All values were normalized with

respect to level of house keeping control 26rDNA expression. Error bars

indicates SE. 69

22. Southern blot hybridization for wound induced gene in Cicer microphyllum

genomic DNA digested with two different restriction enzymes (Lane 1-EcoRI

& lane 2- BamHI). 70

14

INTRODUCTION CHAPTER 1

Cold acclimation protects plants growing in the temperate regions of the world from the

deleterious effects of low and freezing temperatures. Many plant species from temperate

regions have developed sensory mechanisms to sense changes in the environment that signal

in the coming winter, opens the door for the plants to adopt to the change, which lead to an

increased freezing tolerance (FT). The primary environmental factor responsible for increased

FT is exposure to low none freezing temperatures, a phenomenon known as cold-acclimation

(Thomashow, 1999). Many plant species originating from tropical and sub-tropical areas

suffer from injuries when exposed to temperatures above the freezing point but below 15°C,

this is called chilling injury to distinguish it from freezing injury. Visual symptoms of chilling

injury can take a variety of forms, depending on the species, age of the plant, and the duration

of low-temperature exposure. Young seedlings typically show signs of reduced leaf

expansion, wilting, and chlorosis. Extreme cases results in accelerated senescence, a reduced

growth and eventually death. In some plants, the reproductive development is especially

sensitive to chilling temperatures. Exposure of rice plants to chilling temperatures at the time

of anthesis (floral opening) results in sterile flowers. In chilling sensitive plants, major effect

is the physical transition of cell membrane from a flexible liquid-crystalline to a solid gel

phase. This change in physical state of the membrane affects the cellular function in a number

of ways. The most immediate effect is increased permeability leading to cellular leakiness and

ion imbalance. As a consequence of abnormal metabolism, injured cells accumulate toxic

metabolites and active oxygen species (Thomashow, 1999). Many plant species found in the

temperate regions of the world differ from their tropical counterparts in their ability to survive

temperatures below 0°C. Freezing temperatures pose a significant threat to plant survival and

1

15

growth for multiple reasons. Several studies has shown that the membrane systems of the cell

are the primary site of freezing injury in plants (Webb et al., 1994; Steponkus et al., 1998)

and it‟s well established that freezing-induced membrane damage results primarily from the

severe dehydration associated with freezing (Pearce, 2001). As temperature drops below 0°C

ice nucleation generally begins in the intracellular spaces, partly because of a difference in the

solute concentrations leading to a higher freezing point for the intracellular fluid (Thomashow

1999). The chemical potential of ice is less than that of liquid water and therefore the

formation of ice results in a decrease in the water potential outside the cell. As a consequence

the unfrozen water moves from the higher potential in the cell to the lower potential in the

intracellular space. This water movement causes the severe cellular dehydration during

freezing. Most temperate plants can acquire freezing tolerance upon prior exposure to sub

lethal LT stress at temperatures above 0°C, a process called cold-acclimation. Chilling-

sensitive plants from the tropical and sub-tropical regions are incapable of cold-acclimation

and they can not tolerate ice formation in their tissues. Nevertheless, the temperature

threshold for chilling damage is lowered even in some chilling-sensitive crop species by prior

exposures to suboptimal low temperatures (Anderson et al., 1994; Sthapit and Witcombe,

1998), this process is called chilling-acclimation. The molecular basis of chilling-acclimation

is still poorly understood but recent studies shows that it in part is related to the process of

cold acclimation (Rabbani et al., 2003; Usadel et al., 2008). A key function of cold-

acclimation is to stabilize membranes against freezing injury (Webb et al., 1994; Uemura and

Steponkus, 1997) and multiple mechanisms appear to be involved in this stabilization. The

best documented are the changes in lipid composition (Uemura et al., 1995; Uemura and

Steponkus, 1997) but also the accumulation of simple sugars seem to also contribute to the

2

16

stabilization (Strauss and Hauser, 1986). Numerous plants have also been found to possess

antifreeze proteins that are involved in the membrane stabilization during freezing (Yeh et al.,

2000). The underlying molecular mechanisms to these physiological changes there are

extensive in alterations in the expression by a number of cold responsive genes (CORs) (Guy

et al., 1985; Thomashow 1999; Chinnusamy et al., 2007). Much of the injury caused to plants

during LT stress can be associated with reactive oxygen species (ROS), especially in chilling

sensitive plants (O'Kane et al., 1996; Guo et al., 2006). Plants have developed effective

oxygen-scavenging systems consisting of several antioxidant enzymes, such as superoxide

dismutase (SOD), ascorbateperoxidase (APX), glutathione reductase (GR) and catalase (CAT)

and non enzymatic antioxidants, such as ascorbic acid and reduced glutathione. These

antioxidants protect membranes from the deleterious effect of ROS. It has been showed that

chilling tolerant cultivars have higher activities of antioxidant enzymes than susceptible

cultivars in several crops, such as rice and maize (Anderson et al., 1994; Guo et al., 2005).

During both cold- and chilling-acclimation, a plant activates scavenging enzymes, which

helps to detoxify the cell (Apel and Hirt, 2004; Gadjev et al., 2006), which then result in an

increased tolerance to LT stress.

Both modern plant breeders and biotechnologists have exploited plants ability to

survive freezing temperatures with the aim to develop cultivars with increased FT. However

during the past few decades very little work on the improvement of the FT of important crop

species has been done. Revealing the nature of the genetic mechanism behind cold

acclimation and FT will provide potential for new development strategies for freezing tolerant

crops. The main objective of this study was to increase the knowledge underlying genetic

mechanisms of freezing tolerance in plants, with the long-term goal to use these results in the

3

17

development of cold tolerant crops. The primary objective of this research was to identify and

isolate cold tolerant genes from Cicer microphyllum using subtractive hybridization

technology (Dhananjay et al., 2007). Cicer microphyllum is a cold desert legume plant. Cold

deserts are usually confined to high altitudes and circumpolar regions. A total of 16%

landmass is under cold arid zones. Under the trans Himalayan zone the largest cold desert,

Ladakh covers more than 70,000 sq km area of Jammu and Kashmir. High mountains and

barren landscapes determine the harsh climate particularly temperature during winter months,

which fall below -30°C at Leh and -70°C at Dras for about 5-7 months (October to April )

every year. The flora of cold desert Ladakh comes under alpine zones which are situated

between 2700 m-6000 m (Basant et al., 2007). C. microphyllum is widely distributed at

Changthang, Leh, Zanskar and Lahaul-Spiti valleys between 4,230-4,870 m. The whole plant

is used as fodder. The green plant is generally grazed by wild animals especially sheep and

goats and the whole plant is harvested in the month of September and dried properly for

prolonged winter use. It has good protein content about 15.30% which is very much useful for

milch and young animals.

The plant species and methodological approach in this study is very unique and likely

to provide a newer database of low temperature responsive genes with the following

objectives:

Collection of seeds of Cicer microphyllum from Leh region and establishment of

plants inside the laboratory

Preparation of Subtractive cDNA library using both cold acclimated poly (A)+ RNA

and control poly(A)+ RNA and screening of Cicer cDNA library by colony PCR and

dot blot analysis

4

18

Sequencing and sequence analysis of selected clones

Expression analysis of isolated genes in reference to low temperature stress by Real

Time-PCR and whole plant in situ northern hybridization

5

19

REVIEW OF LITERATURE CHAPTER 2

2.1 Cold acclimation

Plants are sessile organisms. Adverse environmental conditions such as salinity, drought,

nutritional deficiency and extreme temperature (high and low) can potentially cause

significant losses to plant productivity and constrain the distribution of some major crops.

Low temperature is one of the most common stresses faced by many plants. The ability of

plants to respond to cold temperatures is an important factor in their ecological and

evolutionary dynamics. Plants vary greatly in their ability to survive freezing temperatures.

Many tropical and subtropical plant species can not tolerate low temperatures and their bio-

geographical distribution is limited. In contrast, every organism has a definite range of

temperature that is optimal for growth process. Above or below this range, normal growth

begins to diminish or more specifically the organism in question of the divergence from the

optimum range begins to show more deleterious consequences. For plants, photosynthesis has

been associated with overall health and vigor (Strand et al., 1999). Net carbon assimilation as

well as respiratory activities is temperature dependent process. The deviation from the

optimum temperature will drive the rates of these basic processes to zero. Under the

conditions that lead to zero net photosynthesis starvation is guaranteed. However this level of

deviation from the optimum temperature may not yet be sufficient to result in an immediate

direct lethal injury during a short term stress, but may require a more extreme temperature or

longer duration of stress. On the basis of low temperature stress tolerance, plants may be

grouped into five different survival profiles. Plants that show injury and/or loss of variability

at temperatures between 0°C and 12°C are considered to be chilling sensitive. A few

examples would include rice (Tajima et al., 1983), corn (Taylor et al., 1974), African violet

6

20

and coffee (Bodner and Larcher, 1987). The next most cold sensitive group is not injured by

exposure to low non freezing temperatures, but is immediately injured or killed when ice

begins to form inside the tissues. The best examples of this group would be the cultivated

potato Solanum tubarosum (Sukumaran and Weiser, 1972) which tolerates non freezing

temperature well, but is damaged by the slightest frost. The next level of hardiness would be

the plants that can withstand ice formation in their tissues, but are killed at high sub zero

temperature (-6°C to -1°C). Example of this group would be Petunia and most members of

the genus Citrus, which are killed at temperature of -3°C to -6°C (Yelenosky and Guy, 1989).

The next hardiness level would be the plant that can, when acclimated, survive in freezing

temperature ranging from -10°C to -30°C. Many of the cereals, temperate herbaceous species

and fruit producing trees fall into this category (Fowler and Gusta, 1979 and Scorza et al.,

1983). The most hardy plants and the last group can survive up to -30°C to -50°C in nature.

Numerous temperate and alpine trees fit into this group and a famous example of this group is

black locust (Robinia pseudoacacia) (Sakai and Yoshida, 1968). Temperate plants have

evolved mechanisms by which they can increase their ability to withstand such low freezing

temperatures after a period of pre-exposure under low but non-freezing temperatures, a

process called cold acclimation (Levitt, 1980). During the cold acclimation process, cold

hardening develops, providing the plant with a tolerance to low temperatures that would be

lethal to an unhardened plant (Howarth and Ougham, 1993). For some perennial plants such

as grape, the combination of declining day length and decreasing temperatures in autumn are

important factors influencing acclimation and cold hardiness (Wample et al., 2000), which is

thought to be a gradual process.

7

21

2.2 Freezing injuries and tolerance mechanisms

2.2.1. Membranes

When exposed to low temperatures, plant cells encounter three main metabolic

constraints: changes in the spatial organization of biological membranes, a retardation of

biochemical and chemical reactions, and alterations in the availability and status of water

(Vezina et al., 1997). Many studies have indicated that membrane disruption is the most

severe injury caused by freezing (Levitt, 1980 and Steponkus, 1984). Ice generally forms in

intercellular spaces, mainly due to lower solute concentration of extracellular fluid and a

higher freezing point (Thomashow, 1999). The lower chemical potential of ice formed

extracellularly is a driving force for the movement of water molecules from inside the cell,

thus causing symplastic dehydration. Freezing injury is regarded to be a consequence of

membrane lesions caused by freeze-induced dehydration (Steponkus, 1984), although other

factors may also contribute to cellular damage (Thomashow, 1999). During thawing, the

water potential gradient is reversed, and the cell‟s cytosol can be rehydrated. This

dehydration/rehydration cycle has significant effects on cellular ultrastructure (Hincha and

Schmitt, 1992). There are three types of damages based on the ways that low temperature

cause to cell membrane. “Expansion-induced lysis”, a process caused by the osmotic

contraction and expansion cycle during freezing and thawing, occurs in non acclimated plants.

“Lamellar-to-hexagonal II” phase transitions are another main injury in non-acclimated

plants, a process involving the fusion of many cellular membranes. “Fracture-jump lesions”

occur due to the low water potential and severe dehydration due to extreme freezing

(Steponkus et al., 1993). In addition membrane lesions, many loosely bound, peripheral

membrane proteins are released during freezing under injurious conditions (Volger et al.,

8

22

1978; Hincha and Schmitt, 1985), thus causing negative effects to cellular metabolism. The

presence of centrally positioned cis double bonds in the membrane lipid lowers the phase

transition temperature to approximately 0°C. Thus by introducing enzymes capable of

catalyzing the formation of cis-double bonds in saturated fatty acids, a chilling resistant

phenotype could theoretically be achieved. This hypothesis has been tested in two reports

(Kodama et al., 1994). Tobacco expressing ω-3 fatty acid desaturase had increased amount of

dienoic and trienoic fatty acids, and consequently also had enhanced chilling resistance. A

broad specificity Δ9-desaturase gene (Des 9) from the cyanobacterium Anacystis nidulans

was also introduced into Tobacco (Ishizaki, 1996). This enzyme introduce a cis double bond

in specific saturated fatty acids in various membrane lipids and thus improves membrane

stability during low temperature stress and supports the plant during the stress.

2.2.2. Oxidative stress

At low temperatures, the balance between photosynthetic energy conversion and

consumption is disrupted. When temperature is declined, the ability of the plant to utilize

captured light energy is substantially reduced, while the energy absorption and electron flow

are less retarded, thus resulting in extra energy which can react with O2 to produce 1O2,

hydrogen peroxide, and superoxide radicals O2 –

(Asada, 1994; Prasad et al., 1994; Fadzillah

et al., 1996; O'Kane et al., 1996; Foyer, 1997), which damage cellular components (Elstner,

1991; McKersie, 1991). Acclimation to low temperature may be partly related to an enhanced

antioxidant system that would prevent the accumulation of these ROS (Prasad, 1996).

Different plant species have evolved different mechanisms to cope with low temperature

related oxidative stress. Under natural conditions, low temperature induced accumulation of

glutathione (GSH) has been observed in spruce (Picea abies L.) and white pine (Pinus strobes

9

23

L.) during winter (Esterbauer and Grill, 1978; Anderson et al., 1992). Under experimental

conditions, GSH was also found to be induced in response to low temperature in soybean,

squash and wheat (Vierheller and Smith, 1990; Wang, 1995; Kocsy et al., 2000). It also has

been found that chilling tolerant plants increase endogenous polyamine (PA) levels in

response to chilling to a much greater extent than chilling-sensitive ones (Guye et al., 1986;

Lee, 1997; Shen et al., 2000). In a chilling sensitive cucumber cultivar, pretreatment of leaves

with PA alleviated chilling injuries, while in a chilling tolerant cucumber cultivar,

pretreatment of leaves with PA synthesis inhibitor enhanced chilling injuries. The primary

function of PA is probably inhibition of chill-induced activation of microsomal NADPH

oxidase and consequential ROS generation (Shen et al., 2000).

Because of their polycationic nature at physiological pH, PA can bind strongly to

negatively charge cellular components such as nucleic acids, proteins, and phospholipids.

Interactions of PAs with membrane phospholipids may stabilize membranes under conditions

of stress (Smith, 1985; Roberts et al., 1986). In addition to the above responses to deal with

the oxidative stress under low temperature, plant cells can synthesize lipid-soluble

antioxidants (tocopherol and β-carotene), water-soluble reductants (ascorbate and glutathione)

and enzymes such as superoxide dismutase (SOD; EC 1.15.1.1), catalase (CAT; EC 1.11.1.6),

ascorbate peroxidase (APX; EC 1.11.1.11), and glutathione reductase (GR; EC 1.6.4.2)

(Zhang et al., 1995). These enzymes have important roles in detoxification of ROS. For

instance, SOD can catalyze dismutation of superoxide to hydrogen peroxide and molecular

oxygen (Bowler et al., 1992). Transgenic plants overexpressing SOD have exhibited

enhanced tolerance to oxidative stress (Bowler et al., 1991 and Perl et al., 1993). Sen Gupta et

al., (1993) transformed a Cu-Zn-SOD from pea to tobacco and found that the photosynthetic

10

24

rates of transgenic tobacco plants were approximately 20% higher than non transformed

plants when subjected to chilling temperature with moderate light intensity. The Mn-SOD

cDNA from Nicotiana plumbaginifoli has been introduced into Alfalfa (Mckersie et al., 1993).

Through the use of two different transit peptides, the Mn-SOD was expressed followed by a

three year field trial which indicated that yield and survival of the transgenic plants were

improved significantly. Mn-SOD has also been expressed in both chloroplast and

mitochondria of transgenic Tobacco (Van camp et al., 1996). Ozone was used to evaluate the

transgenics against the ambient oxidative stress. Transgenic plants in which Mn-SOD was

expressed in chloroplasts demonstrated a three fold and two fold reductions in leaf injury as

compared with wild type and transgenic with Mn-SOD expressed in mitochondria

respectively. Mn-SOD functions to minimize the deleterious accumulation of active oxygen

and the enhanced SOD enzymatic activity may enable the injury to be contained within a few

cells (McKersie et al., 1993).

Another of the SOD isozyme, Fe-SOD from Arabidopsis, has also been expressed in

transgenic Tobacco (Van camp et al., 1996), when targeted to the chloroplast, this enzyme

protected both the plasmalemma and photosystem II against superoxides generated during

illumination of leaf discs impregnated with methyl viologen by scavenging radicals.

An interesting approach for increasing stress tolerance relies on the expression of

glutathione reductase (GR) and Cu, Zn-SOD, both separately and together in the cytosol of

transgenic Tobacco (Aono et al., 1995). The tolerance was assed by using a superoxide

generating herbicide paraquat followed by measuring electrolyte leakage. The GR/Cu,Zn-

SOD expressing plants exhibited less damage than wild type. These results show that both GR

and SOD play crucial roles in protection of plants from oxidative stress, and thus also from

11

25

abiotic stress.

2.3. Influence of low temperature on gene expression

2.3.1. Lipid composition

Lipids are among the basic constituents of bio-membranes, have been a focus of

attention since the 1960s as one of the factors affecting temperature sensitivity (Quinn &

Williams 1983).The lipid composition of the plasma membrane has to be changed under low

temperatures in order to maintain membrane integrity and membrane associated protein with

proper function. For example the physiochemical characteristics displayed by lipids bilayer at

different temperatures differ with the species of the lipid head group of their esterified fatty

acids, and their lipid constituents change depending on the environmental temperature

(McConn et al., 1994; Smolenska and Kuiper 1977 and Willemot et al., 1977). In rye

seedlings, the ratio of unsaturated phosphatidylcholine and phosphatidyl ethanolamine

increased upon cold acclimation (Lynch and Steponkus, 1987). Increased unsaturation of the

membrane lipids in response to low temperature was also observed in cyanobacteria (Sato and

Murata 1980). Since the late 1980s, a series of mutant strains with altered fatty acid

constituents in their bio-membranes have been isolated in Arabidopsis, providing a break

through in the clarification of the pathways by which the polyunsaturated fatty acids

contained in bio-membrane lipids are generated (Somerville et al., 1991). In the 1990s,

cloning of the mutated genes one after other, using genetic approaches (Arondel, 1992; Iba,

1993; Gibson, 1994; Hitz, 1994; and Okuley et al., 1994) became possible, and useful

information such as structure of the enzymes in the biosynthetic pathway for membrane lipids

became available (Shanklin and Cahoon 1998). The creation of transgenic plants by

transferring these genes also allowed the targeted modifications of the fatty

12

26

acid constituents of the bio-membrane lipids and enabled the physiological significance of

bio-membrane lipids in temperature acclimatization to be clarified more directly (Hamada et

al., 1998; Kodama et al., 1994, 1995; Moon et al., 1995; Murakami et al., 2000; Murata et al.,

1992). The increased unsaturation of membrane lipids might be due to the up-regulation of

desaturase genes under cold stress (Los et al., 1993; Sakamoto and Bryant, 1997). In addition

to the abundant information devoted to lipid membrane composition in response to low

temperature, research also indicated that the membranes of individual cellular compartments

could experience a similar modification upon temperature stress. In Brassica napus, the

content of the unsaturated fatty acid, linolenic acid (18:3) in the endoplasmic reticulum (ER)

membrane increased about two fold upon exposure to low temperature, but the oleate

desaturase and linoleate desaturase genes were only transiently regulated in response to low

temperature. This suggests that enhanced translation or enhanced enzymatic activities are

involved in ER lipid composition changes in response to cold (Tasseva et al., 2004). In green

alga, the percentage of membrane polyunsaturated fatty acids was higher in winter time than

in summer time. This increase in the degree of unsaturation might be important for green alga

in order to decrease their threshold of low temperature survival and acclimate net

photosynthesis and dark respiration rates to winter temperatures (Terrados and Lopez-

Jimenez, 1996).

2.3.2. Heat shock proteins (HSPs)

The heat shock response is a reaction caused by exposure of an organism, tissue or

cells to sudden rise in normal temperature and characterized by transient expression of certain

proteins known as heat shock proteins. The primary protein structure for HSPs is well

conserved in organisms ranging from bacteria and other prokaryotes such as higher animals

13

27

and plants. Previously it is thought to be closely involved in the protection of the organism

against heat shock and maintenance of homeostasis (Morimoto et al., 1994). HSPs are

induced not only by high temperature but also by other stresses such as cold, drought, or

salinity (Anderson et al., 1994 and Coca et al., 1994). HSPs belongs to a group of proteins

induced by environmental stress either to protect the plant from damage or to help repair

damage caused by the stress. There is very likely some overlap in function among the

different stress proteins since one stress can induce protection against another (Lurie et al.,

1994; Leshem and Kuiper, 1996). In tomato, the expression of two heat shock-induced

proteins, tom66 and tom111, was found to be first decreased then increased in response to low

temperature. A clear correlation between the induction of these two genes and low

temperature tolerance of the tissue was found (Sabehat et al., 1998). A similar mechanism of

heat-shock-induced tolerance to chilling injury may exist in all plant tissues. Protection

against chilling injury by high-temperature treatment has been found in mung bean

hypocotyls (Collins et al., 1995) and cucumber cotyledons and seeds (Lafuente et al., 1991;

Jennings and Saltveit, 1994). In these studies loss of protection was correlated with the

disappearance of HSPs from the tissue (Lafuente et al., 1991; Collins et al., 1995). The

function of heat shock protein is related to their molecular chaperon characteristics. Heat

shock proteins can stabilize native proteins (Anderson and Guy, 1995), refold stress-denatured

proteins (Gaitanaris et al., 1990) and prevent aggregation of denatured proteins (Ellis and

VanderVies, 1991). Many members of the hsp70 family were found to be up-regulated in

response to both heat shock and low temperature in tomato and spinach. HSP70 has the most-

conserved primary protein structure across different species. HSP70 is thought to interrupt the

interaction within and between protein molecules, for example, to facilitate their membrane

14

28

transport, to bind to the ER, or to prevent the aggregation of denatured proteins. These

functions are ATP dependent, and there are indications, even in plants, for an intrinsic

ATPase activity of HSPs (Mierynyk and Hayman 1996). In transgenic Arabidopsis,

transformed with the heat-shock inducible antisense gene for HSP 70, repression of

endogenous heat-induced HSP 70 resulted, and a lowering of thermo tolerance was observed

in the leaf tissues (Lee et al., 1995). HSP 100 and HSP 90 are also suspected to function as

chaperones, although there is little direct evidence related to temperature stress in plants.

However, studies of Arabidopsis (Hong and Vierling 2000, 2001) have been reported in

which a mutant, hot1, lacking HSP101, showed a susceptibility to high temperatures. Apart

from heat shock, there are also HSPs induced by osmotic and salt stress, stress from low

oxygen, dinitrophenol (DNP), arsenic compounds, other chemical agents, and plant hormones

such as abscisic acid and ethylene. They might play a specific role in the denaturation of

proteins, the prevention of that denaturation, and the repair function, as part of the

physiological responses to diverse environmental stresses. It has been reported, for example,

that salt and drought tolerance improves when the HSP gene is overexpressed in Tobacco

(Sugino et al., 1999) and in Arabidpsis (Sun et al., 2001).The timing of the increased up-

regulation of heat shock proteins is consistent with the hypothesis that protein biogenesis or

protein conformation are adversely affected by low temperatures (Li et al., 1999), indicating a

possible role associated with heat shock proteins.

2.3.3. Antifreeze proteins (AFPs)

Antifreeze proteins are found in a wide range of overwintering plants and located in

the apoplast where they inhibit the growth and recrystallization of ice that forms in

intercellular spaces. During cold acclimation, the accumulations of AFPs are correlated with

15

29

increased freeze tolerance in rye, wheat, and barley (Marentes et al., 1993; Antikainen and

Griffith, 1997). When AFPs bind to the surface of ice, they adsorb irreversibly onto a specific

plane of the crystal lattice (Knight et al., 1991; Knight et al., 1995). Specific activities of

AFPs include changes in ice crystal shape, thermal hysteresis, or inhibition of ice

recrystallization, which varies among overwintering organisms and could be related to their

freezing strategies (Griffith and Yaish, 2004). Ice crystals grown in water or in a solution of

substances that do not interact with ice are disc-shaped. By contrast, most AFPs bind to the

prism face of ice, creating hexagonally shaped crystals (Griffith and Yaish, 2004). At high

concentrations, AFPs depress the freezing temperature of a solution noncolligatively without

affecting the melting temperature, a process known as thermal hysteresis (DeVries, 1986).

Antifreeze proteins are frequently synonymous with the thermal hysteresis proteins (THPs).

Most of the fish anti freeze proteins show modest hysteresis (Burcham et al., 1986). Many

plant biologists considered that plants would not derive significant benefits from AFPs that

could only arrest ice formation over a very narrow temperature range. This how ever changed

with the discovery of THPs in plants (Griffith et al., 1992; Urrutia et al., 1992). In bittersweet

nightshade, a thermal hysteresis protein gene (STHP-64) was isolated and found to contain 10

consecutive 13-mer repeats at its C-terminus, a common feature of animal antifreeze proteins.

Northern blots demonstrated that the STHP-64 transcript was not present in leaves until

November and December, suggesting that cold acclimation induces STHP-64 production

(Huang and Duman, 2002). At low concentrations, AFPs can inhibit the recrystallization of

ice (Knight et al., 1984), which is the growth of larger ice crystals at the expense of smaller

ice crystals. Larger ice crystals increase the possibility of physical damage within frozen plant

tissues (Griffith et al., 1997). Two AFPs (TaIRI-1 and TaIRI-2) were identified to be up-

16

30

regulated in wheat in response to low temperature. TaIRI-1 protein was found to be able to

inhibit the growth of ice crystals (Tremblay et al., 2005). Amino-terminal sequence

comparisons, immuno-cross-reactions, and enzymatic activity analysis of AFPs in winter rye

showed similarity between AFPs and pathogenesis-related (PR) proteins (Hon et al., 1995).

Because the AFPs retain their enzymatic activities, they may also have antifungal properties

that are important in disease resistance, particularly against low-temperature pathogens such

as snow molds (Ergon et al., 1998; Hiilovaara-Teijo et al., 1999). In an interesting twist, a

protein from carrot was found to be associated with antifreeze proteins (Worrall et al., 1998).

When the carrot protein was expressed in transgenic Tobacco plant, the protein retained

antifreeze properties in that it inhibited the recrystalline process. In addition, the AFPs

accumulated in cold acclimated plants in mesophyll cell walls, secondary cell walls of xylem

vessels and epidermal cell walls (Griffith et al., 1997). It appears that low temperature

specific forms are localized and accumulated in response to low temperature in the ways that

reflect a potential common pathway for ice and pathogens to enter the tissue. Apparently

accumulation of AFPs during cold acclimation is a relatively specific response and not

general for all plants. In an unexpected manner, Xu et al., (1998) found that Rhizobacterium,

Pseudomonas putida GR12-2 produces and antifreeze protein that is secreted into the growth

medium. When purified, the protein was found to have properties similar to the bacterial ice

nucleation protein (Wolber et al., 1986). It appears that this protein also has low amount of ice

nucleation activity, which seems paradoxical for the AFPs.

2.3.4. Dehydrins

Dehydrin, also known as a group-2 late embryogenesis abundant (LEA) protein, is one

of several ubiquitous water-stress-responsive proteins in plants (Ingram and Bartels, 1996).

17

31

Dehydrins are highly hydrophilic, glycine-rich and boiling-stable proteins. They possess

repeated sequence structures containing lysine-rich motifs which are speculated to form

putative amphiphilic α helices. Dyhydrins are thought to bind to membranes and cellular

proteins by hydrophobic interactions, and thus protect the functions of intracellular molecules

by preventing their coagulation during symplastic dehydration (Close, 1997). These proteins

may accumulate during drought, salinization, late stages of seed development, freezing and in

response to exogenous ABA (Close et al., 1993; Welin et al., 1994; Campbell and Close,

1997; Close 1997). Many dehydrins have been isolated and characterized not only in

herbaceous plants but also in several woody species including Prunus persica (Arora and

Wisniewski, 1994), birch (Rinne et al., 1999), blueberry (Muthalif and Rowland, 1994) and

citrus (Hara et al., 2001). CuCOR19, a dehydrins isolated from Citrus unshiu, showed

cryoprotective activities for lactate dehydrogenase (LDH) and catalase. The protective role of

the CuCOR19 protein is thought to be related to its random coil structure, which can form a

layer cohesive to other structures. Low temperatures can denature the association of some

enzymes irreversibly. The binding of the coil structure in the CuCOR19 could prevent the

disassociation of the enzymes. In addition to its cryoprotective role, CuCOR19 can bind water

molecules which might be necessary to maintain water in the cell during symplastic

dehydration (Hara et al., 2001). PCA60 is a dehydrin isolated from winter bark tissue of

peach (Wisniewski et al., 1999). The extracted protein was shown to preserve the in vitro

enzymatic activity of lactate dehydrogenase during repeated freeze-thaw cycles. Another

surprising characteristic of this dehydrin is its antifreeze activity shown by its involvement

with ice crystal morphology and thermal hysteresis (Wisniewski et al., 1999). In addition to

their water-binding, macromolecule-stabilizing, and cryoprotective activities, at least one

18

32

report showed that dehydrins may be involved in free radical scavenging (Hara et al., 2003).

The overexpressed citrus dehydrin CuCOR19 in tobacco causes an increase in the cold

tolerance ability of transformed plants. Further analysis correlated this cold tolerance

enhancement to the antioxidative activity imposed by the expressed protein (Hara et al.,

2003). Another notable work about dehydrin was done by Puhakainen et al., (2004) in

Arabidopsis. Chimeric double constructs with dehydrins RAB18 and COR47 or LTI29 and

LTI30 were introduced into Arabidopsis and resulted in increased accumulation of related

dehydrin proteins. Compared to control plants, transgenic plants have more tolerance to cold

temperature, and this increased resistance to cold temperature was speculated to be partly due

to their protective role of cell membranes (Puhakainen et al., 2004).

2.3.5. Compatible solutes

Under environmental stresses including salinity, drought and low temperature

conditions, plants can accumulate certain organic metabolites of low molecular weight known

collectively as compatible solutes (Bohnert et al., 1995). Compatible solutes mainly include

polyhydroxylated sugar alcohols, amino acids and their derivatives, tertiary sulphonium

compounds and quaternary ammonium compounds (Bohnert and Jensen, 1996). The main

functions of compatible solutes involve membrane protection (Rudolph and Crowe, 1985),

cryoprotection of proteins (Carpenter and Crowe, 1988), maintenance of osmotic potential

(Yancey et al., 1982), and scavenging of free radicals (Smirnoff and Cumbes, 1989). The

levels of proline and sucrose increase in Arabidopsis (McKown et al., 1996), and spinach

(Guy et al., 1992) during cold acclimation. The increase in synthesis of proline and sucrose

might be associated with freezing tolerance enhancement (Stitt and Hurry, 2002). The stress

tolerance ability of Arabidopsis was increased by the suppression of proline dehydrogenase,

19

33

an enzyme to catalyze the proline degradation, with its antisense cDNA (Nanjo et al., 1999),

further demonstrating the protective role of proline during cold acclimation. In comparison of

three wheat cultivars with different cold tolerance ability, the accumulation of sugars, amino

acids and glycine betaine were the highest in the most cold tolerant cultivar, the lowest in the

most cold sensitive cultivar (Kamata and Uemura, 2004). In Arabidopsis, levels of

endogenous glycine betaine in the leaves were found to be greatly induced in response to cold

acclimation, water stress and exogenous ABA application, indicating the involvement of

glycine betaine in cold acclimation and water stress (Xing and Rajashekar, 2001). The

relationship between sugar content and freezing tolerance was investigated in cabbage.

Concentration of sucrose, glucose, and fructose gradually increased during cold acclimation.

However, the induced freezing tolerance was lost after only 1 day of deacclimation at control

temperatures, and this change was associated with a large reduction in sugar content (Sasaki

et al., 1996). Genetic engineering to increase levels of some compatible solutes, such as

mannitol and proline has proven to be a promising approach to increase the ability of plants to

tolerate environmental stress (Hayashi and Murata, 1998).

2.4. Regulation of cold acclimation

2.4.1. ABA-dependent and ABA-independent pathway

Several cold responsive genes have been identified and characterized in Arabidopsis.

These genes were designated as COR (cold-responsive or regulated), LTI (low temperature

induced), KIN (cold inducible), RD (responsive to desiccation), and ERD (early response to

dehydration) (Thomashow, 1994). Studies have shown that the promoter of some of these

genes has a core sequence “CCGAC” designated as CRT (C-repeat) or DRE (dehydration

responsive element) (Baker et al., 1994; Yamaguchi-Shinozaki and Shinozaki, 1994). A

20

34

family of transcription factors in Arabidopsis known either as C repeat- binding factor (CBF1,

CBF2, and CBF3) (Stockinger et al., 1997; Gilmour et al., 1998) or dehydration-responsive

element-binding factor (DREB1B, DREB1C, and DREB1A) (Liu et al., 1998) have been

identified. These transcription factors can bind to the cis element and activate the transcription

of the down stream cold responsive or dehydration responsive genes. Transgenic over

expression of the CBF/DREB gene in other plants turns on the expression of down stream

cold responsive genes without cold acclimation and can increase the low temperature

resistance ability (Jaglo-Ottosen et al., 1998; Liu et al., 1998). Since CBF transcripts begin

accumulating within 15 min of plants' exposure to cold, Gilmour et al., (1998) proposed that

another transcription factor constitutively exists, which can bind to the cis element of CBF

gene under cold stimulus. Gilmour et al., (1998) named the unknown activator(s) "ICE"

(inducer of CBF expression) protein(s). This ICE gene has been identified by another group

and was found to encode a MYC-like bHLH (helix loop helix) transcription factor. ICE is a

positive regulator of CBF3 and has a critical role in cold acclimation (Chinnusamy et al.,

2003). CBF3 promoter includes five putative MYC recognition sequences, while CBF1 and

CBF2 only includes one (Shinwari et al., 1998). The ice1 mutation abolishes CBF3

expression, and reduces the expression of CBF-target genes in the cold (Chinnusamy et al.,

2003). Although ICE has a strong effect on the regulation of CBF3, it only slightly affects the

induction of CBF2 and CBF1. Actually, the expression of CBF2 is enhanced in the ice1

mutant after 6 and 12 h of cold treatment (Chinnusamy et al., 2003). The potential negative

regulation of the CBF transcription factor genes may be important for ensuring that their

expression is transient and tightly controlled (Novillo et al., 2004). Novillo et al., (2004)

found a CBF2/DREB1C Arabidopsis mutant with a higher capacity to tolerate freezing than

21

35

wild type plants before and after cold acclimation and higher tolerance to dehydration and salt

stress. The increased cold tolerance was due to the enhanced expression of the

CBF1/DREB1B and CBF3/DREB1A and the downstream regulated COR genes. These results

indicate that CBF2/DREB1C negatively regulates CBF1/DREB1B and CBF3/DREB1A,

ensuring that their expression is transient and tightly controlled (Novillo et al., 2004). In

addition to the CBF/DREB signaling pathway in plant cold acclimation, there is evidence that

multiple pathways may be involved in the acclimation process. Analysis of the eskimo1 (esk1)

mutant of Arabidopsis revealed that considerable freezing tolerance can be achieved in the

absence of COR gene expression (without CBF/DREB signaling activation) (Xin and Browse,

1998). Studies from the analysis of sensitive-to-freezing (sfr) mutants that are not able to fully

acclimate also support the theory that CBF/DREB is not the only signaling pathway for plant

cold acclimation. sfr mutants do not fully cold acclimated, and only retain about 50% of the

wild-type capacity for cold acclimation, which means that the sfr mutation blocks some

signaling pathway. Therefore, each mutant is still able to partially cold acclimate through

signaling pathways that are not disrupted (Warren et al., 1996).

Expression of genes in response to low temperature is thought to be regulated by both

ABA-dependent and ABA-independent signalling pathways. In Arabidopsis, ABA synthesis

mutants, aba1 or abi, are less freezing tolerant than wild-type plants (Heino et al., 1990;

Gilmour and Thomashow, 1991). The expression of many genes has been reported to be

associated with ABA (Shinozaki and Yamaguchi-Shinozaki, 2000; Ramanulu and Bartels,

2002). The analysis of the promoter region of these ABA responsive genes reveals that many

of the genes contain a fragment of (C/T) ACGTGGC consensus sequence, generally known as

“ABA-responsive element (ABRE)” (Busk and Pages, 1998; Rock, 2000). bZIP transcription

22

36

factors are likely to bind to these elements in cold regulated genes and activate gene

expression (Thomashow, 1999). Contrary to the involvement of ABA in the changes of

expression of specific genes, some genes are not dependent on ABA regulation. In the aba1

mutant, cold induced expression of COR78, COR47, and COR6.6 is normal (Gilmour and

Thomashow, 1991). Thus, authors proposed that cold regulated expression of these genes

occurs through an ABA-independent pathway. The important CBF/DREB transcription factor

and its regulon are also not changed in response to exogenous ABA, further pointing to the

existence of the ABA-independent regulation pathway under cold acclimation (Yamaguchi-

Shinozaki and Shinozaki, 1994). In moss Physcomitrella patens, ABA treated cells had

slender chloroplasts and reduced amount of starch grains. When frozen to -4°C, freezing

injury associated ultrastructural changes such as formation of particulate domains and

fracture-jump lesions were frequently observed in the plasma membrane of non-treated

protonema cells but not ABA-treated cells. The ABA treated cells also had higher

accumulation of free soluble sugars (Nagao et al., 2005). In another work from the same

group, surprisingly, determination of ABA content by GC–MS revealed that low-temperature

treatment did not increase accumulation of ABA, but that levels of freezing tolerance

increased. These results suggest that P. patens does not require increases in levels of ABA for

cold acclimation and possesses an ABA independent cold-signaling pathway leading to the

development of freezing tolerance (Minami et al., 2005). Whether and how ABA relates to

the activation of expression of cold responsive genes is still not clear. A clear conclusion

about ABA‟s function in environmental stresses beyond its traditional function in plant

development and growth requires a total understanding of the cold acclimation mechanisms

23

37

and whether ABA plays a critical role in regulating the activity of the mechanisms

(Thomashow, 1999).

The first evidence of an ABA-independent pathway during cold stress came from

studies of the RD29A/COR78/LTI78 gene in Arabidopsis. RD29A/COR78/LTI78 is induced

by cold, drought and ABA (Yamaguchi-Shinozaki and Shinozaki, 1993). However, this gene

is also induced in ABA-deficient and ABA-insensitive mutants by both cold and drought

stresses, which indicates that RD29A/COR78/LTI78 is under control of both ABA dependent

and ABA independent pathways (Gilmour and Thomashow, 1991). Analyses of the

RD29A/COR78/LTI78 promoter revealed a 9-bp conserved sequence, TACCGACAT, named

the dehydration response element (DRE), and were essential for induction of dehydration or

ABA response (Yamaguchi-Shinozaki and Shinozaki, 1994). A similar cis acting element,

named C-repeat (CRT) or LT responsive element (LTRE), containing A/GCCGAC motif that

forms the core of the DRE sequence, have been shown to regulate LT inducible promoters in

Arabidopsis (Baker et al., 1994; Stockinger et al., 1997), Barascica (Jiang et al., 1996), rice

(Rabbani et al., 2003) and wheat (Takumi et al., 2003).

The transcription factors that interact with the CRT/DRE element are the C-repeat

Binding Factor/DRE Binding protein 1 (CBF/DREB1), which first was found in a yeast one-

hybrid screen by Stockinger et al., (1997). Arabidopsis contains three CBF encoding gene,

namely, CBF1, CBF2, and CBF3, all present in tandem on chromosome 4, and they are

rapidly induced by LT (Stockinger et al., 1997; Gilmour et al., 1998; Liu et al., 1998;

Shinwari et al., 1998). All these transcription factors contain an AP2/ERF

(APETALA2/Ethylene Responsive element binding Factor) DNA-binding domain that

recognise CRT/DRE elements, which are present in many COR genes, and they belong to the

24

38

AP2/ERF superfamily of transcription factors. Analyses in transgenic plants have shown that

ectopic expression of CBF/DREB1 genes is sufficient to activate expression of many COR

genes and thereby induce cold acclimation even at warm temperature (Gilmour et al., 2000;

Maruyama et al., 2004; Vogel et al., 2005). Thus, the CBF/DREB1 transcription factors

belong to a master switch that controls the expression of many important COR genes. Global

expression studies of transgenic Arabidopsis plants with ectopic expression CBF1, CBF2 or

CBF3 revealed that there is a large, if not complete, overlap in the regulons of genes

controlled by the various CBFs/DREB1 (Fowler and Thomashow, 2002). Vogel and co-

workers (2005) based on expression studies in Arabidopsis identified 514 cold responsive

genes, referred to as COS („cold standard‟) and by using ectopic overexpression of CBF2,

concluded that 16.5 % of the cold inducible COS genes fall under the control of the

CBFs/DREB1 regulon. CBF/DREB1 genes whose transcripts accumulate rapidly in response

to low temperatures have been isolated in rapeseed, tomato, rye, wheat, barley, rice, oat, and

many other plants species(Jaglo et al., 2001; Dubouzet et al., 2003; Zhang et al., 2004;

Brautigam et al., 2005; Skinner et al., 2005; Ito et al., 2006). It therefore appears that the

CBF/DREB1 pathway is partly conserved in flowering plants. Interestingly, the promoters of

CBF/DREB1 genes themselves do not contain any CRT/DRE elements. This led Gilmour et

al., (1998) to speculate about the existence of unidentified factors; called ICE (for Inducer of

CBF Expression) which presumably recognized novel cold regulatory elements, or "ICE

boxes," present in the CBF/DREB1 promoters. According to their model, ICE was present but

inactive in plant cells at warm temperatures and was activated upon transfer to low

temperature, in turn, rapidly activating CBF transcription. Chinnusamy et al., (2003)

presented the first evidence of the existence of ICE, namely ICE1. ICE1 were a MYC-type

25

39

basic-helix-loop helix transcription factor that was constantly expressed and it could bind to a

MYC target in the CBF promoter. They also showed that a mutated ice1 failed to induce CBF3

under cold acclimation and it was hypersensitive to freezing. On the other hand,

overexpression of ICE1 enhanced expression of CBF3, CBF2 and down stream COR genes,

but only during LT stress. This suggested that LT stress posttranslational modification is

necessary to activate ICE1. Recently, there was also a report about a ICE2 in Arabidopsis

(Fursova et al., 2009) and a homolog to ICE1 in barley (Skinner et al., 2006). In Arabidopsis

many transcription factor genes are transiently induced during LT stress (Fowler and

Thomashow, 2002), which suggests a feedback regulation mechanism. Molecular analysis of

a cbf2 mutant in Arabidopsis suggests that CBF2 is a negative regulator of CBF1 and CBF3

(Novillo et al., 2004). Further more, CBF genes are negatively regulated by an upstream

transcription factor, MYB15 (a member of R2R3- MYB family) in Arabidopsis (Agarwal et al.,

2006). MYB15 is also expressed in the absence of LT stress and MYB 15 binds to MYB

recognition sites in the promoters of CBFs. Also a LT induced C2H2 zinc finger transcription

factor ZAT12, seems to function as a negative regulator of CBF (Vogel et al., 2005). ZAT12 is

under control of the circadian clock and is out of phase with the rhythm of CBF2 (Fowler et

al., 2005). Transgenic overexpressions of ZAT12 decrease expression of CBF under cold

stress (Vogel et al., 2005). Although, CBF/DREBl regulon is a key component for a

successful cold acclimation there have been reports about other important players. One such

example is the ESKl mutant in Arabidopsis, which is constitutively freezing tolerant but did

not affect the expression of genes in the CBF/ DREB1 regulon (Xin and Browse, 2000).

26

40

2.4.2. Participation of Calcium in cold acclimation

The elevation of cytosolic Ca2+

is an early event in the response LT stress. Our

knowledge of these cytosolic Ca2+

oscillations comes from transgenic studies in Arabidopsis

and Tobacco (Knight et al., 1991). Cytosolic Ca2+

oscillations can be detected within seconds

or min after the transfer of the plants to LT and they are associated with membrane

depolarization. Furthermore, they have characteristic waveforms that are dependent on both

magnitude and absolute temperature of the temperature shift (Knight et al., 1996; Plieth,

1999). The magnitude of the Ca2+

oscillation is also dependent of the plant‟s previous

experience of temperature stress, repeated low temperature treatment results in a damped Ca2+

oscillation, which implies that plants appear to have a Ca2+

signature memory of earlier

temperature experiences. It has been shown that there is a positive correlation between cold-

induced cytosolic Ca2+

influx and accumulation of COR genes in both alfalfa (Monroy and

Dhindsa, 1995) and Arabidopsis (Henriksson and Trewavas, 2003). Different chelators and

channel blockers have been used to show the role of Ca2+

as second messenger in cytosolic

influx in cold-responsive signal transduction (Monroy et al., 1993; Knight et al., 1996). It is

also observed that effective Ca2+

signatures are produced only in particular tissue or organs.

During LT stress the cytosolic Ca2+

influx occurs in the whole plant, in contrast to drought,

where it is present only in roots (Knight and Knight, 2000). If the plant fails to control the

Ca2+

oscillation it will lead to prolonged elevated levels of cytosolic Ca2+

, which can be toxic

for the cells. Experiments have shown that chilling sensitive maize is unable to restore the

lower resting levels of intracellular Ca2+

after low temperature influx, while freezing tolerant

wheat quickly do so (Jian et al., 1999). This observation has been suggested to partly explain

the incapacity among chilling sensitive plants to cope with longer periods of cold stress, since

27

41

prolonged periods with elevated levels of cytosolic Ca2+

is suggested to cause ROS

accumulation, metabolic dysfunction, and structural damage to the cell. Cytosolic Ca2+

signal

is transmitted primarily through Ca2+

regulated proteins called calcium sensors, which change

their phosphorylation status when they sense the elevation in Ca2+

(Monroy et al., 1993). The

major calcium sensors in plants are calmodulin (CaM), CaM domain-containing protein

kinases (CDPKs), calcineurin B-like proteins (CBLs) and CBL interacting protein kinases

(CIPKs). Many CDPKs are up regulated by cold stress in different plant species. Monroy and

co-workers used antagonists and inhibitors of CDPK and CaM and showed that alfalfa cells in

suspension culture were inhibited in their ability to cold acclimate (Monroy et al., 1993).

Similar results have also been showed in Arabidopsis (Tahtiharju et al., 1997). Kim and co-

workers identified a Ca2+

regulated protein kinase in Arabidopsis, CIPK3, and they used a

mutant, cipk3, to study this protein during abiotic stress (Kim et al., 2003). The authors

showed that CIPK3 mediates the Ca2+

signal and positively regulates the ABA and cold

induced expression of stress related genes. They also suggest that CIPK3 is working as a

cross-talk node between the ABA and cold signal transduction, because disruption of CIPK3

function simultaneously alter the gene expression induction pattern of RD29A by ABA, salt,

and cold treatments. This is an interesting result since the cold induced expression of RD29A

previously has been shown to be independent of ABA (Thomashow, 1999; Shinozaki and

Yamaguchi-Shinozaki, 2000). The over expression of CIPK genes in rice have also confirmed

improved tolerance to cold, drought and salt stress (Xiang et al., 2007).

Mitogen activated protein kinase (MAP kinase) cascades are also involved in cold

stress signalling. The activities of MAP kinases have been shown to increase at low

temperature and this activity increase could also bee observed during drought stress in both

28

42

alfalfa and Arabidopsis (Jonak et al., 1996; Mizoguchi et al., 1996). Similarly, Teige and co-

workers identified the map kinase MKK2 in Arabidopsis as an important mediator of the cold

and salt stress signals. The defective MKK2 plants were hypersensitive to freezing and

germination on salt media, while MKK2 overexpressers showed enhanced freezing and salt

tolerance (Teige et al., 2004).

As a result of cold stress there is also an oxidative burst due to the generation of ROS

like superoxide, hydrogen peroxide (H2O2) and hydroxyl radicals. These oxidative bursts

induce synthesis ROS scavenger enzymes and other protective mechanism (Apel and Hirt,

2004; Mittler et al., 2004). The mechanism by which plants are able to sense the oxidative

burst in response to cold is still unknown. It has been shown that ROS can activate MAP

kinase cascades in Arabidopsis. The MAPKKK ANP1 mediates H2O2 induced activation of

MPK3 and MPK6, and stable over expression of ANP1 is resulting in plants enhanced

tolerance to heat, freezing and salt stress (Kovtun et al., 2000). The homologue to ANP1 in

tobacco, NPK1, is active in cold signal transduction cascades and influence auxin signalling

(Kovtun et al., 1998). Overexpression of NPK1 in maize also enhances freezing and drought

tolerance (Shou et al., 2004). This shows that ROS could be a missing link between MAP

kinases and stress signalling. Another important signalling molecule during LT stress appears

to be inositol 1,4,5- trisphospahte (IP3). Arabidopsis plants with mutations in the FRY1 gene

have defective inositol polyphospahte 1-phosphatase enzyme, which functions in the

degradation of IP3. This defect leads to super induction of ABA and cold responsive genes

during stress and reduced freezing tolerance while the plants maintain unusually high levels of

IP3 both before and after the exposure to stress (Xiong et al., 2001). It seems that the initial

perception of abiotic stress (or exogenously applied ABA) by plants result in a transient

29

43

increase in IP3. This data is not in conflict with the hypothesis that Ca2+

function as second

messenger, since IP3 have been shown to mediate transient increases in the cytosolic Ca2+

in

plant cells (Allen et al., 1995). The identification of another allelic mutation in the FRY1

gene, the hos2 mutation (resulting in an almost identical phenotype but lacking the super

induction of ABA responsive genes) enhanced our understanding of the role of FRY1/HOS2.

Xiong and co-workers showed that FRY1/HOS2 might work as a negative regulator CBF2 and

CBF3 expression, since the transcripts level of these two transcription factors were

significantly higher in the hos2 mutant (Xiong et al., 2004). The hos2 allele of FRY1 was

specifically temperature sensitive, with the enzymatic activity only affected in the cold, which

could explain why it lacked the super induction of ABA responsive genes versus the fry1

counterpart.

30

44

MATERIALS & METHODS CHAPTER 3

3.1 Plant material

Seeds of Cicer microphyllum were collected from Defence Institute of High Altitude

Research, Leh. In vitro plant cultures were established from excised embryo of Cicer

microphyllum (Singh et al., 2007). The plants were then established in the pots filled with

potting mixture (Vermiculite: Peat Moss: Soil, ratio 1:1:1) in culture room at 25°C with 16:8h

light and dark cycles (Fig.1a&b). After 15 days seedlings with four leaves were exposed to

cold stress at 4°C for 24 h and stressed tissue was collected. RNA was isolated from control

and stressed tissue (1gm) by guanosine thiocyanate (GTC) method.

A B

(A) Natural habitat

Fig.1 Cicer microphyllum

(B) Grown in laboratory

31

45

3.2 DEPC (Diethyle pyrocarbonate) treatment to glassware

Contaminated RNase was inactivated by soaking glassware in freshly prepared 0.1%

(v/v) DEPC in water for 24 hr. The glassware drained and autoclaved (necessary to destroy

any unreacted DEPC which can otherwise react with other proteins and RNA) prior to use.

All solutions for RNA isolation were prepared in 0.1% autoclaved DEPC water in order to

remove any nuclease contamination. Polycarbonate or polystyrene materials were

decontaminated by soaking in 3% hydrogen peroxide for 10 mins. Peroxide solution was

then removed by extensively rinsing with DEPC treated and autoclaved water prior to use.

3.3 Isolation of total RNA by guanosine thiocyante method

Solution preparation for RNA isolation

1M sodium citrate (pH 7.0)

10% sacrosyl

N- Lauryl Sarcocine 10 g

Distilled Water 100 ml

GTC solution (100ml)

Guanidium thiocyanate 50 g

Sterile water 58.6 ml

1 M sodium citrate 5.28 ml

10% sacrosyl 10.56ml

2-mercaptaethanol 0.36 ml (added just before use)

2 M sodium acetate (pH 4.0)

32

46

The tissue was homogenized thoroughly with 15 ml of the GTC solution. Homogenate

was transferred to a 50ml sterile polypropylene tube and mixed by inversion. Sodium acetate

(2M, pH-4.0, 3.0ml) was then added and mixed thoroughly by inversion. Then 15 ml phenol

(water saturated) and 3 ml of chloroform: isoamylalcohol (49:1) was added and the tubes

were again mixed thoroughly by inversion. The final suspension was shaked vigorously and

cooled on ice for 15 mins. The sample was centrifuged at 10000 g for 20 min at 4°C (after

centrifugation the RNA is present in aqueous layer whereas the DNA and proteins are present

in the interphase and phenol layer). The aqueous phase was transferred to another fresh sterile

tube and mixed with 15 ml of isopropanol and placed at -20°C for 1 hr to precipitate RNA.

RNA was sedimented at 10000g for 20 min. The resulting RNA pellet was dissolved in 3 ml

of GTC solution and reprecipitated with 1 volume isopropanol at -20°C for 1 hr. The tubes

were centrifuged again for 10 min at 4°C at 10000g. The pellet was washed with 75% alcohol,

dried and dissolved in 750 l of nuclease free water. The concentration of RNA was

determined at 260 nm spectrophotometrically. The isolated RNA was then electrophorese on

1% agarose/formaldehyde gel, visualized and photographed to confirm concentration and

quality. Total RNA was treated with RNase free DNase (Fermantas) to remove any genomic

DNA contamination. Poly (A+) RNA was purified by using PolyATtract® mRNA isolation

system I (Promega, USA) and finally dissolved in nuclease free water.

3.4 Suppression subtraction hybridization (SSH) and library construction

SSH (Diatchenko et al., 1996) was performed using the PCR-Select cDNA

Subtraction kit (Clonetech, USA). First and second strand cDNA was synthesized from 2 µg

of poly (A)+ RNA from stressed tissue (tester population) and RNA from control tissue

(driver population) as given below.

33

47

3.4.1 First strand cDNA synthesis:

For each tester and driver poly A+

RNA, following components were added in a sterile

microcentrifuge.

Poly A+

RNA (2µg) - 4µl

cDNA synthesis primer (10µM) - 1µl

Incubated the tube at 70°C for 5 min, cooled on ice for 5 min and briefly centrifuged.

Then following components were added to each reaction

5X First strand buffer - 2µl

dNTP Mix (10mM each) - 1 µl

Sterile water - 1 µl

AMV Reverse Transcriptase - 1 µl

Tubes were vortexed and centrifuged briefly to collect the liquid at the bottom. The tubes

were incubated at 42°C for 2 h and were immediately placed on ice to terminate first strand

cDNA synthesis and processed to second strand cDNA synthesis.

3.4.2 Second strand cDNA synthesis

Second strand cDNA synthesis was performed with each first strand tester and driver

cDNA. Following components were mixed to each first strand cDNA tube containing a total

of 10 µl volume.

Sterile water - 48.4 µl

5X second strand buffer - 16.0 µl

dNTP Mix (10mM) - 1.6 µl

34

48

20X Second Strand Buffer - 4.0 µl

The final volume was adjuste to 80 µl. The mixture was incubated at 16 °C for 2 h. T4

DNA Polymerase (6U) was added and incubated at 16°C for 1 hour. Reaction was terminated

by adding 4 µl of EDTA/Glycogen mix. Phenol : Chloroform : Isoamyle alcohol (25:24:1)

was mixed (100 µl) thoroughly and centrifuged at 14000 rpm for 10 min at room temperature.

Top aqueous layer was collected, placed in a fresh tube followed by another round of 100 µl

of Chloroform: Isoamyle alcohol (24:1) and centrifuged at 12000 rpm for 10 min at room

temperature. To the upper aqueous layer 25 µl 4M NH4OAc and 187.5 µl 100 % ethanol was

added. Centrifuged at 14000 rpm for 10 min at room temperature, supernatant was removed,

pellet was washed with 70 % ethanol and air dried and dissolved in 50 µl sterile water.

3.4.3 Rsa I Digestion

Each tester and driver double stranded cDNA was then digested with RsaI restriction

enzyme, to generate shorter, blunt ended ds cDNA fragments, optimal for subtraction and

required for adapter ligation in further processes. Following reagents were mixed to each

reaction.

ds cDNA - 43.5 µl

10X Rsa I restriction buffer - 5.0 µl

Rsa I restriction rnzyme (10 U/ µl) - 1.5 µl

Mixed properly and incubated at 37°C for 2 h. The reaction was terminated by adding 2.5 µl

of 20X EDTA/Glycogen mix. Phenol: chloroform: isoamyle alcohol (25:24:1) was added

(50 µl), mixed thoroughly and centrifuged at 14000 rpm for 10 min at room temperature.

Top aqueous layer was collected, placed in a fresh tube, 50 µl of chloroform:isoamyl

35

49

alcohol was added (24:1) and again centrifuged at 10000 rpm for 10 min at room

temperature. The upper aqueous layer was carefully collected and 25 µl 4M NH4OAc +

187.5 µl 100 % ethanol was added. Centrifuged at 14000 rpm for 10 min at room

temperature, removed the supernatant, and washed the pellet with 70 % ethanol and air

dried. The pellet was dissolved in 5.5 µl of sterile water and stored at -20°C. These digested

and purified double stranded cDNA served as experimental driver cDNA in further

hybridization reactions after adapter ligation.

3.4.4 Adapter ligation

RsaI digested cDNA (1 µl) was diluted with 5 µl of sterile water in two separate tubes

and following reagents were mixed in each reaction tube.

Sterile water - 3 µl

5X Ligation Buffer - 2 µl

T4 DNA Ligase (400U/ µl) - 1 µl

Following reagents were mixed to generate tester cDNA.

36

50

1 2

Component Tester1-1 Tester1-2

Diluted tester cDNA 2 µl 2 µl

Adaptor 1 (10µM) 2 µl --

Adapter 2R (10µM) -- 2 µl

Master mix 6 µl 6 µl

Final volume 10 µl 10 µl

The same setup was used for tester 2-1 and 2-2.

Centrifuged briefly and incubated at 16 °C overnight and reaction was stopped by

adding 1 µl of EDTA/Glycogen mix. Reaction was then heated at 72°C for 5 min to

inactivate the enzyme. Now experimental adapter ligated tester cDNAs are ready. Small

amount of sample (1 µl) from each was taken and diluted into 100 µl of sterile water which

was used for amplification by PCR and remaining sample was stored in -20 °C. In two

separate ligation reactions, tester cDNA was ligated to adapters 1 and 2 for hybridization

reactions. In the first hybridization, an excess of driver cDNA was hybridized at 68 °C for

8 h with tester cDNA ligated to adapter 1 & 2 in two reactions described below.

Tube Number

37

51

3.4.5 First hybridization Following reagents were mixed for first hybridization

1 2

Component Tester1-1 Tester1-2

RsaI digested Driver cDNA 1.5 µl 1.5 µl

Adaptor 1 ligated tester1-1 1.5 µl --

Adapter 2R ligated tester 1-2 -- 1.5 µl

4X hybridization buffer 1 µl 1 µl

Final volume 4.0 µl 4.0 µl

The same setup was used for tester 2-1 and 2-2.

Tubes were then incubated at 98°C for 2 min in a thermal cycler, followed by 68°C

incubation for 6-12 h.

3.4.6 Second hybridization

The two samples from the first hybridization were mixed together and fresh denatured

driver cDNA was added to further enrich the differentially expressed sequences.

Following components were mixed in a sterile tube:

Driver cDNA - 1 µl

4X Hybridization buffer - 1 µl

Sterile water - 2 µl

Hybridization sample

38

52

1 µl of this mixture was taken in a tube and Incubated at 98°C for 2 min. Tubes were removed

and mixed the driver with hybridization sample 1 and 2. This ensures that two hybridization

samples will mix together only in presence of fresh driver. The reactions containing fresh

driver were incubated at 68°C for overnight. Then 200 µl of dilution buffer was added to each

tube, incubated at 68°C for 5 min and stored in -20°C.

3.4.7 First PCR Amplification

1 µl of each diluted and subtracted sample was taken in a PCR tube and following

components were mixed.

10X PCR Buffer - 2.5 µl

dNTP Mix (10mM) - 0.5 µl

PCR Primer 1 (10µM) - 1 µl

Taq polymerase - 1U

Total volume was adjusted to 25 µl and incubated at 75°C for 5 min to extend the adaptors,

followed by thermal cycling as given below.

27 cycles were allowed

94°C - for 30 Sec

66°C - for 30 Sec

72°C - for 2 min

After the 27 cycles, 8 µl of PCR product was analyzed on 2 % agarose gel. 3 µl of PCR

product from each tube was diluted in 27 µl of sterile water to use as template in secondary

PCR.

39

53

3.4.8 Second PCR Amplification

Following components were mixed in a sterile tube.

Diluted PCR product - 1 µl

10X PCR Buffer - 2.5 µl

dNTP Mix (10mM) - 0.5 µl

Nested PCR Primer 1 (10µM) - 1 µl

Nested PCR Primer 2R (10µM) - 1 µl

Taq polymerase - 1U

Volume was maintained to 25 µl by addition of sterile water and commenced thermal cycling.

10-12 cycles:

94°C - for 30 Sec

66°C - for 30 Sec

72 °C - for 2 min

Subtracted cDNA was checked on 2% agarose gel that showed a clear smear. This subtracted

product was purified using QIAquick PCR Purification kit (QIAGEN, Germany) and digested

with RsaI enzyme.

3.4.9 Ligation of subtracted product

Following components were mixed in a sterile tube

Subtracted and digested product - 100 ng

T4 DNA Ligase enzyme (10 U/ µl) - 1µl

T4 DNA Ligase buffer (10 X) - 1µl

SmaI digested pBluescript KS (+) vector - 500 ng

40

54

The reaction volume was adjusted to 10 µl with sterile water and incubated at 16 °C for 24 h.

3.4.10 Preparation of E. coli (DH5α) competent cells (CaCl2 method)

Glycerol stock of DH5α (100 l) was inoculated in 5 ml of Luria broth containing

appropriate antibiotic (10 ppm nalidixic acid). The culture was incubated at 37°C in an

incubator shaker overnight at 150-180 rpm. One ml of this overnight grown culture was

inoculated to a conical flask containing 100 ml of Luria broth with appropriate antibiotic and

the flask was incubated at 37°C for 2.0-2.5 h with continuous shaking at 180-200 rpm (to get

OD 0.45-0.6) The culture was chilled on ice for 20 min and aseptically transferred to a

centrifuge tube and centrifuged at 3000 rpm for 5 min. The supernatant was discarded and the

pellet was suspended in 10 ml 100 mM ice chilled CaCl2 and the tube was kept on ice for 30

min and then centrifuged at 3000 rpm at 4°C. Supernatant was discarded and the pellet was

suspended in 2 ml 100 mM ice chilled CaCl2. Glycerol (20%) was added to the tube and

stored at -80 °C in aliquots.

3.4.11 Transformation of E. coli competent cells

The tube containing competent cells was thawed on ice after removing from –80 C.

Ligated plasmid DNA (5 l) was added to the tube containing competent cells (200 l) and

mixed gently and the tube was kept on ice for 30 min. After incubation, a brief heat shock was

given at 42oC for 90s to the cells and the tube was replaced quickly on ice for 5 min. Luria

Broth (800 l) was added to the cell suspension and incubated at 37 oC for 1 h with shaking at

100-150 rpm/min. Aliquots of 50, 100, 850 l were plated on Luria Agar plates containing

ampicillin (100 mg/ml). 8 l of 0.2 M IPTG (Isopropyl -D thio Galactoside) and 40 l of 20

mg/ml X-Gal (5-bromo 4-chlororo 3-indolyl D galactoside) was spreaded on the plates prior

41

55

to the plating of the transformed cells for blue/white selection to identify the recombinant

clones. The plates were incubated, upside down at 37 oC overnight.

3.5 Screening of the subtracted library by colony PCR

Recombinants from the subtracted library were screened for size of insert by colony

PCR. Colony PCR is used for exponentially amplifying DNA, via enzymatic replication,

using a bacterial colony having the cloned plasmid as template. Through this amplification

process unlimited copies of a particular sequence of DNA can be obtained.

Reaction mixture was prepared as follows

Components Final concentration

Template Bacterial colony

Primer 1 0.2 M

Primer 2 0.2 M

dNTPs 200 M each

Taq Buffer (with MgCl2) 1X

Taq polymerase 1 U/reaction (Fermentas, Life

Sciences)

Sterile water Variable (make volume 50 l)

Program was set for thermal cycling as below

94°C for 3 min

94°C for 30 sec

55°C for 30 sec 30 cycles

72°C for 1.5 min

72°C 5 min

PCR product were analysed on 0.8% agarose gel using 100 bp DNA ladder (Fermentas, Life

Sciences). Recombinants having lorger than 500 bp insert were picked for differential

screening by dot blots.

42

56

3.6 Differential screening of the subtractive clones by Dot Blot

Dot blot is an array of DNA samples immobilized on a nylon membrane with the help

of dot blot apparatus (Biorad, USA). Dot blots were prepared in duplicate in a lattice pattern

by applying a mixture of 5 µg plasmid of selected clones and 5 µL of freshly prepared 0.6N

NaOH to a Hybond-N+ nylon membrane (GE Healthcare, UK). Plasmids were isolated by

following alkaline lysis method as describe below.

3.6.1 Plasmid isolation (Alkaline lysis method)

Overnight grown bacterial culture (50 ml) was centrifuged at 8000 rpm for 5 mins.

Supernatant was discarded and the pellet was suspended in 4 ml solution I (50 mM glucose,

25 mM tris, 10 mM EDTA) and vortexed well. Freshly prepared solution II (8 ml, 1.0 %

SDS and 0.2 N NaOH) was added to the tubes and mixed well. The tubes were rinsed

properly and incubated for 5 mins at RT and solution III (6 ml, 3 M potassium acetate and 5

M acetic acid) was added. The tubes were inverted 2-3 times gently and kept on ice for 10

mins. The tubes were centrifuged at 8000 rpm for 15 mins. Supernatant was collected in fresh

tube and equal volume of C:I (24:1) was added and mixed thoroughly. The tubes were

centrifuged at 8000 rpm for 10 mins. The aqueous layer was collected in fresh tube and equal

volume of isopropanol was added, mixed thoroughly and the tubes were stored at -20°C. The

tubes were centrifuged at 8000 rpm for 15 mins. The pellet was washed with 70% ethanol.

The pellet was air dried and dissolved in 500 μl TE. RNase was added (10 mg/ml) & the tubes

were incubated at 37 °C for 1 h. Equal volume of phenol was added, and the tubes were

centrifuged at 13000 rpm for 5 min. To the supernatant, 500 μl of PCI was added and the

tube was centrifuged at 13000 rpm for 5 min. To the supernatant, 500 μl chloroform was

added and centrifuged at 3000 rpm for 5 min. Supernatant was collected and a 2.5 volumes of

43

57

absolute alcohol + 1/10 volume of sodium acetate was added. The tubes were kept at -20°C

for 1 h. The tubes were centrifuged at 13000 rpm for 15 min. Supernatant was discarded and

pellet was washed with 70%ethanol. The pellet was air dried and dissolved in TE buffer.

3.6.2 Dot blot preparation

The dot blot apparatus was assembled and the membrane was soaked with 20X SSC

prior to placing it in the apparatus. Flow valve was adjusted so that the vacuum chamber was

open to air. Samples (5 µg plasmid of selected clones and 5 µL of freshly prepared 0.6N

NaOH) were carefully loaded in the well and allowed the entire sample to filter through the

membrane by gentle vacuum. (Each well should be filled with equal volume of sample to

ensure homogenous filtration.) Each sample was washed with the 200 µl SSC after complete

filtration. After the wells were completely drained, the membrane was removed from the

apparatus. The nylon membrane was crosslinked using UV crosslinker (GE Healthcare, UK)

with a UV exposure 12,000 mj/cm2.

3.6.3 Hybridization and detection

Dot blots were placed in hybridization bottle and Hybridization solution (20 ml) was

added and incubated on 38 ºC for 60 min in hybridization chamber (GE Healthcare, UK).

Formamide based hybridization buffer (Sambrook et al., 1989) was used for hybridization.

Probes were prepared by using decalabel DNA biotin labeling kit (Fermentas Life Sciences,

USA) and 100 ng of control and stressed cDNA (as described earlier) as template. Probes

were denatured (100 ºC for 5 min followed by cooling on ice) and added to the hybridization

solution and Hybridized for 12-16 h at 38 ºC. There after hybridization solution was decanted

and blots were washed twice with 2X SSC and 0.1% SDS for 5 min each at room temperature.

Blots were again rinsed twice with 0.1% SDS and 0.1X SSC at 65ºC for 10 min. Blots were

44

58

then developed by using chromogenic detection kit (Fermentas Life Sciences). The intensity

of the dot blot was analyzed using AlphaEaseFC™ software (Alpha Innotech Corporation).

The clones which were found differentially expressed, selected and sent for sequencing.

3.6.4 Sequencing and sequence analysis

Sequencing of differentially expressed clones was done using ABI Prism automated DNA

sequencer (model 3730). Sequences were analyzed for homology with BLAST at NCBI

(www.ncbi.nlm.nih.in).

3.7 Southern blot hybridization

3.7.1 DNA Isolation

Leaf samples (C. microphyllum) were grinded in liquid Nitrogen (Liq N2). Samples

were then transferred to centrifuge tubes containing prewarmed buffer (100 mM Tris Cl, 1.4

M NaCl, 20 mM EDTA, 2 % CTAB, 2 % PVP, 0.2 % βME) at 65°C (2.5 ml buffer/gm tissue)

and vortexed well. The tubes were incubated in water bath for one hr at 65ºC with intermittent

vortexing. Equal volume of C:I (24:1) was added and mixed well by several gentle inversions

for 10 min and centrifuged at 12000 rpm for 15 mins at RT. Supernatant was collected in a

fresh tube and equal volume of chilled isopropanol was added and mixed gently and kept at -

20 °C for 30 min. The tubes were then centrifuged at 12000 rpm for 15 min at room

temperature. Pellet was dissolved the in TE buffer and RNase was added at final

concentration of 50 µg/ml and tubes were incubated at 37°C for 1 h. Equal volume of PCI

(25:24:1) was added mixed well by gentle inversions for 10 min and and tubes were then

centrifuged at 12000 rpm for 15 min at RT. In supernatant equal volume of CI (24:1) was

added, mixed well and centrifuged at 12000 rpm for 15 min. Supernatant was collected and

equal volume of absolute alcohol and 1/10 vol of sodium acetate was added and mixed well

45

59

and the tubes were stored at -20 °C for 30 min. The tubes were centrifuged at 13000 rpm for

15 mins and pellet was washed with 70% ethanol. The air dried pellet was dissolved in TE

buffer and stored at 4 °C. The isolated DNA was electrophoresed (100 V, 150 mA, 1 h) on

agarose gel (0.8 %) and stained with ethidium bromide (50 µg/ml).

3.7.2 Restriction digestion of genomic DNA

DNA (20 g) sample was taken in an eppendorf tube (1.5 ml) to with enzyme buffer (10x, 30

l) and restriction enzyme (50 U) was added. The volume was made up to 300 l with

autoclaved distilled water. The components were mixed well and the tubes were incubated at

37°C for 12-16 h. Reaction was stopped by the heat inactivation of enzyme at 80°C for 15

min. Digested DNA samples were analyzed the by agarose gel (1%) electrophoresis.

3.7.2 Blot preparation and hybridization

After agarose gel electrophoresis of the restriction digested genomic DNA, the gel was

treated with depurination buffer (0.25 N HCl) for 15 min. Depurination buffer was discarded

and the gel was washed with the distilled water twice. The gel was treated with denaturation

buffer (1.5 M NaCl, 0.5 M NaOH) for 15 min and again washed with distilled water twice.

The gel was washed with neutralization buffer (1.5 M NaCl, 0.5 M Tris Cl, 0.001 M EDTA)

for 15 mins and the gel was washed with distilled water twice and tank was filled with SSC.

Whatmann paper strips (3 mm) were placed over the tray in the tank and the bubbles were

removed with the help of glass rod. The gel was put upside down i.e. wells towards bottom.

Nylon membrane was wetted thoroughly with SSC and was placed on the gel with the help of

forceps. Whatmann papers (2 wet, 1 dry), blotting papers (up to 4 cm height) and weight (up

to 1.5 kg) were placed over it respectively. After 12-14 h, the wet sheets were removed and

turn back the gel. The nylon membrane was removed. Well marks were made on the nylon

46

60

membrane with gel on the top. The gel was removed and put the nylon membrane along with

dry whatmann paper. The transferred DNA was cross linked on the membrane with UV

crosslinker (GE Healthcare, UK) and stored at 4 °C. Blots were hybridized and developed as

described in dot blot hybridization and detection. In this experiment, probes were prepared by

using PCR amplified product of metallothionin gene and wound induced gene as templates.

3.8 Expression analysis

3.8.1 Whole plant in-situ hybridization to RNA in Cicer microphyllum

Whole plant (shoot as well as root) was wrapped in aluminum foil and then placed into

deep freezer (-80 ºC) for 4 h. After this step, the plant was kept into 95% chilled ethyl alcohol

in completely dipped condition for next 4 h within -80 ºC. The plant material was then placed

in -20 ºC for 4 h followed by 8 h incubation in 95% ethyle alcohol at room temperature by

gentle shaking to remove all the pigments from plant tissues. To confirm the efficiency of this

protocol, positive as well as negative control was kept during the experiment. In positive

control plant sample was hybridized with 26 rDNA probe which binds in all the tissues and

negative control was performed with all the steps except addition of probes which does not

give any color after the detection. When all the pigments were eliminated, alcohol was

decanted and sample was washed with sterile water. Freshly prepared bursting solution (20

ml, 0.25mM Sodium azide, 0.1% SDS, 5mM EDTA, 1 mg/ml pronase) was added and

incubated for 6-8 h at 38 ºC by gentle shaking. Busting solution was then, decanted, rinsed

with sterile water and 20 ml hybridization solution was added, and kept at 38 ºC for 60 min.

By the time probe was prepared by using 100ng of template DNA, labeled with biotin as

manufacturer‟s instruction. Probe was denatured at 100 ºC for 5 min followed by cooling on

ice, added to the hybridization solution and Hybridized for 8-12 h at 38 ºC. After

47

61

hybridization, solution was decanted and washed the plant material twice with 2X SSC and

0.1% SDS for 5 min each at room temperature. Again rinsed twice with 0.1% SDS and 0.1X

SSC at 65 ºC for 10 min. The plant material was washed with 1X blocking/washing buffer for

5 min at room temperature. Blocking solution (20 ml) was added and incubated at room

temperature for 20 min. Excess liquid was removed and 20 ml of freshly prepared

straptavidin-AP conjugate solution was added, incubated at room temperature for 45 min.

Solution was removed and plant material was washed with 50 ml 1X of blocking/washing

buffer and then liquid was discarded. Plant material was incubated with 20 ml of 1X detection

buffer for 15 min and solution was decanted followed by incubation with 10 ml of freshly

prepared substrate solution was done at room temperature in dark. Blue-purple color in

different plant parts after 15-30 min was observed and the solution was discarded followed by

wash with sterile water.

3.8.2 Northern Blotting

3.8.2.1 Plant material and growth condition

Seeds of Cicer microphyllum were germinated as described in Singh et al (2007).

Seedlings were grown in culture room at 25°C with intermittent light and dark cycles of 16 &

8 h respectively. Fifteen days old seedlings were exposed to 4 °C for different time intervals

and leaf samples were harvested, frozen in liquid nitrogen and stored at -80°C for further

experiments. To study the ABA effect, seedlings were treated with 10, 20, 30 & 50 µM ABA

for 24 h and leaf samples were harvested. Northern expression was also carried out by 1 µM

zinc sulphate foliar spray and with 100 µM poly ethylene glucol treatment for dehydration

stress response.

3.8.2.2 RNA extraction

48

62

RNA was isolated following GTC method and quantified using Qubet flurometer-Invitrogen

(USA).

3.8.2.3 Agarose/Formaldehyde Gel Electrophoresis

Agarose (0.75g) was dissolved in 36 ml water and cooled up to 60 oC in a water bath.

It was placed in a fume hood and running buffer (1X, MOPS) with formaldehyde (9 ml). Gel

was poured and allowed to set. Gel was then placed in the gel tank and sufficient 1x running

buffer was added to cover to a depth of ~ 1mm. RNA samples were prepared by adding

following components in nuclease free tube.

Total RNA - 40 µg

Formamide - 12.5 µl

Formaldehyde (37 %) - 4.0 µl

MOPS (10 X) - 2.5 µl

Ethydium bromide - 0.5 µg

Total volume was adjusted to 25 µl, vortexed, centrifuged briefly to collect the liquid and

incubated at 55 °C/15 mins. Samples were then cooled on ice and loaded with RNA loading

dye (1 X). Gel was run in 1 X MOPS solution at 80 V/2 h.

3.8.2.4 Blot preparation, hybridization and detection

Gel was washed with nuclease free water twice and tank was filled with 10 X SSC.

Whatmann paper strips (3mm) were placed over the tray in the tank and the bubbles were

removed with the help of glass rod. The gel was put upside down i.e. wells towards bottom.

Nylon membrane was wetted thoroughly with SSC and was placed on the gel with the help of

forceps. Whatmann papers (2 wet, 1 dry), blotting papers (up to 4 cm height) and weight (up

to 1.5 kg) were placed over it respectively. After 12-14 h, the wet sheets were removed and

turn back the gel. The nylon membrane was removed. Well marks were made on the nylon

membrane with gel on the top. The gel was removed and put the nylon membrane along with

49

63

dry whatmann paper. The transferred DNA was cross linked on the membrane with UV

crosslinker (GE Healthcare, UK) and stored at 4 °C. Blots were hybridized and developed as

described in dot blot hybridization and detection.

3.8.3 Quantitation of transcript by Real Time-PCR

Fifteen days old seedlings were exposed to 4 °C for different time intervals and leaf

samples were harvested, frozen in liquid nitrogen and stored at -80 °C for further experiments.

To study the transcript level in different plant tissues (in control as well as stressed condition),

samples of young leaves, mature leaves and root were harvested and stored at -80 °C. Total

RNA was isolated from different tissues or treated samples by RNeasy plant mini kit (Qiagen,

USA). RNA was treated with RNase free DNase. Total RNA was quantified (Qubit-

invitrogen) and equal quantity of RNA was used for first strand cDNA synthesis. Equal

quantity of cDNA was used for quantitative PCR (Mx3005P Stratgene/Agilent) with SYBR

green dye and gene specific primers. Normalization reaction was carried out with a control

(26s rDNA) and ROX used as reference dye. A 25 ml reaction was set up with gene specific

primers and template with Sybergreen mastermix (Stratagene/Qiagen) with PCR conditions of

95 for 10 min followed by 95 for 30 sec, 55 for 30 sec and 72 for 30 Sec. The data obtained

was presented as fold change in transcript level with reference to control (calibrator).

50

64

RESULTS CHAPTER 4

4.1 Screening of subtracted cDNA library

The quality of RNA was checked on 1% formaldehyde/agarose gel (Fig. 2) and

quantified by Qubit (Invitrogen, USA). The quality of cDNA subtraction library was assessed

on 2% agarose gel which revealed smear (Fig. 3) ranging from 0.5 to 1.8kb. This forward

subtracted product was purified, ligated in pBluescript KS+ vector at SmaI site by blunt end

cloning and transformed in E. coli (Dh5α) competent cells. A total of 1040 clones were

obtained, which were screened by colony PCR (Fig. 4) for insert size. Clones with more than

500 bp of insert were picked for differential screening by dot blot (Fig. 5). Colony PCR was

carried out with universal sequencing primers (M13 F and R) which gives approximate 200

bp amplification of vector sequence due to this clones having >500 bp size were picked which

will be helpful during analysis of sequences. A total of 523 clones were picked by colony

PCR among which 300 clones were observed differentially expressed as per dot blot analysis.

Single pass nucleotide sequencing of recombinant plasmid DNAs was performed by using

M13 forward primer. Sequences were assembled into clusters based on the presence of

overlapping, identical or similar sequences. The ESTs from forward subtracted library yielded

45 single tons with an average length of 307 base pairs, which could be assigned putative

functions on the basis of sequence similarity to genes or proteins of known function in gene

bank. A total of 283 ESTs were submitted in genebank which were assigned accession

numbers from GO241043 to GO241326. The sequenced clones gave homology with known

genes and some sequence gave no homology with the available database. The ESTs which

exhibited significant homology with previously reported genes in gene bank are summarized

in the Table 1.

51

65

Fig.3. Results of SSH using cDNA from cold stressed leaves as testers and that from control

leaves as drivers. Lane 1 & 2: unsubtracted cDNA, lane 3 & 4: After first round of

subtraction, lane 5 & 6: Forward-subtracted cDNA and reverse subtracted cDNA, lane M:

DNA ladder mix marker.

Fig.2. Total RNA isolated from control as well as stressed plant leaves

Control Stress

52

66

Fig. 4. Screening of insert size by colony PCR. Lane M: 1 kb DNA ladder, lane 1-19:

PCR product

M 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19

Fig. 5. Differential screenings of these clones by dot analysis, arrow blot represents same

clone differentially expressed in low temperature (4°C) stress.

53

67

Table 1: ESTs which exhibited significant homology with previously reported genes in gene bank

Sl. No. Acc. no Size (bp) Homology E value

1 GO241313 487 Auxin-induced protein 6B 3e-31

2 GO241318 146 Proteinase-like cysteine protease 3e-07

3 GO241322 499 Conserved hypothetical protein from

Ricinus communis

2e-16

4 GO241324 402 Medicago truncatula Ser/Thr protein

kinase (PRK), exostosin-like protein

7e-63

5 GO241326 542 Unknown protein from Arabidopsis

thaliana

8e-04

6 GO241299 716 Senescence-associated protein from

Picea abies

1e-42

7 GO241302 298 Zinc finger protein, putative from

Ricinus communis

2e-22

8 GO241303 257 Glutamate 2e-07

9 GO241304 245 H-protein promoter binding factor-1

from Arabidopsis thaliana

3e-07

10 GO241304 131 Hypothetical protein (Trifolium

pretense)

0.004

11 GO241290 204 Signal peptidase I, putative (Ricinus

communis)

8e-15

12 GO241293 215 Similar to digestive cysteine

proteinase 2 (Taeniopygia guttata)

2e-13

13 GO241294 219 Nitrate transporter, putative (Ricinus

communis)

6e-07

14 GO241296 602 Hypothetical protein (Medicago

truncatula)

5e-24

15 GO241289 482 Putative protocatechuate dioxygenase

(Streptomyces avermitilis)

8e-14

16 GO241284 526 Wound-responsive family protein

(Arabidopsis thaliana)

5e-12

17 GQ914056 482 Putative membrane protein

(Streptomyces scabiei)

2e-14

18 GO241279 520 Unknown protein (Glycine max) 1e-06

19 GO241242 331 Ubiquitin family protein (Arabidopsis

lyrata)

7e-07

20 GO241262 340 SAUR family protein (Populus

trichocarpa)

6e-14

54

68

21 GO241215 156 GDP-L-galactose phosphorylase 2e-04

22 GO241227 123 Transporter, putative (Ricinus

communis)

0.056

23 GO241191 442 Putative reverse transcriptase (Cicer

arietinum)

8e-04

23 GO241197 340 Cathepsin L-like (Salmo salar) 1e-10

24 GO241159 276 AT5G55660 (Arabidopsis thaliana) 4e-08

25 GO241161 217 Cold acclimation responsive protein

BudCAR4 (Medicago sativa)

1e-05

26 GO241167 708 Predicted protein (Populus

trichocarpa)

0.002

27 GO241185 329 Putative 60S ribosomal protein RPL10

(Novocrania anomala)

3e-12

28 GO241187 180 catalase (EC 1.11.1.6) CAT-2 - maize

(fragment)

1.4

29 GO241130 164 Unknown (Zea mays) .043

30 GO241142 211 Class I chitinase 3e-06

31 GO241143 159 Hypothetical protein (Arthrobacter sp.

JEK-2009)

6e-19

32 GO241147 198 MYB-like DNA-binding protein

(Catharanthus roseus)

0.002

33 GO241087 136 Unnamed protein product

(Ostreococcus tauri)

0.056

34 GO241095 109 Signal peptidase I, putative (Ricinus

communis)

0.47

35 GO241100 141 KAT2 (potassium channel in

Arabidopsis thaliana 2)

0.001

36 GO241107 543 Chalcone reductase (Medicago sativa) 8e-78

37 GO241123 157 Nitrate and chloride transporter

(Glycine max)

8e-06

38 GO241126 238 ATP-dependent Clp protease

proteolytic subunit (ClpP4)

(Arabidopsis thaliana)

8e-04

39 GO241127 232 Putative extracellular dioxygenase

(Phytophthora infestans T30-4)

2e-04

40 GO241128 226 Chloramphenicol acetyltransferase 2e-17

41 GO241129 90 SocE (Bacillus cereus) 0.81

42 GO241046 278 ribosomal protein L19 (Triticum

aestivum)

0.026

55

69

43 GO241051 219 Calumenin homologue (Ciona

intestinalis)

0.005

44 GO241074 144 Stress responsive protein (Zea mays) 0.001

45 GQ900702 225 C. arietinum mRNA for class I type 2

metallothionein

1e-84

From the sequences of cold induced subtracted library, a metallothionin gene

(accession no. GQ900702) was identified which gets up-regulated upon cold stress. Full

length open reading frame of this gene was amplified by using gene specific primers (Met F

& Met R, Appendix V) which was 240 base pairs long.

4.2 Characterization of metallothionin gene from Cicer microphyllum

Isolated metallothionin gene contains an ORF of 240 bp length and codes for a 79

amino acid protein with molecular wt of 7.9 kDa. The amino acid composition shows that

protein is Cysteine (17.7%) rich as with any metallothionin gene (Munoz et al., 1998) (Fig.

6). Translated protein from the sequence shows similarities with MTs of related species such

as C. arietinum (89% similarity with C. arietinum MT-2 proteins (accession no.Q39459)),

Vigna angularis (88% identity, accession no.AB176561.1), and Arachis hypogea (83%

identity, accession no. DQ097731.1). The isolated gene was designated as cmMet2. To further

ascertain the group, protein sequences were retrieved from NCBI & Multiple sequence

alignment (MSA) was carried out which shows characteristic pattern of cystein positions in

type 2 metallothionin i.e., presence of Cys-Cys and Cys-X-X-Cys motif (Munoz et al., 1998)

(Fig. 6). The two cystein rich domains are separated by a space of approximately 40 aa.

56

70

Fig. 6. Comparison of deduced amino acid sequences of C. micropyllum with other

reported plant MT-like protein sequences.

Fig. 7. Phylogenetic tree constructed based on metallothionein protein sequences of C.

microphyllum and other known plant MT-like protein sequences

57

71

The cmMet2 contains an overall N-Terminal consensus of MSCCGGNCGCS,

characteristic of type2 met gene (Cobbett & Goldsbrough, 2002). Phylogenetic analysis

groups Cicer microphyllum metallothionin with type2 metallothionin (Fig. 7), which groups

with type2 metallothionin of even non-legumes, but clearly differentiated from type1

metallothionin of legumes. Thus, this study clearly shows the homology between Cicer

arietinum metallothionin type 2 and Cicer microphyllum metallothionin like gene.

The PCR amplicons obtained from using cDNA and genomic DNA of C.

microphyllum as a template showed similar size, which confirmed the absence of any intron

sequence within gene (Fig.8). As metallothionins were reported to be regulated upon heavy

metal stress, osmotic and ABA stress responses, metallothionin like gene was chosen for

further study. The metallothionin gene was identified by blastn showed homology with type II

metallothionin of Cicer arietinum (89%).

240 bp

Fig. 8. Polymerase chain reaction of metallothionine gene using genomic DNA and cDNA.

Lane M: 100 bp DNA ladder, lane a: Amplification of metallothionin gene from cDNA,

lane b: Amplification of metallothionin gene from genomic DNA, lane c: Negative control

and lane d: Positive control

58

72

A single band was observed in southern blot (Fig. 9) analysis with three enzyme/

probe combinations, which implies the presence of single copy of isolated gene in the

genome. As metallothionins belongs to multigenic family (Yu et al., 1998), presence of single

band in the southern blot implies the sequence diversity among the isoforms or the presence

of single copy of isoform could be possible.

Accumulation of cmMet2 transcript was examined in seedling stage by whole plant in

situ hybridization. 20 days old seedlings of Cicer were processed and hybridized with a biotin

labeled cmMet2 cDNA probe. The accumulation of transcript was higher in shoot tip and

young expanding leaves (Fig. 10) than roots. In aerial parts, there was a difference in

transcript level in various parts. Transcript level was higher in shoot apex and axillary nodes

in comparison to internodal regions and old leaves. Expression in roots was observed in all

parts like tap root and secondary roots.

Fig. 9. Southern blot hybridization for metallothionin gene in Cicer microphyllum genomic

DNA digested with three different restriction enzymes. Lane a- EcoRI , lane b- BamHI and

lane c: Mbo1

59

73

Fig. 10. Whole plant in situ hybridization of Cicer microphyllum. (a) Negative control, (b)

Plant hybridized with biotin labeled cmMET cDNA as probe.

A

B

60

74

The quantitative experiment with Real-time PCR analysis was in conformity with in

situ expression analysis. Transcript abundance in root was five times higher than young shoot

(Fig. 11 & Table 2). Similarly, cmMet-2 expression in matured tissues was less than the

young shoot and root.

Tissue Type Fold Change

Yong Shoot 1

Matured shoot 0.06

Root 5.13

SE 0.1

LSD @5% 0.6

0

1

2

3

4

5

6

YS MS RT

Fold

chan

ge

Fig. 11 Fold change in transcript abundance of cmMet-2 in different tissues (YS-

Young shoot; MS- Mature Shoot; RT- Root). Error bars indicates SE.

Table 2. Fold change in transcript abundance of cmMet-2 in different tissues.

61

75

Transcript abundance of cmMet-2 was significantly increased by several folds in aerial parts

after exposure to different time intervals at low temperature stress (4oC). Increase in transcript

abundance was observed from 6 h of exposure which continued to increase even after 24 h.

Thus the transcript level increases with duration of exposure to 4oC. The fold change in

transcript abundance is shown in log fold change (Fig. 12 & Table 3).

Period of exposure (h) Log Fold change

0 0

6 6.81

12 7.23

24 8.93

SE 0.11

LSD @5% 0.5

Fold

chan

ge

0

1

2

3

4

5

6

7

8

9

10

0h 6h 12h 24h

Fig. 12 Log fold change in transcript abundance of cmMet-2 in different time interval in

aerial parts in response to cold stress exposure at 4oC. Error bars indicates SE

Table 3. Fold change (log2) in transcript abundance of cmMet-2 in different time interval in

aerial parts in response to cold stress exposure at 4oC

62

76

In order to study the fold change expression in the different parts of plant analyzed

after cold stress at 4oC for 24 h. cmMet-2 Transcript increase was observed in all tissue types

in comparison to unstressed same type of tissue (Fig 13 & Table 4). Fold change in transcript

over control was very high in the matured tissue young shoot and root tissues in response to

24 h of cold exposure.

Tissue type Control Stressed SE LSD@ 5%

Young shoot 0 3.72 0.045 0.27

Matured shoot 0 9.48 0.022 0.13

Root 0 3.07 0.231 1.39

Table 4. Fold change (log2) in transcript abundance of cmMet-2 in different tissues in

response to cold stress exposure at 4oC for 24 h (fold change is calculated over the control

of same tissue)

0

1

2

3

4

5

6

7

8

9

10

YS MS RT

Fig. 13 Log fold change in transcript abundance of cmMet-2 in different tissues in

response to cold stress exposure at 4oC for 24 h (fold change is calculated over the

control of same tissue) YS-Young shoot; MS-Mature Shoot; RT-root. Error bars

indicates SE.

Fold

chan

ge

63

77

When seedlings were treated with different concentrations of ABA (10 µM, 20 µM, 30

µM and 50 µM ABA for 24 h), gradual increase of the transcript levels of cmMet2 was found

(Fig.14). Further, the influence of gene expression was analyzed by PEG (100 mM) treatment

and Zn foliar spray of 1 µM which found to induce the transcript (Fig. 15 & 16). This

confirmed the general induction of the cmMet-2 transcripts in response to different stresses.

Fig. 15. A. Northern blot analysis of cmMet-2 mRNA expression levels in 15 days old

seedlings treated with 100µM PEG (Lane 1- control, Lane-2 stressed tissue for 24

hours). B. Total RNA sample on formamide gel stained with ethidium bromide.

A

B

Fig. 14. A. Northern blot analysis of cmMet-2 mRNA expression levels in 15 days old

seedlings treated with different concentrations of ABA (Lane a- 10µM ABA, lane b-

20 µM ABA, lane c- 30 µM ABA and lane d- 50 µM ABA) samples collected after

24 h. B. Total RNA sample on formamide gel stained with ethidium bromide.

A

B

64

78

4.3 Characterization of putative wound induced gene of Cicer microphyllum

Full length ORF of putative wound induced gene was amplified by 3‟ gene specific

Primer (5‟TCATTTGCAGGTGCAAGGGTTG3‟) and 5‟ Gene specific primer

(5‟ATGAGTCCATCAAGCAGAGCAT3‟). The full length ORF of this gene cloned,

sequenced, submitted to genebank with assigned accession number GQ914056 and designated

as cold tolerant protein. Putative wound induced gene contains 279 bp long open reading

frame and encodes 92 amino acid protein (Fig. 17).

Fig. 16. A. Northern blot analysis of cmMet-2 mRNA expression levels in 15 days old

seedlings treated with 1.0µM Zinc sulphate (Lane 1- control, Lane-2 stressed tissue for

24 hours). B.Total RNA sample on formamide gel stained with ethidium bromide.

B

A

Fig. 17. Nucleotide sequence and its translated amino acid sequence of the putative

wound induced gene of Cicer microphyllum

65

79

Northern blot experiment reconfirms up regulation of expression patterns of putative

wound induced gene during low temperature stress (Fig. 18). Northern blot also confirmed the

increased level of transcript accumulation after exposure to low temperature stress.

Accumulation of cmMet2 transcript during low temperature stress was examined in seedling

stage by whole plant in situ hybridization which showed an increased level of transcript

accumulation (Fig.19).

The expression profiling of wound induced gene of Cicer microphyllum by Real Time

PCR confirmed an increase in accumulation of transcript after 3 h and significant increased

level after 12 h of low temperature stress. The expression profiling of wound induced gene

revealed highest expression (28 fold) of transcript level in 12 h exposure at 4°C low

temperature stress, however the expression was gradually decreased upon exposure to longer

period of time (Fig. 20 & Table 5). The expression profiling of wound induced gene after

foliar spray of salicylic acid in Cicer microphyllum by real time PCR confers an increase in

Expression of wound induced gene

Equal loading of RNA (control)

1 2 3 4

A

B

Fig. 18. A. Northern blot analysis of wound induced mRNA expression levels in 15 days

old seedlings treated with different time interwals of low temperature stress. (Lane 1-0 h,

lane 2- 3 h, lane 3 -6 h and lane 4- 12 h) B. Total RNA sample on formamide gel stained

with ethidium bromide.

66

80

accumulation of transcript at 10 µM and significant increased level after 50 µM

concentration. It was obserbed that 2.75 fold increase of transcript level at 10 µM and 2.71

fold at 50 µM concentration as compared to mock (Fig. 21 & Table 6). Further, Southern blot

hybridization of putative wound induced gene confirmed presence of single copy number in

the genome of Cicer microphyllum (Fig. 22).

A

B

A

Fig. 19. Whole plant in situ hybridization of Cicer microphyllum. (a) Negative control (b)

Positive control hybridized with biotin labeled 26rDNA sequence as probe (c) Uninduced

plant hybridized with biotin labeled wound induced cDNA as probe (d) Stressed plant (4°C

/ 24 hours) hybridized with biotin labeled wound induced cDNA as probe

62

67

81

.

Period of exposure (h) Log Fold change

0 1

6 3.95171

12 28.3144

24 9.01799

SE 1.18733

LSD @5% 5.32086

Fig. 20. Fold change in transcript abundance of putative wound induced gene during low

temperature stress in different time intervals (0, 6, 12 and 24 h). All values were

normalized with respect to level of house keeping control 26rDNA expression. Error bars

indicates SE

-5

0

5

10

15

20

25

30

35

0 6 12 24

Time (h)

Fold

chan

ge

Table 5. Fold change in transcript abundance of putative wound induced gene during low

temperature stress in different time intervals (0, 6, 12 and 24 h). Each treatment replicated

three times

68

82

SA Treatment ( M) Log Fold change

Mock (M) 1

10 2.75

50 2.71

SE 0.25

LSD @5% 1.50

Table 6. Fold change in transcript abundance of putative wound induced gene in response

to SA spray (Mock, 10 and 50 M). Each treatment replicated three times

Fig. 21. Fold change in transcript abundance of putative wound induced gene in

response to SA spray (Mock, 10 and 50 M). All values were normalized with respect to

level of house keeping control 26rDNA expression. Error bars indicates SE

0

0.5

1

1.5

2

2.5

3

3.5

Fold

chan

ge

Concentration of SA

69

83

Fig. 22. Southern blot hybridization for wound induced gene in Cicer microphyllum

genomic DNA digested with two different restriction enzymes (Lane 1-EcoRI & lane 2-

BamHI).

70

84

DISCUSSION CHAPTER 5

5.1 Screening of subtracted cDNA library

One of the most abundant clones from the forward subtracted library encodes an Auxin

induced protein. To understand the mechanistic basis of cold temperature stress and the role of

the auxin response, Kyohei et al., (2009) characterized root growth and gravity response

of Arabidopsis thaliana after cold stress (4 °C) exposure of 8 to 12 h that inhibited root

growth and gravity response by 50%. Authors demonstrated that auxin-signaling

mutants axr1 and tir1 showed a reduced gravity response, responded to cold

treatment like the

wild type, suggesting that cold stress affects auxin transport rather than auxin signaling.

Furthermore, the inhibition of protein trafficking by cold is independent of cellular actin

organization and membrane fluidity. These results suggest that the effect of cold stress on

auxin is linked to the inhibition of intracellular trafficking of auxin efflux carriers. In the same

direction, Lee et al., (2005) stated that a number of genes important for biosynthesis and

signaling of plant hormones such as abscisic acid, gibberellic acid and auxin are regulated by

cold stress which is potentially important in coordinating cold tolerance with growth and

development. Leon et al., (1999) identified a AIR1 mRNA sequence through auxin induced

cDNA library which encode a proline and glycine rich N-terminus protein, responsible for

coupling of cell wall to plasma membrane. Singh et al., (2007) reported a substantial number

of genes involved in hormone response, signal cascades, defence, anti-oxidation, programmed

cell death/senescence and cell division through Auxin induced cDNA library approach. In this

study also a senescence associated protein was observed differentially expressed in low

temperature stress. Results demonstrated by Singh et al., (2007) suggests the induction phase

71

85

due to Auxin is accompanied by the expression of genes that may also be involved in zygotic

embryogenesis, developmental reprogramming processes and may infact be involved in

multiple cellular pathways which are yet unknown and needs further investigation.

Another clone was similar to cysteine protease and cathepsin-L like proteins. Cysteine

proteases of the papain super family have long been recognized for their role in intracellular

and extracellular protein degradation in a range of cellular processes (Bond and Butler, 1987).

Within the papain family, the cathepsins can be subdivided into more than 10 subfamilies on

the basis of their primary sequence and enzymatic activity (Santamaria et al., 1998). The

family includes cathepsin B, C, L, and Z, all of which contain an essential cysteine residue in

their active site but differ in tissue distribution and in some enzymatic properties, such as

substrate specificity and pH stability (Tort et al., 1999). Role of these genes in low

temperature stress is not clear and need further attention.

Other interesting clones from forward subtracted library included cDNA encoding ion

transporters and zinc finger family transcription factors. Some messages of each of these two

families have been shown to be cold induced in Arabidopsis (Hannah et al., 2005) and in

blueberry (Dhananjay et al., 2007) from previous microarray experiments. In the same

direction Dhananjay et al., (2007) had reported increased expression of zinc finger protein,

during cold stress in blueberry plants through subtractive cDNA approach. XERICO is an

Arabidopsis zinc figure protein recently shown to confer drought tolerance through increased

abscisic acid biosynthesis (Ko et al., 2006). These results support the conclusion that forward

subtracted library is indeed enriched for genes whose expression is upregulated during cold

acclimation, when plants are nearing maximal cold tolerance.

72

86

Another clone represented a glutamate like gene which encodes the enzyme glutamate

synthetase and plays a central role in plant nitrogen metabolism and may be synthesized and

metabolized by a number of different pathways (Brian and Lea, 2007). Lam et al., (2006)

stated that glutamate signalling may be part of a much broader network of N signalling

pathways that enable the plant to monitor and adapt to changes in its N status and the N

supply.

H-protein promoter binding factor-1 was also identified in cold induced subtracted

cDNA library. Joel et al., (2002) had demonstrated approximate five fold increase in

transcript level of this gene after three hour of cold stress (4°C) in roots and leaves separately.

Another cDNA clone exhibited homology with cold acclimation responsive protein,

which belongs to dehydrin family with the features of high hydrophilicity, a helix K-segment,

a long Gly-rich region and a phosphorylatable tract of Ser as well as deficiency in Cys and

Trp (Liu et al., 2006). The expression of these genes increased after two weeks of cold

treatment and more expression was detected in radicle than in cotyledon and function

prediction suggested role in protection of membrane structure and prevent macromolecular

coagulation or sequestrate calcium ions by association or disassociation with membrane under

low temperature conditions (Liy et al., 2006).

Catalase enzyme encoding gene was also found in screening of library. There is

increasing evidence that chilling elevates the levels of active oxygen species (Wise and

Naylor, 1987), which damage cellular components (Elstner, 1991; McKersie, 1991). Catalase

activity is involved in active oxygen species detoxification system in higher plants (Reviewed

by Koh, 2002). The higher CAT activity in acclimated seedlings during chilling and the stress

recovery suggests that CAT plays a major antioxidant role, likely along with other antioxidant

73

87

enzymes, in pre-emergent maize seedlings (Tottempudi, 1997).

Other interesting clone was a chitinase encoding gene. Chitinases are up-regulated by

a variety of stress conditions, both biotic and abiotic, and regulated by such phytohormones as

ethylene, jasmonic acid, and salicylic acid. Like other PR proteins, chitinases play a role in

plant resistance against distinct pathogens and by reducing the defence reaction of the plant,

chitinases allow symbiotic interaction with nitrogen-fixing bacteria or mycorrhizal fungi

(Reviewed by Kasprzewska, 2003). Recent studies (Maria et al., 2006) showed enhanced

resistance to biotic and abiotic stress in transgenic tobacco plants overexpressing chitinases of

fungal origin.

One of the best-characterized energy-dependent proteases is the Clp protease which

has been identified in this study. Clp protease was originally identified in vitro as an ATP-

dependent protease consisting of two components, the ATPase subunit and the protease

(ClpP) subunit (Hwang et al., 1988). Clp proteins in different bacterias are involved in many

stress responses such as heat, high salt, low temperature, UV light and often strongly induced

after brief exposure (Porankiewicz et al., 1999). Skinner and Trempy (2001) examined the

level of clpX transcript after cold shock and observed the level of clpX transcript was

increased approximately 2.8-fold after cold shock in Lactococcus lactis. Arabidopsis

chloroplast Clp protein expression was demonstrated during cold acclimation (Zhenga et al.,

2002) and proved the potential changes in Clp gene expression and protein content in

Arabidopsis leaves during cold acclimation.

Chalcone reductase ,a critical biosynthetic branch point that has afforded legume

plants with the additional ability to synthesize a set of related deoxychalcone-derived

phytoalexins in response to herbivore or pathogen attack including isoflavonoids, coumestans,

74

88

pterocarpans, and isoflavans (Dixon and Paiva, 1995). Recent studies have demonstrated that

in Arabidopsis leaves, levels of flavanoids increase in response to UV irradiation (Lois,

1994). The importance of flavanoids in respone to low temperature is not confirmed and still

need characterization.

One clone encoding putative myb-related protein was also repeated in forward

library which have been shown to play a role in cold stress signaling in herbaceous plants

(Urao et al., 1993). This transcription factor was also reported by Dhananjay et al., (2007) in

cold induced forward subtracted library in bluberry plant. Dhananjay et al., (2007)

demonstrated differential expression of this gene during cold stress which confers the role of

this gene in low temperature stress.

Wound induced gene was also found in screening of library which may be a part of

complex wound signaling network in plants. Wound signal molecules are well known to

promote rapid membrane associated events such as depolarization of the membrane with a

concomitant protein influx (Thain et al., 1995; Moyen and Johanes, 1996) and elevation of

intracellular levels of calcium. So the wound signal transduction pathways must have an

association by mobilization of calcium from intra cellular stores, and by calmodulin-related

activity (Leon et al., 1998). In Tomato it has been reported that the expression of a wound and

systemin inducible calmodulin gene may be associated with activation of wound responsive

genes (Bergey and Ryan, 1999) and role of calcium as a secondary messenger during different

stress responses is well known. So this wound gene may have a relation with low temperature

stress response. it would be investigated to study its role in low temperature response.

One of the best characterized clone in this study was metallothionin like protein

encoding gene. Metallothionins are low molecular mass, cysteine rich, metal binding proteins

75

89

(Kojima, 1991). It has been described that plant metallothionin genes respond to a variety of

stress conditions (Zhou and Goldsbrough, 1994; Heish et al., 1995; Choi et al., 1996). The

stimulatory effect of ABA on the levels of transcription of the CanMT-1 and CanMT-2 clones

suggests that these chickpea metallothionins are induced in response to specific ABA-

mediated stress. Munoz et al., (1998) proved that two different metallothionin like proteins,

encoded by CanMT-1 and CanMT-2 from Cicer arietinum epicotyles, are developmentally

regulated, showing upregulation in mature tissues, and also could be involved in responses to

osmotic stress and ABA treatment. The metallothionin was also found induced upon cold

stress in Lepidium latifolium (Aslam et al., 2009).

Another highly abundant clone found in screening was a plant receptor serine-

threonine kinase which belongs to mitogen activated protein kinase (MAPKs) family and also

known as extracellular regulated protein kinase (ERK) activated by dual phosphorylation on

Thr and Tyr residues. In Saccharomyces cerevisiae, osmoregulatory pathways begin with

either Src-homology3 (SH3) domain containing membrane protein or a two component

histidine kinase, which activates a MAPK cascade and leads to increased osmolytes synthesis

and accumulation (Gustin et al.,1998). In Arabidopsis, at least three MAPK have been found

that are enzymatically activated by salt as well as by cold, wounding and other environmental

signals (Ichimura et al., 2000).

In the same direction and approach with Lepidium latifolium (Aslam et al., 2009)

authors have identified genes involved in diverse processes and as observed in present study

most represented clone was enzyme like Serine Threonine kinase. In both the studies

metallothionin like protein is observed upregulated during low temperature stress. Many

clones remain unidentified from genebank searches in both the studies.

76

90

Thus, from forward subtracted library, many genes encoding cold stress responsive

proteins such as cold acclimation responsive protein, stress related protein of Zea mays, auxin

induced protein and senescence related proteins have been identified as reported in early

studies (Singh et al., 2007). These are proteins that have been shown previously to be

associated with cold stress responses on bluberry plants (Dhananjay et al., 2007) and in other

plants (Hannah et al., 2005). Many clones encoding putative transcription factors and other

proteins related to signal transduction were also present such as zinc finger protein, putative

myb- related protein, protein kinase family protein were also present whose roles in cold

acclimation responses are well known (Dhananjay et al., 2007; Mukhopadhaya and Tyagi,

2004; Davletova and Mittler, 2005; Urao et al., 1993). Finding of these genes in Cicer

microphyllum allow the researchers to test their functions in other crops and woody perennials

for increased cold tolerance flora. Besides clones encoding specific proteins some others like

DNA binding proteins, calumenin homologue, putative stress responsive protein, serine

threionine kinase were also present. All of these are potentially quite interesting and warrant

further investigation.

Plants respond and adapt to extreme low temperature with an array of biochemical,

physiological and molecular alterations. The genes identified in the present study may be

involved in significant processes such as signal transduction and ABA dependent\independent

pathway for tolerance to stress and to maintain normal growth and development.

In conclusion cDNA Suppression Subtractive Hybridization analysis was used to

identify the genes responsive to low temperature in Cicer microphyllum. Our data provide a

clue, how Cicer microphyllum responds to and adjusts to low temperature stress. Further

studies on the genes which have not shown any significant similarity from pre existing

77

91

database will promote the study of environment responsive mechanism and their roles in

conferring tolerance during low temperature stress in Cicer microphyllum. Based on the

modulated gene expression pattern and their functions obtained, we will further clarify the

important physiological and biochemical action of the identified genes (table 1). Sequence

analysis identified genes for regulatory proteins like kinases, cold acclimation responsive

proteins, metallothionin, enzymes and proteins with known and unknown functions, putative

transcription factors and other proteins related to signal transduction. Furthermore, many

cDNA clones did not exhibited any significant homology as per BLAST searches, suggesting

that they represent novel, unclassified genes, perhaps unique to Cicer microphyllum or other

cold desert plants. Thus results demonstrated in this study indicate that subtractive

hybridization is an effective strategy for identification of genes involved in cold acclimation

pathways. These genes will be helpful in dissecting cold acclimation pathways in high altitude

plants for which research is lacking. This ongoing research on a high altitude cold tolerant

plant Cicer microphyllum will be helpful in elucidating the physiological, biochemical and

molecular processes involved in adaptation and invading of this plant in various

environmental conditions.

5.2. Characterization of Metallothionin like genes in abiotic stresses

The metallothionin gene was identified by blastn showed homology with type II

metallothionin of Cicer arietinum (89%). From the sequences obtained from the library, a

metallothionin gene (accession no. GQ900702) was identified, up-regulated in response to

cold stress. The PCR amplicons, using cDNA and genomic DNA as a template showed

similar size, which confirmed the absence of any intron sequence within gene. As

metallothionins were reported to be regulated upon heavy metal stress, osmotic and ABA

78

92

stress responses, metallothionin like gene was chosen for further study.

A single band was observed in southern blot analysis with three enzyme/ probe

combinations, which implies the presence of single copy of isolated gene in the genome. As

metallothionins belongs to multigenic family (Yu et al., 1998), presence of single band in the

southern blot implies the sequence diversity among the isoforms or the presence of single

copy of the isoform.

5.2.1 In silico characterization of metallothionin genes from Cicer microphyllum

Isolated metallothionin gene contains an ORF of 240 bp length and codes for a 79 amino acid

protein with molecular wt of 7.9 kDa. The amino acid composition showed that protein is

Cysteine (17.7%) rich as with any metallothionin gene (Munoz et al., 1998) (Fig. 6).

Translated protein from the sequence shows similarities with MTs of related species such as

C. arietinum (89% similarity with C. arietinum MT-2 proteins (accession No. Q39459), Vigna

angularis (88% identity, Accession No. AB176561.1) and Arachis hypogea (83% identity,

Accession No. DQ097731.1). The isolated gene was designated as cmMet2. To further

ascertain the group, protein sequences were retrieved from NCBI & Multiple sequence

alignment (MSA) was carried out which showed characteristic pattern of cystein positions in

type2 metallothionin i.e. presence of Cys-Cys and Cys-X-X-Cys motif (Munoz et al., 1998)

(Fig. 6). The two cystein rich domains were separated by a space of approximately 40 aa. The

cmMet2 contains an overall N-Terminal consensus of MSCCGGNCGCS, characteristic of

type2 met gene (Cobbett & Goldsbrough 2002). Phylogenetic analysis groups Cicer

microphyllum metallothionin with type2 metallothionin (Fig. 7), which groups with type 2

metallothionin of even non-legumes, but clearly differentiated from type1 metallothionin of

legumes. Thus, clearly establishing the homology between Cicer arietinum 79

93

metallothionin type 2 and Cicer microphyllum metallothionin like gene.

Temperature is one of the critical environmental factors that limit agricultural

production worldwide by affecting plant growth and development. The cellular and molecular

responses of plants to these stresses have been studied intensively (Thomashow 1999;

Hasegava et al., 2000; Xiong and Zhu, 2002). However, because of the complexity and

diversity of cell metabolism among species, there is no clear picture of stress reponse system.

In the present work, isolation and characterization of a metllathionin gene i.e. cmMet2 from

Cicer microphyllum from a high altitude, cold adapted species from western and trans-

Himalayan region has been described. From the subtracted cDNA library, a metallothinin that

was induced upon cold stress was identified. Based on sequence analysis and domain analysis

the isolated gene is a type 2 metallothinin. The isolated met is cystein rich, with charetceristic

domains and its distribution it belongs to type 2 metallothinin (Munoz et al., 1998).

The tissue specific distribution of expression by whole plant ISH study showed that

the expression of cmMet2 was observed in root, young leaves and nodes which is further

confirmed by quantitative study. Expression of cmMet2 in roots is quite usual because roots

are subjected to initial metal ion stress. Further exposure to cold stress and ABA increase

transcript in roots tissues which shows site of met activity in roots. This result is also similar

to MT1 (type3) in Arabidopsis (Zhou and Goldsbrough, 1995) and rgMT in rice (Heish et al.,

1995) which showed higher mRNA level in roots than in shoots but differ from ricMT gene in

which higher mRNA level was observed in shoots rather than in roots. On the basis of above

result, it would appear that cmMet2 might be involved in the process of metal detoxification

like Arabidopsis MT (Murphy et al., 1997). The higher level of expression in young leaves

and shoot apex was found which was opposite to the previous findings related 80

94

with Met gene (Munoz et al., 1998). Two Met gene isolated form Cicer arietinum showed

higher expression in old tissues and level of expression deceased from lower to higher portion

of shoot (Munoz et al., 1998), but in case of cmMet2, the level of expression was

considerably higher at shoot apex. Higher level of expression of cmMet2 in young tissues

indicates that it may play a role in low temperature stress. The expression of gene was

increased in same tissues, when whole plant was subjected to low temperature stress (4oC) for

24 h. The induction of cmMet2 during cold stress was also confirmed by real time PCR using

26rDNA as internal control. High level of transcript of this gene during low temperature

stress for different time intervals and in different tissues during low temperature stress confers

the previous findings of Reid and Ross (1997). This upregulation suggest that plant MT gene

expression may be regulated by low temperature. High level of expression of cmMet in nodes

also indicates that it may play a role in actively dividing cells like ricMT gene (Yu et al,

1998).

Several groups have identified changes in the expression of mRNA encoding MT-like

proteins during plant development (Zhou et al., 2005) and tissue maturation (Munoz et al.,

1998). Present study of cmMet2 also shows correlation between the gene expression and

tissue maturation. It could be developmentally regulated and indicating down regulation in

mature tissue.

The expression of cmMet2 gene was also checked in other stresses like PEG, ABA

and heavy metal i.e., Zn. These results are similar to previous reports on metallothionine like

gene. The level of expression was increased in response to all these stresses.

The study conclusively established that cmMet-2 is abiotic stress regulated gene and

get up-regulated upon cold stress. CmMet-2 might be involved in ROS scavenging like in any

81

95

other stress responsive gene (Katakai et al., 2001 & Haq et al., 2003). Since, the Met are also

considered to be involved in ion homeostasis to regulate enzyme activities/transcription

factors which requires Zn ions as co-factor (Zhou et al., 2005; Krezel et al., 2007). A Zn

induction study showed the increase in the transcript upon Zn foliar spray with 1µM

concentration. The Ec proteins isolated from wheat germ is known to bind with Zn (Lane et

al., 1987) and is defined as a higher plant class 2 metallothionin (Kagi and Schaffer, 1988).

Metals are involved in complex biological processes which include role as a co-factor of

enzymes involved in biochemical oxidation and reduction. Suggested roles of MTs in living

organisms are the control of intracellular redox potential and activated oxygen detoxification

(Hamer et al., 1986). MT2a expression in Arabidopsis is induced by Zn (Zhou and

Goldsbrough, 1995) and Zn elevated the mRNA level of MT in rice suspension cultured cells

(Heish et al., 1995).

As the over expression studies in rice (Zhou et al., 2005) showed the global shift in the

transcript accumulation which could be possible by regulating the transcription factor

requiring Zn as co-factor or the signaling enzymes. All these studies suggest the possible role

of metallothionin gene in regulating available metal ions which subsequently affects the

intracellular active oxygen species produced in stressed plants and thus supports the tolerance

mechanism against stress.

The roles and functions of metallothionin like proteins in plants posses a great

diversity. However, they have been implicated in heavy metal metabolism and tolerance

under stress conditions. The multiple cysteine residues of MTs could bind heavy metal ions

such as copper and zinc. Bounded metal ions are released from metalloproteins once the

multiple cysteine residues are oxidized (Jiang et al., 1998 and Fabisiak et al., 1999). They

82

96

exert protective effects during various abiotic stresses and in addition have unique functions

remains to be investigated.

Two Met from Cicer arietinum were found to be regulated by osmotic stress and ABA

(Munoz et al., 1998). cmMet also shows same response against PEG mediated osmotic stress

and ABA treatment. However, there are very few reports on the role of Met- like proteins

during cold stress. In this study, we investigated the role of cmMet during cold stress. Real

time RT- PCR result clearly indicates the differential increase in cmMet transcript level

during cold at 4oC. This result is further confirmed by whole plant in situ hybridization.

The expression of cmMet can be induced markedly by low temperature, ABA, PEG

and Zn. These results suggest that the cmMet2 gene may play a role during various

environmental stresses. In this study we described and characterized a cmMet2 gene; its

putative regulatory element may be present to support its role in transcriptional regulation

processing.

Thus from the above findings, it can be concluded that MT from Cicer microphyllum

may play diverse physiological roles and/or functions to cope with various environmental and

developmental situation.

5.3 Characterization of wound induced gene in reference to low temperature stress

Wound induced gene was also found in screening of library which may be a part of

complex wound signaling network in plants. The identified novel wound induced gene was

cloned, sequenced and submitted to genebank with assigned accession number GQ914056.

Putative wound induced gene contains 279 bp long open reading frame and encodes 92 amino

acid long protein. Wound signal molecules are well known to promote rapid membrane

associated events such as depolarization of the membrane with a concomitant protein influx

83

97

(Thain et al., 1995, Moyen and Johanes, 1996) and elevation of intracellular levels of calcium.

So the wound signal transduction pathways must have an association by mobilization of

calcium from intra cellular stores, and by calmodulin-related activity (Leon et al., 1998). In

tomato it has been reported that the expression of a wound and systemin inducible calmodulin

gene may be associated with activation of wound responsive genes (Bergey and Ryan, 1999)

and role of calcium as a secondary messenger during different stress responses is well known.

So this wound gene may have a relation with low temperature stress response.

Proteins encoded by these wound related genes may play significant functions in

repairing of damaged plant tissues, participating in the activation of wound defense signaling

pathways and adjusting plant metabolism to the imposed nutritional demands. Multiple

signals and differential induction of gene expression point to the existence of a complex

wound signaling network in plants that, in addition may have species-specific variations.

Many structurally different molecules play regulatory roles in wound signaling, including the

oligopeptide systemin (Pearce et al., 1991), oligosaccharides released from the damaged

cell

wall (Bishop et al., 1981), and molecules with hormonal activity such as jasmonates (Farmer

and Ryan, 1990), ethylene (O'Donnell et al., 1996), and abscisic acid (Pena-Cortes

et al.,

1989). However, it has not been possible to identify and define unequivocally the nature of the

primary signals that trigger wound-activated defense responses. Frequently, the induction

of

wound responses requires the simultaneous action of different signals and regulators and,

quite often, the qualitative and quantitative participation of any putative signal in the

activation of wound responses depends on the plant species as well. A role of jasmonic acid in

plant response to water deficit has been suggested because this stress induces the expression

of several genes that also respond to jasmonic acid (Mason and Mullet, 1990 & Bell and

84

98

Mullet, 1991). In addition to its role in plant growth and development, jasmonate has been

proposed as a regulator of plant responses to various stresses as low concentration of

jasmonate were found to induce genes encoding osmotin like protein (Chang et al., 1994).

In this study we have characterized a novel wound induced gene in reference to low

temperature stress. This is the first report of involvement of wound induced gene in low

temperature stress response and need to be further investigated.

Whole plant in situ hybridization experiment showed an increased level of transcript

after 24 h of low temperature stress at 4°C. Transcript level of this gene was reconfirmed by

real time PCR which confers a significant increase in accumulation of transcript after 12 h. In

this study housekeeping 26s rDNA gene was considerd as internal control. Levels of this gene

during low temperature stress was investigated which reveals a gradual increase in the

transcript level during exposure from zero to 12 h at 4°C. Levels of this gene during low

temperature stress was investigated which reveals an increase in the transcript level during

exposure of salicylic acid (mock, 10 and 50 µM). Northern blot analysis also revealed the up

regulation of putative wound induced gene during low temperature stress. In northern blot

experiment a gradual increase was recorded in transcript level after 3, 6, and 12h of low

temperature stress. All these experiments were repeated twice to confirm the results and

finally it can be concluded from above findings that this putative wound induced gene is being

up regulated by low temperature stress. Southern blot confers the presence of this gene in

single copy in the genome of Cicer microphyllum. Proteins encoded by these wound related

genes may play significant functions in repairing of damaged plant tissues, participating in the

activation of wound defense signaling pathways and adjusting plant metabolism to the

imposed nutritional demands. Multiple signals and differential induction of gene expression

85

99

point to the existence of a complex wound signaling network in plants that, in addition may

have species-specific variations. Many structurally different molecules play regulatory roles in

wound signaling, including the oligopeptide systemin (Pearce et al., 1991), oligosaccharides

released from the damaged cell wall (Bishop et al., 1981), and molecules with hormonal

activity such as jasmonates (Farmer and Ryan, 1990), ethylene (O'Donnell et al., 1996), and

abscisic acid (Pena-Cortes et al., 1989). However, it has not been possible to identify

and

define unequivocally the nature of the primary signals that trigger wound-activated defense

responses. Frequently, the induction of wound responses requires the simultaneous action of

different signals and regulators and, quite often, the qualitative and

quantitative participation

of any putative signal in the activation of wound responses depends on the plant species as

well. A role of jasmonic acid in plant response to water deficit has been suggested because

this stress induces the expression of several genes that also respond to jasmonic acid (Mason

and Mullet, 1990 & Bell and Mullet, 1991). In addition to it‟s role in plant growth and

development, jasmonate has been proposed as a regulator of plant responses to various

stresses as low concentration of jasmonate were found to induce genes encoding osmotin like

protein (Chang et al., 1994). In this study we have characterized this gene in reference to low

temperature stress and to the best of our knowledge this is the first report of involvement of

wound induced gene in low temperature stress response and need further investigation.

86

100

SUMMARY CHAPTER 6

Cicer microphyllum is a wild relative of cultivated chickpea and a high altitude cold adapted

species distributed in western Himalayas. A cold induced subtracted cDNA library was

constructed using cold acclimated poly (A)+ RNA and control poly(A)

+ RNA of Cicer

microphyllum to identify low temperature regulated genes. A total of 523 clones were picked

by colony PCR among which 300 clones were observed differentially expressed as per dot

blot analysis. Single pass nucleotide sequencing of recombinant plasmid DNAs was

performed by using M13 forward primer. Sequences were assembled into clusters based on

the presence of overlapping, identical or similar sequences. The ESTs from forward

subtracted library yielded 45 single tons with an average length of 307 base pairs, which

could be assigned putative functions on the basis of sequence similarity to genes or proteins of

known function in gene bank. A total of 283 ESTs were submitted in genebank which were

assigned accession numbers from GO241043 to GO241326. BLAST analysis of these ESTs

revealed its similarity for regulatory proteins like kinases, metallothionin, enzymes, cold

stress responsive proteins such as cold acclimation responsive protein, stress related protein of

Zea mays, auxin induced protein, senescence related proteins, zinc finger protein, putative

myb- related protein and proteins with unknown functions.

A cDNA encoding metallothionin like protein has been identified from a cold induced

subtraction cDNA library from Cicer microphyllum. The sequence of cloned metallothionin

gene of C. microphyllum (GQ900702) contains 240 bp long open reading frame.

This clone encodes 79-amino acid protein of 7.9 kDa. Sequence analysis identified the

motifs characteristic of Type II metallothionin and designated as cmMet-2. Southern

hybridization confirms single copy of the cmMet-2 gene in C. microphyllum genome. In situ

87

101

hybridization indicated spatial transcript regulation of cmMet-2 in root and aerial parts and

also confirmed through real-time PCR based quantitative transcript analysis. The data

revealed significantly low level of transcript in aerial parts than the roots. Quantitative

analysis using real-time PCR assay revealed induction of transcript in all parts of plants in

response to cold stress at 4°C. The transcript abundance was found to increase exponentially

with time course from 6h to 24 h after exposure. Further, regulation of transcript

accumulation in response to ABA application, PEG (100 M) induced osmotic stress or

ZnSO4 (1 M) foliar spray indicated by northern hybridization suggests involvement of

cmMet-2 in multiple stress response. A cDNA encoding wound induced like protein has been

identified from this cold induced subtraction cDNA library of C. microphyllum. The full

length ORF of identified novel wound induced gene was cloned, sequenced and submitted to

genebank with assigned accession number GQ914056. Expression profiling of this gene by

real-time PCR and northern blot confirmed its up-regulation during low temperature stress.

Quantitative analysis using real-time PCR assay revealed induction of transcript after foliar

spray of salicylic acid (mock, 10 and 50µM). In situ RNA hybridization shows that the

expression of isolated wound induced gene found to get up-regulated during low temperature

stress (4°C/24 hours). Southern blot confers presence of wound induced gene in single copy

number on the genome of C. microphyllum.

In conclusion Suppression Subtractive Hybridization analysis was used to identify the

genes responsive to low temperature in C. microphyllum. Our data provide a clue, how C.

microphyllum responds to and adjusts to low temperature stress.

Further studies on the genes which have not shown any significant similarity from pre

existing database will promote the study of environment responsive mechanism and their

88

102

roles in conferring tolerance during low temperature stress in C. microphyllum. This ongoing

research on a high altitude cold tolerant plant C. microphyllum will be helpful in elucidating

the physiological, biochemical and molecular processes involved in adaptation and invading

of this plant in various environmental conditions.

89

103

REFERENCES

Agarwal M., Hao Y., Kapoor A., Dong C.H., Fujii H., Zheng X., Zhu J.K. (2006) A R2R3

type MYB transcription factor is involved in the cold regulation of CBF genes and in

acquired freezing tolerance. J Biol Chem., 281, 37636-37645.

Allen G.J., Muir S.R., Sanders D. (1995) Release of Ca2+

from individual plant vacuoles by

both InsP3 and cyclic ADP-ribose. Science., 268, 735-737.

Anderson J.V., Chevone B.I., Hess J.L. (1992) Seasonal variation in the antioxidant system

of eastern white pine needles. Plant Physiol., 98, 501-508.

Anderson J.V., Guy C.L. (1995) Spinach leaf 70-kilodalton heat-shock cognate stabilizes

bovine adrenal glucose-6-phosphate dehydrogenase in vitro without apparent stable

binding. Planta., 196, 303–310.

Anderson J.V., Li Q.B., Haskell D.W., Guy C.L. (1994) Structural organization of the

spinach endoplasmic reticulum-luminal 70-kilodalton heat-shock cognate gene and

expression of 70-kilodalton heat-shock genes during cold acclimation. Plant Physiol.,

104, 1359-1370.

Anderson M.D., Prasad T.K., Martin B.A., Stewart C.R. (1994) Differential Gene

Expression in Chilling-Acclimated Maize Seedlings and Evidence for the Involvement

of Abscisic Acid in Chilling Tolerance. Plant Physiol., 105, 331-339.

Antikainen M., Griffith M. (1997) Antifreeze accumulation in freezing tolerant cereals.

Physiol Plant., 99, 423–432.

Aono M. (1995) paraquat tolerance of transgenic Nicotiana tobacum with enhanced activities

of glutathione reductase and superoxide dismutase. Plant Cell Physiol., 36, 1687-1691.

Apel K., Hirt H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal

transduction. Annu Rev Plant Biol., 55, 373-399.

Arondel V., Lemieux B., Hwang I., Gibson S., Goodman H.M., Somerville C.R. (1992)

Map-based cloning of a gene controlling omega-3 fatty acid desaturation in Arabidopsis.

Science., 258,1353–55.

Arora R., Wisniewski M.E. (1994) Cold acclimation in genetically related (sibling)

deciduous and evergreen peach (Prunus persica [L.] Batsch). Plant Physiol., 105, 95-

101.

Asada K. (1994) Production and action of active oxygen species in photosynthetic tissues. In:

Mullineaux P.M. (Ed.), Causes of photo-oxidative stress and amelioration of defence

systems in plants. CRC Press Boca Raton, FL., 77–104.

104

Aslam M., Sinha V.B., Singh R.K., Anandhan S., Pande V. & Ahmed Z. (2009) Isolation

of cold responsive genes from Lepidium latifolium by suppressive subtraction

hybridization. Acta Physiol. Plant., 32, 205-210.

Baker S.S., Wilhelm K.S., Thomashow M.F. (1994) The 5'-region of Arabidopsis thaliana

cor15a has cis-acting elements that confer cold-, drought- and ABA-regulated gene

expression. Plant Mol Biol., 24, 701-713.

Basant B., O. P. Chaurasia, P. C. Pande and Zakwan Ahmed. (2007) Raw edible plants of

cold desert Ladakh. Indian Journal of Traditional Knowledge., 6(1),182-184.

Bedi S., Basra A.S. (1993) Chilling injury in germinating seeds: basic mechanisms and

agricultural implications. Seed Science Research., 3, 219-229.

Bell E., Mullet J. E. (1991) Lipoxygenase gene expression is modulated in plants by water

deficit, wounding, and methyl jasmonate. Mol. Gen. Genet., 230, 456-462.

Bergey D.R., Ryan C.A. (1999) Wound- and systemin-inducible calmodulin gene expression

in tomato leaves. Plant Molecular Biology., 40, 815–823.

Singh B., Tyagi A.K., Khurana J.P., Khurana P. (2007) Analysis of expression profile of

selected genes expressed during Auxin induced somatic-embryogenesis in leaf based

system of Wheat (Triticum aestivum) and their possible interaction. Plant Mol Biol., 65,

677-692.

Bishop P.D., Makus D.J., Pearce G., Ryan C.A. (1981) Proteinase inhibitor inducing factor

activity in tomato leaves residues in oligosaccharides enzymically released from cell

walls. Proceedings of National Academy of Sciences, USA., 78, 3536-3540.

Bodner M., Larcher W. (1987) Chilling susceptibility of different organs and tissues of

Saintpaulia ionantha and Coffea arabica. Angew. Botanik., 61, 225-242.

Bohnert H.J., Jensen R.G. (1996) Strategies for engineering water-stress tolerance in plants.

Trends in Biotech., 14, 89–97.

Bohnert H.J., Nelson D.E., Jensen R.G. (1995) Adaption to environmental stresses. Plant

Cell., 7, 1099-1111.

Bond J. S., and Butler P. E. (1987) Metallothionin review. Annual Review of Biochemistry.,

56, 333-364.

Bowler C., Slooten L., Vandenbranden S., De Rycke R., Botterman J., Sybesma C., Van

Montagu M., Inze D. (1991) Manganese super-oxide dismutase can reduce cellular

damage mediated by oxygen radicals in transgenic plants. EMBO J., 10, 1723-1732.

Bowler C., Van Montague M., Inze D. (1992) Superoxide dismutase and stress tolerance.

Annu Rev Plant Physiol Plant Mol Biol., 43, 83-116.

105

Brautigam M., Lindlof A., Zakhrabetkova S., Gharti-Chhetri G., Olsson B. and Olsson

O. (2005) Generation and analysis of 9792 EST sequences from cold acclimated oat,

Avena saitiva. BMC Plant Biology., 5, 18-24.

Brian G., Lea P.J. (2007) Glutamate in plants: metabolism, regulation, and signaling.

Journal of Experimental Botany., 58, 2339–2358.

Brown A.P., Dunn M.A., Goddard N.J., Hughes M.A. (2001) Identification of a novel

lowtemperature- response element in the promoter of the barley (Hordeum vulgare L)

gene blt101.1. Planta., 213, 770-780.

Buchanan Wollaston V. (1994) Isolation of cDNA for genes that are expressed during leaf

senescence in Brassica napus. Plant Physiology., 105, 839-846.

Burcham T.S., Osuga D.T., Yeh Y., Feeney R.E. (1986) A kinetic description of antifreeze

glycoprotein activity. J. Biol. Chem., 261, 6390-6397.

Busk P.K., Pages M. (1998) Regulation of abscisic acid-induced transcription. Plant Mol.

Biol. 37, 425-435.

Butt A., Mousley C., Morris K., Beynon J., Can C., Holub E., Greenburg J.T.,

Buchanan-Wollaston V. (1998) Differential expression of a senescence enhanced

metallothionin gene in Arabidopsis in response to isolates of Perenospora parasitica

and Pseudomonas syringae. The Plant Journal., 16, 209-221.

Campbell S.A., Close T.J. (1997) Dehydrins: genes, proteins, and associations with

phenotypic traits. New Phytol., 137, 61–74.

Carpenter J.F., Crowe J.H. (1988) The mechanism of cryoprotection of proteins by solutes.

Cryobiology., 25, 244-255.

Chang P., Xu Y., Liu D., Narasimhan M.L., Hasegawa P.M., Bressan R.A. (1994) Plant

defense genes are synergistically induced by ethylene and jasmonate. Plant Cell., 6,

1077-1085.

Charbonnel-Campaa L., Lauga B., Combes D. (2000) Isolation of a type 2 metallothionin

like gene preferentially expressed in the tapetum in Zea mays. Gene., 254, 199-208.

Chen H.J., Hou W.C., Yang C.Y., Huang D.J., Liu J.S., Lin Y.H. (2003) Molecular

cloning of two metallothionin like protein genes with differential expression patterns

from sweet potato (Ipomoea batatus) leaves. Journal of Plant Physiology., 160, 547-

555.

Chinnusamy V., Ohta M., Kanrar S., Lee B., Hong X., Agarwal M., Zhu J.K. (2003)

ICE1: a regulator of cold-induced transcriptome and freezing tolerance in Arabidopsis.

Genes Dev., 17, 1043-1054.

Chinnusamy V., Zhu J., Zhu J.K. (2007) Cold stress regulation of gene expression in

plants. Trends Plant Sci., 12, 444-451.

106

Choi D., Kim H.M., Yun H.K., Park J.A., Kim W.T., Bok S.H. (1996) Molecular cloning

of two metallothionin like genes from Nicotiana glutinosa L. and it‟s induction by

wounding and tobacco mosaic virus infection. Plant Physiology, 112, 353-359.

Chubatsu L.S., Meneghini R. (1993) Metallothionin protects DNA from oxidative damage.

Biochemical Journal., 291, 193-198.

Close T.J. (1997) Dehydrins: a commonalty in the response of plants to dehydration and low

temperature. Physiol Plant., 100, 291–296.

Close T.J., Fenton R.D., Yang A., Asghar R., DeMason D.A., Crone D.E., Meyer N.C.,

Moonan F. (1993) Plant reponses to cellular dehydration during environmental stress.

American Society of Plant Physiologists., 34, 104–118.

Cobbett C., Goldsbrough P. (2002) Phytochelatins and metallothionins: roles in heavy metal

detoxification and homeostasis. Annual Review of Plant Biology, 53, 159-182.

Coca M.A., Almoguera C., Jordano J. (1994) Expression of sunflower low-

molecularweight heat-shock proteins during embryogenesis and persistence after

germination: localization and possible functional implications. Plant Mol. Biol., 25, 479-

492.

Collins G., Nie X.L., Saltveit M. (1995) Heat shock proteins and chilling sensitivity of mung

bean hypocotyls. J. Exp. Biol., 46, 479-492.

Coupe S.A., Taylor J.E., Roberts J.A. (1995) Characterization of an mRNA encoding a

metallothionein-like protein that accumulates during ethylene-promoted abscissin of

Sambucus nigra L. leaflets. Planta, 197, 442-447.

Daveletova S. K., Mittler S.C.R. (2005) A zinc finger protein ZAT 12 plays a central role in

reactive oxygen and abiotic stress signaling in Arabidopsis. Plant Physol., 139, 847-

856.

Davies C., Robinson S.P. (2000) Differential screening indicates a dramatic change in

mRNA profiles during grape berry ripening, Cloning and characterization of cDNA

encoding putative cell wall and stress response proteins. Plant Physiology., 122, 803-

812.

De Framond A.J. (1991) A metallothionein-like gene from maize (Zea mays); cloning and

characterization. FEBS Lett., 290, 103-106.

DeVries A.L. (1986) Antifreeze glycopeptides and peptides: interactions with ice and water.

Methods Enzymol., 127, 293-303.

Dhananjay N., Anik L., Rajeev A., Lisa J. (2007) Identification of genes associated with

cold acclimation in blueberry (Vaccinium corymbosum L.) using a subtractive

hybridization approach. Plant Science, 173, 213-222.

Diatchenko L., Lau Y.F.C., Campbell A.P., Chenchik A., Moqadam F., Huang B.,

Lukyanov S., Lukyanov K., Gurskaya N., Sverdlov E.D. Siebert P.D. (1996)

107

Suppression subtractive hybridization: a method for generating differentially regulated

or tissue-specific cDNA probes and libraries. Proc Natl Acad Sci USA., 93, 6025–6030.

Dixon R. A., Paiva N. L. (1995) Stress induced phenylpropanoid metaboloism. Plant Cell, 7,

1085–1097.

Dubouzet J.G., Sakuma Y., Ito Y., Kasuga M., Dubouzet E.G., Miura S., Seki M.,

Shinozaki K., Yamaguchi-Shinozaki K. (2003) OsDREB genes in rice, Oryza sativa

L., encode transcription activators that function in drought, high-salt and cold-

responsive gene expression. Plant J., 33, 751-763.

Ellis R.J., Van der Vies S.M. (1991) Molecular chaperones. Annu Rev Biochem., 60, 321–

347.

Elstner E.F. (1991) Mechanism of oxygen activation in different compartments of plant cells,

active oxygen/oxidative stress and plant metabolism. American Society of Plant

Physiologists, 13-25.

Ergon A., Klemsdal S.S., Tronsmo A.M. (1998) Interactions between cold hardening and

microdochium nivale infection on expression of pathogenesis-related genes in winter

wheat. Physiol. Mol. Plant Pathol., 53, 301-310.

Esterbauer H., Grill D. (1978) Seasonal variation of glutathione and glutathione reductase in

needles of Picea abies. Plant Physiol., 61, 119-121.

Evans I.M., Gatehouse L.N., Gatehouse J.A., Robinson N.J., Croy R.R. (1990) A gene

from pea (Pisum sativum L.) with homology to metallothionein genes. FEBS Lett., 262,

29-32.

Fabisiak J.P., Tyurin V.A., Tyurina Y.Y., Borisenko G.G., Korotaeva A., Pitt B.R., Lazo

J.S., Kagan V.E. (1999) Redox regulation of copper-metallothionein. Arch. Biochem.

Biophys., 363, 171-181.

Fadzillah N.M., Gill V., Finch R.P., Burdon R.H. (1996) Chilling, oxidative stress and

antioxidant responses in shoot cultures of rice. Planta, 199, 552-556.

Farmer E.E., Ryan C.A. (1990) Interplant communication: air borne methyl jasmonate

induces synthesis of preotinase inhibitors in plant leaves. Proc. Natl. Acad. Sci. USA.,

87, 7713-7716.

Fowler D.B., Gusta L.V. (1979) Selection for winter hardiness in wheat. Identification of

genotypic variability. Crop Science, 19, 769-772.

Fowler S., Thomashow M.F. (2002) Arabidopsis transcriptome profiling indicates that

multiple regulatory pathways are activated during cold acclimation in addition to the

CBF cold response pathway. Plant Cell, 14, 1675-1690.

Fowler S.G., Cook D., Thomashow M.F. (2005) Low temperature induction of Arabidopsis

CBF1, 2, and 3 is gated by the circadian clock. Plant Physiol., 137, 961-968.

108

Foyer C.H. (1997) Oxygen metabolism and electron transport in photosynthesis. In:

Scandalios J.G. (Ed.), Oxidative stress and the molecular biology of antioxidant

defenses. Cold Spring Harbor Laboratory Press, 587–621.

Fursova O.V., Pogorelko G.V., Tarasov V.A. (2009) Identification of ICE2, a gene

involved in cold acclimation which determines freezing tolerance in Arabidopsis

thaliana. Gene, 429, 98-103.

Gadjev I., Vanderauwera S., Gechev T.S., Laloi C., Minkov I.N., Shulaev V., Apel K.,

Inze D., Mittler R., Van Breusegem F. (2006) Transcriptomic footprints disclose

specificity of reactive oxygen species signaling in Arabidopsis. Plant Physiol., 141, 436-

445.

Gaitanaris G.A., Papavassiliou A.G., Rubock P., Silverstein S.J., Gottesman M.E. (1990)

Renaturation of denatured repressor requires heat shock proteins. Cell, 61, 1013-1020.

Gibson S., Arondel V., Iba K., Somerville C. (1994) Cloning of a temperature-regulated

gene encoding a chloroplast !-3 desaturase from Arabidopsis thaliana. Plant Physiol.,

106, 1615–21.

Gilmour S.J., Hajela R., Thomashow M.F. (1988) Cold acclimation in Arabidopsis. Plant

Physiol., 87, 745-750.

Gilmour S.J., Sebolt A.M., Salazar M.P., Everard J.D., Thomashow M.F. (2000)

Overexpression of the Arabidopsis CBF3 transcriptional activator mimics multiple

biochemical changes associated with cold acclimation. Plant Physiol., 124, 1854-1865.

Gilmour S.J., Thomashow M.F. (1991) Cold acclimation and cold-regulated gene

expression in ABA mutants of Arabidopsis thaliana. Plant Mol. Biol. 17, 1233-1240.

Gilmour S.J., Zarka D.G., Stockinger E.J., Salazar M.P., Houghton J.M., Thomashow

M.F. (1998) Low temperature regulation of the Arabidopsis CBF family of AP2

transcriptional activators as an early step in cold-induced COR gene expression. Plant

Physiology, 141, 436-445.

Griffith M., Antikainen M., Hon W.C., Pihakaski-Maunsbach K., Yu X.M., Chun J.U.,

Yang D. (1997) Antifreeze proteins in winter rye. Physiol. Plant., 100, 327–332.

Griffith M., Yaish M.W.F. (2004) Antifreeze proteins in overwintering plants: a tale of two

activities. Trends in Plant Sci., 9, 399-405.

Griffith M., Ala P., Yang D.S.C., Hon W.C., and Moffatt B.A. (1992) Antifreeze protein

produced endogenously in winter rye leaves. Plant Physiol., 100, 593-596.

Griffith M., Antikainen M., Hon W.C., Pihakaski-Maunsbach K., Yu X.M., Chun J.U.,

Yang D.S.C. (1997) Antifreeze proteins in winter rye. Physiol. Plant., 100, 327-332.

Guo Z., Ou W., Lu S., Zhong Q. (2006) Differential responses of antioxidative systems to

chilling and drougt in four rice cultivars differing in sensitivity. Plant Physiology and

Biochemistry, 44, 828-836.

109

Guo Z., Tan H., Zhu Z., Lu S., Zhou B. (2005) Effect of intermediates on ascorbic acid and

oxalate biosynthesis of rice and in relation to its stress. Plant Physiol. Biochem., 43,

955-962.

Gustin M.C., Albertyn J., Alexander M., Davenport K. (1998) MAP kinase pathways in

the yeast Saccharomyces cerevisiae. Microbiol Mol. Biol. Rev., 62, 1264-1300.

Guy C.L., Huber J.L.A., Huber S.C. (1992) Sucrose phosphate synthase and sucrose

accumulation at low temperature. Plant Physiol. 100, 502-508.

Guy C.L., Niemi K.J., Brambl R. (1985) Altered gene expression during cold acclimation of

spinach. Proc. Natl. Aca. Sci. USA., 82, 3673-3677.

Guye M.G., Vigh L., Wilson J.M. (1986) Polyamine titre in relation to chilling-sensitivity in

Phaseolus sp. J. Exp. Bot. 37, 1036-1043.

Hamer D.H. (1986) Review on plant Metallothionein. Annu. Rev. Biochem. 55, 913-951.

Hamada T., Kodama H., Takeshita K., Utsumi H., Iba K. (1998) Characterization of

transgenic tobacco with an increased- linolenic acid level. Plant Physiol., 118, 591–98.

Hayashi H., Murata N. (1998) Genetically engineered enhancement of salt tolerance in

higher plants, stress responses of photosynthetic organisms. In Satoh K.M.N. Elsevier,

Amsterdam, 133–148.

Hannah M. A., Heyer A.G., Hincha D.K. (2005) A global survey of gene regulation during

cold acclimation in Arabidopsis thaliana. P.Lo.S. Genet, 1, 179-196.

Hara M., Terashima S., Kuboi T. (2001) Characterization and cryoprotective activity of

cold-responsive dehydrin from Citrus unshiu. J. Plant Physiol., 158, 1333–1339.

Hara M., Terashima S., Fukaya T., Kuboi T. (2003) Enhancement of cold tolerance and

inhibition of lipid peroxidation by citrus dehydrin in transgenic tobacco. Planta, 217,

290-298.

Hasegawa P.M., Bressan R.A., Zhu J.K., and Bohnert H.J. (2000) Plant cellular and

molecular responses to high salinity. Plant Physiol., 51, 463–499.

Haq F., Mahoney M., Koropatnick J. (2003) Signaling events for metallothionein

induction. Mutat. Res., 533, 211-226.

Heino P., Sandman G., Lang V., Nordin K., Palva E.T. (1990) Abscisic acid deficiency

prevents development of freezing tolerance in Arabidopsis thaliana. Theor. Appl.

Genet., 79, 801-806.

Heish H. M., Liu W. K., Huang P. C. (1995) A novel stress inducible metallothionin like

gene from rice. Plant Mol. Biol., 28, 381-389.

Henriksson K.N., Trewavas A.J. (2003) The effect of short-term low-temperature treatments

on gene expression in Arabidospis correlates with changes in intracellular Ca2+

levels.

Plant Cell Environ., 26, 485-496.

110

Hiilovaara-Teijo M., Hannukkala A., Griffith M., Yu X.M., Pihakaski-Maunsbach K. (1999) Snow-mold-induced apoplastic proteins in winter rye leaves lack antifreeze

activity. Plant Physiol., 121, 665-674.

Hincha D.K., Schmitt J.M. (1985) Mechanical and chemical injury to thylakoid membranes

during freezing in vitro. Biochim. Biophy. Acta., 812, 173-180.

Hincha D.K., Schmitt J.M. (1992) Freeze-thaw injury and cryoprotection of thylakoid

membranes, comparative analysis of water relationships at the organismic, cellular and

molecular levels. Springer-Verlag, Heidelberg, 316-337.

Hitz W.D., Carlson T.J., Booth R., Kinney A.J., Stecca K.L., (1994) Cloning of a higher-

plant plastid !-6 fatty acid desaturase cDNA and its expression in a cyanobacterium.

Plant Physiol., 105, 635– 41.

Hon W.C., Griffith M., Mlynarz A., Kwok Y.C., Yang D. (1995) Antifreeze Proteins in

Winter Rye Are Similar to Pathogenesis Related Proteins. Plant Physiol., 109, 879-889.

Hong S.W., Vierling E. (2000) Mutants of Arabidopsis thaliana defective in the acquisition

of tolerance to high temperaturestress. Proc. Natl. Acad. Sci. USA., 97, 4392–97.

Hong S.W., Vierling E. (2001) Hsp101 is necessary for heat tolerance but dispensable for

development and germination in the absence of stress. Plant J., 27, 25–35.

Howarth C., Ougham H. (1993) Gene expression under temperature stress. New Phytol.,

125, 1-26.

Huang T., Duman J.G. (2002) Cloning and characterization of a thermal hysteresis

(antifreeze) protein with DNA-binding activity from winter bittersweet nightshade,

Solanum dulcamara. Plant Mol. Biol., 48, 339-350.

Hussain S., Slikker W., Syed F.A. (1996) Role of metallothionin and other antioxidants in

scavenging superoxide radicals and their possible role in neuroprotection.

Neurochemistry International, 29, 145-152.

Hwang B.J., Woo K.M., Goldberg A. L., Chung C. H. (1988) Protease Ti, a new ATP-

dependent protease in Escherichia coli, contains protein-activated ATPase and

proteolytic functions in distinct subunits. J. Biol. Chem., 263, 8727–8734.

Iba K., Gibson S., Nishiuchi T., Fuse T., Nishimura M. (1993) A gene encoding a

chloroplast !-3 fatty acid desaturase complements alterations in fatty acid desaturation

and chloroplast copy number of the fad7 mutant of Arabidopsis thaliana. J. Biol. Chem.,

268, 24099–105.

Ichimura K., Mizoguchi T., Yoshida R., Yuasa T., Shinozaki K. (2000) Various abiotic

stresses rapidly activate Arabidopsis MAP kinases ATMPK4 and ATMPK6. Plant J.,

24, 655-665.

Ingram J., Bartels D. (1996) The molecular basis of cellular dehydration tolerance in plants.

Annu. Rev. Plant. Physiol., 47, 377-403.

111

Ishizaki-Nishizawa O., Fujii T., Azuma M., Sekiguchi K., Murata N., (1996)

Lowtemperature resistance of higher plants is significantly enhanced by a nonspecific

cyanobacterial desaturase. Nat. Biotech., 14, 1003–1006.

Ito Y., Katsura K., Maruyama K., Taji T., Kobayashi M., Seki M., Shinozaki K.,

Yamaguchi-Shinozaki K. (2006) Functional analysis of rice DREB1/CBF-type

transcription factors involved in cold-responsive gene expression in transgenic rice.

Plant Cell Physiol., 47, 141-153.

Jaglo K.R., Kleff S., Amundsen K.L., Zhang X., Haake V., Zhang J.Z., Deits T.,

Thomashow M.F. (2001) Components of the Arabidopsis C-

repeat/dehydrationresponsive element binding factor cold-response pathway are

conserved in Brassica napus and other plant species. Plant Physiol., 127, 910-917.

Jaglo-Ottosen K., Gilmour S.J., Zarka D., Schabenberger O., Thomashow M.F. (1998)

Arabidopsis CBF1 overexpression induce COR genes and enhances freezing tolerance.

Science, 280, 104-106.

Jennings P., Saltveit M.E. (1994) Temperature and chemical shocks induce chilling

tolerance in germinating Cucumis sativus (cv. Poinsett 76) seeds. Physiol. Plant., 91,

703-707.

Jian L., Li., Chen W., Li P.H., Ahlstrand G.G. (1999) Cytochemical Localization of

Calcium and Ca2+-

ATPase Activity in Plant Cells under Chilling Stress: a Comparative

Study between the Chilling-Sensitive Maize and the Chilling- Insensitive Winter Wheat.

Plant Cell Physiol., 40, 1061-1071.

Jiang C., Iu B., Singh J. (1996) Requirement of a CCGAC cis-acting element for cold

induction of the BN115 gene from winter Brassica napus. Plant Mol. Biol., 30, 679-684.

Jiang L.J., Maret W., Vallee B.L. (1998) The glutathione redox couple modulates zinc

transfer from metallothionein to zinc-depleted sorbitol dehydrogenase. Proc. Natl. Acad.

Sci. U.S.A., 95, 3483-3488.

Joel A., Kreps, Yajun Wu, Hur-Song Chang, Tong Zhu, Xun Wang, and Jeff F. Harper.

(2002) Transcriptome changes for arabidopsis in response to salt, osmotic, and cold

stress. Plant Physiology., 130, 2129–2141.

Jonak C., Kiegerl S., Ligterink W., Barker P.J., Huskisson N.S., Hirt H. (1996) Stress

signaling in plants: a mitogen-activated protein kinase pathway is activated by cold and

drought. Proc. Natl. Acad. Sci. USA., 93, 11274-11279.

Kagi J.H.R., Schaffer A. (1988) Biochemistry of metallothioneins. Biochemistry, 27, 8509-

8515.

Kamata T., Uemura M. (2004) Solute accumulation in wheat seedlings during cold

acclimation: Contribution to increased freezing tolerance. Cryoletters, 25, 311-322.

Kasprzewska A. (2003) Plant chitinases--regulation and function. Cell Mol. Biol. Lett., 8(3),

809-24.

112

Katakai K., Liu J., Nakajima K., Keefer L. K., Waalkes M.P. (2001) Nitric oxide induces

metallothionein (MT) gene expression apparently by displacing zinc bound to MT.

Toxicol. Lett., 119, 103–108.

Kille P., Winge D.R., Harwood J.L., Kay J. (1991) A plant metallothionin produced in

E.coli. FEBS Letters, 295, 171-175.

Kim K.N., Cheong Y.H., Grant J.J., Pandey G.K., Luan S. (2003) CIPK3, a calcium

sensorassociated protein kinase that regulates abscisic acid and cold signal transduction

in Arabidopsis. Plant Cell, 15, 411-423.

Knight C.A., DeVries A.L., Oolman L.D. (1984) Fish antifreeze protein and the freezing

and recrystallization of ice. Nature, 208, 295-296.

Knight C.A., Wen D.Y., Laursen R.A. (1995) Nonequilibrium antifreeze peptides and the

recrystallization of ice. Cryobiology, 32, 23–34.

Knight H., Knight M.R. (2000) Imaging spatial and cellular characteristics of low

temperature calcium signature after cold acclimation in Arabidopsis. J. Exp. Bot., 51,

1679-1686.

Knight H., Trewavas A.J., Knight M.R. (1996) Cold calcium signaling in Arabidopsis

involves two cellular pools and a change in calcium signature after acclimation. Plant

Cell, 8, 489-503.

Knight M.R., Campbell A.K., Smith S.M., Trewavas A.J. (1991) Transgenic plant

aequorin reports the effects of touch and cold-shock and elicitors on cytoplasmic

calcium. Nature, 352, 524–526.

Ko J.H., Yanh S.H., Han K.H. (2006) Up regulation of an Arabidopsis RING-H2 gene,

XERICO, confers drought tolerance through increased abscisic acid biosynthesis. Plant

J., 47, 343-355.

Kocsy G., Szalai G., Vagujfalvi A., Stehli L., Orosz G., Galiba G. (2000) Inhibition of

glutathione synthesis reduces chilling tolerance in maize. Planta, 211, 528-536.

Kodama H., Hamada T., Horiguchi G., Nishimura M., Iba K. (1994) Genetic

enhancement of cold tolerance by expression of a gene for chloroplast !-3 fatty acid

desaturase in transgenic tobacco. Plant Physiol., 105, 601–605.

Kodama H., Horiguchi G., Nishiuchi T., Nishimura M., Iba K. (1995) Fatty acid

desaturation during chilling acclimation is one of the factors involved in conferring low-

temperature tolerance to young tobacco leaves. Plant Physiol., 107, 1177–85.

Koh I. (2002) Acclimative response to temperature Stress in higher plants: Approaches of

Gene Engineering for Temperature Tolerance. Annu. Rev. Plant Biol., 53, 225–245.

Kojima Y. (1991) Nomenclature of Metallothionin: proposal. Methods Enzymol., 205, 8-10.

113

Kovtun Y., Chiu W.L., Tena G., Sheen J. (2000) Functional analysis of oxidative

stressactivated mitogen-activated protein kinase cascade in plants. Proc. Natl. Acad. Sci.

USA., 97, 2940-2945.

Kovtun Y., Chiu W.L., Zeng W., Sheen J. (1998) Suppression of auxin signal transduction

by a MAPK cascade in higher plants. Nature, 395, 716-720.

Krezel A., Hao Q., Maret W. (2007) The zinc/thiolate redox biochemistry of metallothionein

and the control of zinc ion fluctuations in cell signaling. Plant Physiol., 105, 601–605.

Kyohei S., Matsuo U., Seiji T., Abidur R.,

(2009) Auxin Response

in Arabidopsis under Cold Stress: Underlying Molecular Mechanisms. The Plant Cell ,

21, 3823-3838.

Lafuente M.T., Belver A., Guye M.G., Saltveit M. (1991) Effect of temperature

conditioning on chilling injury of cucumber cotyledons. Plant Physiol., 95, 443-449.

Lam J.D., Arteca R.N., Pell E.J. (2006) Senescence associated gene expression during

ozone induced leaf senescence in Arabidopsis. Plant Physiology, 120, 1015-1023.

Lane B.G., Kajioka R., Kennedy T.D. (1987) The wheat germ Ec protein is a zinc

containing metallothionein. Biochemistry of cell Biology, 65, 1001-1005.

Lee J.H., Ubel A., Sch F. (1995) Derepression of the activity of genetically engineered heat

shock factor causes constitutive synthesis of heat shock proteins and increased

thermotolerance in transgenic Arabidopsis. Plant J., 8, 603–12.

Lee T.M. (1997) Polyamine regulation of growth and chilling tolerance of rice (Oryza sativa

L.) roots cultured in vitro. Plant Sci., 122, 111-117.

Lee B., David A., Jian zhu. (2005) The Arabidopsis cold responsive transcriptome and it‟s re

gulation by ICE1. The Plant Cell, 17, 3155-3175.

Leon J., Rojo E., Titarenko E., Sanchez Sessano J.J. (1998) Jasmonic acid dependent and

independent wound signal transduction pathways are differentially regulate by

Ca++

/calmodulin in Arabidopsis thaliana. Molecular and general studies, 258, 412-419.

Leon W. Neuteboom, Jessica M. Y. N., Marko Kuyper, Olton R. Clijdesdale, Paul J. J.

Hooykaas and Bert J. Van Der Zaal. (1999) Isolation and characterization of cDNA

clone corresponding with mRNA that accumulates during Auxin induced lateral root

formation. Plant Mol. Bio., 39, 273-281.

Leshem Y., Kuiper P. (1996) Is there a GAS (general adaption syndrome) response to

various types of environmental stress. Biol. Plant., 38, 1-18.

Levitt J. (1980) Responses of plants to environmental stresses. 2nd ed. Academic Press, New

York, NY.

114

Li Q.B., Haskell D.W., Guy C.L. (1999) Coordinate and non-coordinate expression of the

stress 70 family and other molecular chaperones at high and low temperature in spinach

and tomato. Plant Mol. Biol., 39, 21-34.

Liu Q., Kasuga M., Sakuma Y., Abe H., Miura S., Yamaguchi-Shinozaki K., Shinozaki

K. (1998) Two transcription factors, DREB1 and DREB2, with an EREBP/AP2 DNA

binding domain separate two cellular signal transduction pathways in drought- and low-

temperature-responsive gene expression, respectively, in Arabidopsis. Plant Cell, 10,

1391-1406.

Liu M., Lu C., Shen X. Yin W. (2006) Characterization and function analysis of a cold-

induced AmCIP gene encoding a dehydrin-like protein in Ammopiptanthus

Mitochondrial DNA. The Journal of DNA Mapping, Sequencing, and Analysis, 5, 342 –

349.

Lois R. (1994) Accumulation of UV-absorbing flavonoids induced by UV-B radiation

inAmbidopsis thaliana L.Planta., 194, 498-503.

Los D.A., Horvath I., Vigh L., Murata N. (1993) The temperature-dependent expression of

the desaturase gene desA in Synechocystis PCC6803. FEBS Lett., 318, 57.

Lurie S., Klein J.D., Fallik E. (1994) Cross protection of one stress by another, Biochemical

and cellular mechanisms of stress Tolerance of Plants. Springer Verlag Berlin, 201-212.

Lynch D.V., Steponkus P. (1987) Plasma membrane lipid alterations associated with cold

acclimation of winter rye seedlings (Secale cereale L. cv Puma). Plant Physiol., 83,761.

Marentes E., Griffith M., Mlynarz A., Brush R.E. (1993) Proteins accumulate in the

apoplast of winter rye leaves during cold acclimation. Physiol. Plant., 87, 499–507.

Marıa A., Pintor T., Cubero B. (2006) Transgenic Tobacco Plants Overexpressing

Chitinases of Fungal Origin Show Enhanced Resistance to Biotic and Abiotic Stress

Agents. Plant Physiology, 142, 722–730.

Maruyama K., Sakuma Y., Kasuga M., Ito Y., Seki M., Goda H., Shimada Y., Yoshida

S., Shinozaki K., Yamaguchi-Shinozaki K. (2004) Identification of cold-inducible

downstream genes of the Arabidopsis DREB1A/CBF3 transcriptional factor using two

microarray systems. Plant J., 38, 982-993.

Mason H.S., Mullet, J.E. (1990) Expression of Two Soybean Vegetative Storage Protein

Genes during Development and in Response to Water Deficit, Wounding, and Jasmonic

Acid. Plant Cell, 2, 569-579.

McConn M., Hugly S., Browse J., Somerville C. (1994) A mutation at the fad8 locus of

Arabidopsis identifies a second chloroplast !-3 desaturase. Plant Physiol., 106, 1609–

1614.

McKersie B.D. (1991) The role of oxygen free radicals and desiccation stress in plants.

American Society of Plant Physiologists, 107-118.

115

McKersie B.D., Chen Y., de Beus M., Bowley S.R., Bowler C., Inze D., D'Halluin K.,

Botterman J. (1993) Superoxide dismutase enhances tolerance of freezing stress in

transgenic alfalfa (Medicago sativa L.). Plant Physiol., 103, 1155-1163.

McKown R., Kuroki G., Warren G. (1996) Cold responses of Arabidopsis mutants

impaired in freezing tolerance. J. Exp. Bot., 47, 1919-1925.

Miernyk J.A., Hayman G.T. (1996) ATPase activity and molecular chaperone function of

the stress70 proteins. Plant Physiol., 110, 419–24.

Minami A., Nagao M., Ikegami K., Koshiba T., Arakawa K., Fujikawa S., Takezawa D.

(2005) Cold acclimation in bryophytes: low-temperature-induced freezing tolerance in

Physcomitrella patens is associated with increases in expression levels of stress-related

genes but not with increase in level of endogenous abscisic acid. Planta, 220, 414-423.

Mittler R., Vanderauwera S., Gollery M., Van Breusegem F. (2004) Reactive oxygen gene

network of plants. Trends Plant. Sci., 9, 490-498.

Mizoguchi T., Irie K., Hirayama T., Hayashida N., Yamaguchi-Shinozaki K.,

Matsumoto K, Shinozaki K. (1996) A gene encoding a mitogen-activated protein

kinase kinase kinase is induced simultaneously with genes for a mitogen-activated

protein kinase and an S6 ribosomal protein kinase by touch, cold, and water stress in

Arabidopsis thaliana. Proc. Natl. Acad. Sci. US A., 93, 765-769.

Monroy A.F., Dhindsa R.S. (1995) Low-temperature signal transduction: induction of cold

acclimation-specific genes of alfalfa by calcium. Plant Cell, 7, 321-331.

Monroy A.F., Sarhan F., Dhindsa R.S. (1993) Cold-induced changes in freezing tolerance,

protein phosphorylation, and gene expression (evidence for a role of calcium). Plant

Physiol., 102, 1227-1235.

Moon B.Y., Higashi S., Gombos Z., Murata N. (1995) Unsaturation of the membrane lipids

of chloroplasts stabilizes the photosynthetic machinery against lowtemperature

photoinhibition in transgenic tobacco plants. Proc. Natl. Acad. Sci. USA., 92, 6219–

6123.

Morimoto R.I., Tissieres A., Georgopoulos C. (1994) The Biology of Heat Shock Proteins

and Molecular Chaperones. Cold Spring Harbor Lab. Press. NewYork, 1–30.

Moyen C., Johannes E. (1996) Systemin transiently depolarizes the tomato mesophyll cell

membrane and antagonizes fusiccocin-induced extracellular acidification of mesophyll

tissue. Plant, Cell and Environment, 19, 463-470.

Mukhopadhyay S., Tyagi A.K. (2004) Overexpression of a zinc figure protein gene from

rice confers tolerance to cold, dehydration and salt stress in transgenic tobacco. Proc.

Natl. Acad. Sci. USA., 101, 6309-6314.

Munoz F.J., Ullan R.V., Labrador E., Dopico B. (1998) Increased expression of two

cDNAs encoding metallothionin like proteins during growth of Cicer arietinum

epicotyls. Physiol. Plant., 104, 273-279.

116

Murakami Y., Tsuyama M., Kobayashi Y., Kodama H., Iba K. (2000) Trienoic

fattyplastid 1-3 fatty acid desaturases in defense response of higher plants. J. Plant Res.

111, 481–86.

Murata N., Ishizaki-Nishizawa O., Higashi S., Hayashi H., TasakaY. (1992) Genetically

engineered alteration in the chilling sensitivity of plants. Nature, 356, 710–13.

Murata N., Los D.A. (1997) Membrane Fluidity and Temperature Perception. Plant Physiol.,

115, 875-879.

Murphy A., Zhou J., Goldsbrough P.B., Taiz L. (1997) Purification and immunological

identification of metallothioneins 1 and 2 from Arabidopsis thaliana. Plant Physiol.,

113, 1293-1301.

Muthalif M.M., Rowland L.J. (1994) Identification of dehydrin-like proteins responsive to

chilling in floral buds of blueberry (Vaccinium, section Cyanococcus). Plant Physiol.,

104, 1439-1447.

Nagao M., Minami A., Arakawa K., Fujikawa S., Takezawa D. (2005) Rapid degradation

of starch in chloroplasts and concomitant accumulation of soluble sugars associated with

ABA-induced freezing tolerance in the moss Physcomitrella patens. J Plant Physiol.,

162, 169-180.

Nanjo T., Kobayashi M., Yoshiba Y., Kakubari Y., Yamaguchi-Shinozaki K., Shinozaki

K. (1999). Antisense suppression of proline degradation improves tolerance to freezing

and salinity in Arabidopsis thaliana. FEBS Lett., 461, 205-210.

Nover L., Scharf K.D. (1997) Heat stress proteins and transcription factors. Cell Mol. Life

Sci., 53, 80-103.

Novillo F., Alonso J.M., Ecker J.R., Salinas J. (2004) CBF2/DREB1C is a negative

regulator of CBF1/DREB1B and CBF3/DREB1A expression and plays a central role in

stress tolerance in Arabidopsis. Proc. Natl. Acad. Sci. USA., 101, 3985-3990.

O’Donnell P.J., Calvert C., Atzorn R., Wasternack C., Leyser H.M.O., Bowles D.J.

(1996) Ethylene as a signal mediating the wound response of tomato plants. Science,

274, 1914-1917.

O'Kane D., Gill V., Boyd P., Burdon R. (1996) Chilling, oxidative stress and antioxidant

responses in Arabidopsis thaliana callus. Planta, 198, 371-377.

Okuley J., Lightner J., Feldmann K., Yadav N., Lark E., Browse J. (1994) Arabidopsis

FAD2 gene encodes the enzyme that is essential for polyunsaturated lipid synthesis.

Plant Cell, 6, 147–58.

Orvar B.L., Sangwan V., Omann F., Dhindsa R.S. (2000) Early steps in cold sensing by

plant cells: the role of actin cytoskeleton and membrane fluidity. Plant J., 23, 785- 794.

Pearce G., Strydom D., Johnson S., Ryan C.A. (1991) A polypeptide from tomato leaves

induces wound inducible proteinase inhibitor proteins. Science, 253, 895-898.

117

Pearce R.S. (2001) Plant Freezing and Damage. Annals of Botany, 87, 417-424.

Pena-Cortes H., Sanchez-Serrano J.J., Mertens R., Willmitzer L. (1989) Abscisic acid is

involved in the wound induced expression of proteinase inhibitor II gene in potato and

tomato. Proc. Nat. Acad. Sci. USA., 86, 9851-9855.

Perl A., Perl-Treves R., Galili G., Aviv D., Shalgi E., Malkin S., Galun E. (1993)

Enhanced oxidative stress defense in transgenic potato expressing tomato Cu, Zn

superoxide dismutases. Theor. Appl. Genet. 85, 568-576.

Plieth C. (1999) Temperature sensing by plants: calcium-permeable channels as primary

sensors-a model. J. Membr. Biol., 172, 121-127.

Porankiewicz J., Wang J., Clarke A.K. (1999) New insights into the ATP-dependent Clp

protease: Escherichia coli and beyond. Mol. Microbiol. 32, 449–458.

Prasad T.K. (1996) Mechanisms of chilling-induced oxidative stress injury and tolerance in

developing maize seedlings: changes in antioxidant system, oxidation of proteins and

lipids, and protease activities. Plant. J., 10, 1017-1026.

Prasad T.K., Anderson M.D., Martin B.A., Stewart C.R. (1994) Evidence for chilling-

induced oxidative stress in maize seedlings and a regulatory role for hydrogen peroxide.

Plant Cell, 6, 65 74.

Puhakainen T., Hess M.W., Makela P., Svensson J., Heino P., Palva E.T. (2004)

Overexpression of multiple dehydrin genes enhances tolerance to freezing stress in

Arabidopsis. Plant Mol. Biol., 54, 743-753.

Quinn P.J., Williams W.P. (1983) The structural role of lipids in photosynthetic membranes.

Biochim. Biophys. Acta., 737, 223–66.

Rabbani M.A., Maruyama K., Abe H., Khan M.A., Katsura K., Ito Y., Yoshiwara K.,

Seki M., Shinozaki K., Yamaguchi-Shinozaki K. (2003) Monitoring expression

profiles of rice genes under cold, drought, and high-salinity stresses and abscisic acid

application using cDNA microarray and RNA gel-blot analyses. Plant Physiol., 133,

1755-1767.

Ramanulu S., Bartels D. (2002) Drought- and desiccation-induced modulation of gene

expression in plants. Plant Cell Environ., 25, 141-151.

Reid S.J., Ross G.S. (1997) Up-regulation of two cDNA clones encoding metallothionin-like

proteins in apple fruit during cool storage. Physiol. Plant., 100, 183-189.

Rinne P.L., Kaikuranta P.L., van der Plas L.H., van der Schoot C. (1999) Dehydrins in

coldacclimated apices of birch (Betula pubescens ehrh.): production, localization and

potential role in rescuing enzyme function during dehydration. Planta, 209, 377-388.

Roberts D.R., Dumdroff E.B., Thompson J.E. (1986) Exogenous polyamines alter

membrane fluidity in bean leaves: a basis for potential misinterpretation of their true

physiological role. Planta, 167, 395-401.

118

Robinson N.J., Tommey A.M., Kuske C., Jackson P.J. (1993) Plant metallothioneins.

Biochem. J., 295, 1-10.

Rock C. (2000) Pathways to abscisic acid-regulated gene expression. New Phytol., 148, 357-

396.

Rudolph A.S., Crowe J.H. (1985) Membrane stabilization during freezing: the role of two

natural cryoprotectants, trehalose and proline. Cryobiology, 22, 367-377.

Sabehat A., Lurie S., Weiss D. (1998) Expression of small heat-shock proteins at low

temperatures, A possible role in protecting against chilling injuries. Plant Physiol., 117,

651-658.

Sakai A., Yoshida S. (1968) The role of sugar and related compoundsin variations of freezing

resistance. Cryobiol., 5, 160-174.

Sakamoto T., Bryant D.A. (1997) Temperature-regulated mRNA accumulation and

stabilization for fatty acid desaturase genes in the cyanobacterium Synechococcus sp.

strain PCC 7002. Mol. Microbiol., 23, 1281.

Sambrook J., Fritsch E.F., Maniatis T. (1989) Molecular cloning: a laboratory manual. New

York:Cold Spring Harbor Laboratory Press.72-74.

Sangwan V., Foulds I., Singh J., Dhindsa R.S. (2001) Cold-activation of Brassica napus

BN115 promoter is mediated by structural changes in membranes and cytoskeleton, and

requires Ca2+

influx. Plant J., 27, 1-12.

Santamaria I., Velasco G., Pendas A. M., Fueyo A., Lopez-Otin C. (1998) J. Biol. Chem.,

273, 16816–16823.

Sasaki H., Ichimura K., Oda M. (1996) Changes in sugar content during cold acclimation

and deacclimation of cabbage seedlings. Annal. Bot., 78, 365-369.

Sato N., Murata N. (1980) Temperature shift induced responses in lipids in the blue-green

alga, Anabaena variabilis: The central role of diacylmonogalactosylglycerol in thermo-

adaptation. Biochi. Biophy. Acta., 619, 353-358.

Scorza R., Ashworth E.N., Bell R.L., Lightner G.W. (1983) Sampling for field evaluation

of peach and nectarine flower bud survival Prunus persica, statistics, winter hardiness. J.

Amer. Soc. Hort. Sci., 108, 747-750.

Sen Gupta A., Heinen J.L., Holoday A.S., Burke J.J., Allen R.D. (1993) Increased

resistance to oxidative stress in transgenic plants that overexpress Chloroplastic Cu/Zn

superoxide dismutase. Proc. Natl. Acad. Sci. USA., 90, 1629-1633.

Shanklin J., Cahoon E.B. (1998) Desaturation and related modifications of fatty acids. Annu.

Rev. Plant Physiol., 49, 611–41.

Shen W., Nada K., Tachibana S. (2000) Involvement of polyamines in the chilling tolerance

of cucumber cultivars. Plant Physiol., 124, 431-440.

119

Shinozaki K., Yamaguchi-Shinozaki K. (2000) Molecular responses to dehydration and low

temperature: differences and cross-talk between two stress signaling pathways. Curr.

Opin. Plant. Biol., 3, 217-223.

Shinwari Z.K., Nakashima K., Miura S., Kasuga M., Seki M., Yamaguchi-Shinozaki K.,

Shinozaki K. (1998) An Arabidopsis gene family encoding DRE/CRT binding proteins

involved in low-temperature-responsive gene expression. Biochem. Biophys. Res.

Commun. 250, 161-170.

Shou H., Bordallo P., Fan J.B., Yeakley J.M., Bibikova M., Sheen J., Wang K. (2004)

Expression of an active tobacco mitogen-activated protein kinase kinase kinase

enhances freezing tolerance in transgenic maize. P.N.A.S., 101, 3298-3303.

Singh S., Anandhan S., Arun M.B., Goyary D., Singh N.K. and Das S.C. (2007) In vitro

establishment of Cicer microphyllum, a wild relative of cultivated ckickpea from cold

desert of Ladakh. Journal of Arid Legumes, 4(1), 66-68.

Skinner J.S., Szucs P., von Zitzewitz .J, Marquez-Cedillo L., Filichkin T., Stockinger

E.J., Thomashow M.F., Chen T.H., Hayes P.M. (2006) Mapping of barley homologs

to genes that regulate low temperature tolerance in Arabidopsis. Theor. Appl. Genet.,

112, 832-842.

Skinner J.S., von Zitzewitz J., Szucs P., Marquez-Cedillo L., Filichkin T., Amundsen K.,

Stockinger E.J., Thomashow M.F., Chen T.H., Hayes P.M. (2005) Structural,

functional, and phylogenetic characterization of a large CBF gene family in barley.

Plant. Mol. Biol., 59, 533-551.

Skinner M., Trempy J., (2001) Expression of clpX, an ATPase subunit of the Clp Protease,

is heat and cold shock inducible in Lactococcus lactis. J. Dairy Sci., 84, 1783–1785.

Smirnoff N., Cumbes Q.J. (1989) Hydroxyl radical scavenging activity of compatible

solutes. Phytochemistry, 28, 1057-1060.

Smith T.A. (1985) Polyamines. Annu. Rev. Plant. Physiol., 36, 117-143.

Smolenska G., Kuiper P., (1977) Effect of low temperature upon lipid and fatty acid

composition of roots and leaves of winter rape plants. Physiol. Plant., 41, 29–35.

Snowden K., Gardner R., (1993) Five genes induced by alluminium in wheat (Triticum

aestivum L.) roots. Plant Physiol., 103, 855-861.

Somerville C., Browse J. (1991) Plant lipids: metabolism, mutants, and membranes. Science,

252, 80–87.

Steponkus P. (1984) Role of the plasma membrane in freezing injury and cold acclimation.

Annu. Rev. Plant. Physiol., 35, 543-584.

Steponkus P.L., Uemura M., Balsamo R.A., Arvinte T. (1988) Transformation of the

cryobehavior of rye protoplasts by modification of the plasma membrane lipid

composition. Pro.c Natl. Acad. Sci. USA., 85, 9026-9030.

120

Steponkus P.L., Uemura M., Joseph R.A., Gilmour S.J., Thomashow M.F. (1998) Mode

of action of the COR15a gene on the freezing tolerance of Arabidopsis thaliana. Proc.

Natl. Acad. Sci. USA., 95, 14570-14575.

Steponkus P.L., Uemura M., Webb M.S. (1993) A contrast of the cryostability of the

plasma membrane of winter rye and spring oat. Two species that widely differ in their

freezing tolerance and plasma membrane lipid composition. Advances in low

temperature biology. JAI Press, London, 211-312.

Sthapit B.R., Witcombe J.R. (1998) Inheritance of Tolerance to Chilling Stress in Rice

during Germination and Plumule Greening. Crop Science, 38, 76-82.

Stitt M., Hurry V. (2002) A plant for all seasons: alterations in photosynthetic carbon

metabolism during cold acclimation in Arabidopsis. Curr. Opin. Plant. Biol., 5, 199-

206.

Stockinger E.J., Gilmour S.J., Thomashow M.F. (1997) Arabidopsis thaliana CBF1

encodes an AP2 domain-containing transcriptional activator that binds to the

Crepeat/DRE, a cis-acting DNA regulatory element that stimulates transcription in

response to low temperature and water deficit. Proc. Natl. Acad. Sci. USA., 94, 1035-

1040.

Strand A., Hurry V., Henkes S., Huner N., Gustafsson P., Gardestrom P., and Stitt M. (1999) Acclimation of Arabidopsis leaves developing at low temperatures. Increasing

cytoplasmic volume accompanies increased activities of enzymes in the Calvin cycle

and in the sucrose-biosynthesis pathway. Plant Physiol., 119, 1387-1398.

Strauss G., Hauser H. (1986) Stabilization of lipid bilayer vesicles by sucrose during

freezing. Proc. Natl. Acad. Sci. USA., 83, 2422-2426.

Sugino M., Hibino T., Tanaka Y., Nii N., Takabe T., (1999) Overexpression of DnaK from

a halotolerant cyanobacterium Aphanothece halophytice acquires resistance to salt stress

in transgenic tobacco plants. Plant Sci., 137, 81–88.

Sukumaran N.P., Weiser C.J. (1972) Freezing injury in potato leaves. Plant Physiol., 50,

564-567.

Sun W., Bernard C., von de Cotte B., Van Montagu M., Verbruggen N. (2001) At-

HSP17.6A, encoding a small heat-shock protein in Arabidopsis, can enhance

osmotolerance upon overexpression. Plant J., 27, 407–15.

Tahtiharju S., Sangwan V., Monroy A.F., Dhindsa R.S., Borg M. (1997) The induction of

kin genes in cold-acclimating Arabidopsis thaliana. Evidence of a role for calcium.

Planta, 203, 442-447.

Tajima K., Amemiya A., Kabaki N. (1983) Physiological study of growth inhibition in rice

plant as affected by low temperature, Physiological mechanism and varietal difference

of chilling injury in rice plant. Bull. Natl. Inst. Agr. Sci., D34, 69-111.

121

Takumi S., Koike A., Nakata M., Kume S., Ohno R., Nakamura C. (2003) Cold-specific

and light-stimulated expression of a wheat (Triticum aestivum L.) Cor gene Wcor15

encoding a chloroplast-targeted protein. J. Exp. Bot., 54, 2265-2274.

Tasseva G., Davy de Virville J., Cantrel C., Moreau F., Zachowski A. (2004) Changes in

the endoplasmic reticulum lipid properties in response to low temperature in Brassica

napus. Plant Physiol. Biochem., 42, 811-822.

Taylor A.O., Slack C.R., McPherson H.G. (1974) Plants under climatic stress. VI. Chilling

and light effects on photosynthetic enzymes of sorghum and maize. Plant Physiol., 54,

696-701.

Teige M., Scheikl E., Eulgem T., Doczi R., Ichimura K., Shinozaki K., Dangl J.L., Hirt

H. (2004) The MKK2 pathway mediates cold and salt stress signaling in Arabidopsis.

Mol. Cell., 15, 141-152.

Terrados J., Lopez-Jimenez J.A. (1996) Fatty acid composition and chilling resistance in

the green alga Caulerpa prolifera (Forrskal) Lamouroux (Chlorophyta, Caulerpales).

Biochem. Mol. Biol. Int., 39, 863-869.

Thain J.F., Gubb I.R., Wildon D.C. (1995) Depolarization of tomato leaf cells by

oligogalacturonide elicitors. Plant, Cell and Environment., 18, 211-214.

Thomashow M. (1994) Arabidopsis thaliana as a model for studying mechanisms of plant

cold tolerance. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 807-

834.

Thomashow M. (1999) Plant cold acclimation: Freezing tolerance genes and regulatory

mechanisms. Annu. Rev. Plant. Physiol., 50, 571-599.

Tort J., Brindley P.J., Knox D., Wolfe K.H., and Dalton J. P. (1999) Proteinases and

associated genes of parasitic helminths. Adv. Parasitol., 43, 161–266.

Tottempudi K. P. (1997) Role of Catalase in lnducing Chilling Tolerance in Pre-Emergent

Maize Seedlings. Plant Physiol., 114, 1369-1 376.

Tremblay K., Ouellet F., Fournier J., Danyluk J., Sarhan F. (2005) Molecular

characterization and origin of novel bipartite cold-regulated ice recrystallization

inhibition proteins from cereals. Plant Cell Physiol., 46 (6), 884–891.

Trevaskis B., Hemming M.N., Dennis E.S., Peacock W.J. (2007) The molecular basis of

vernalization-induced flowering in cereals. Trends Plant Sci., 12, 352-357.

Uemura M., Joseph R.A., Steponkus P.L. (1995) Cold Acclimation of Arabidopsis thaliana

(Effect on Plasma Membrane Lipid Composition and Freeze-Induced Lesions). Plant

Physiol., 109, 15-30.

Uemura M., Steponkus P.L. (1997) Effect of Cold Acclimation on the Lipid Composition of

the Inner and Outer Membrane of the Chloroplast Envelope Isolated from Rye Leaves.

Plant Physiol., 114, 1493-1500.

122

Urao T., Yamaguch-Shinozaki M., Urao S., Yamaguch-Shinozaki K. (1993) An

Arabidopsis myb homolog is induced by dehydration stress and it‟s gene product binds

to the conserved MYB recognition sequence. Plant Cell., 5, 1529-1539.

Urrutia M.E., Duman J.G. and Knight C.A. (1992) Plant thermal hysteresis proteins.

Biochim. Biophys. Acta., 1121, 199-206.

Usadel B., Blasing O.E., Gibon Y., Poree F., Hohne M., Gunter M., Trethewey R.,

Kamlage B., Poorter H., Stitt M. (2008) Multilevel genomic analysis of the response

of transcripts, enzyme activities and metabolites in Arabidopsis rosettes to a progressive

decrease of temperature in the non-freezing range. Plant Cell Environ., 31, 518-547.

Van Camp W. (1996) Enhancement of oxidative stress tolerance in transgenic tobacco plants

overproducing Fe-superoxide dismutase in chloroplasts. Plant Physiol., 112, 1703-1714.

Vaultier M.N., Cantrel C., Vergnolle C., Justin A.M., Demandre C., Benhassaine-Kesri

G., Cicek D., Zachowski A., Ruelland E. (2006) Desaturase mutants reveal that

membrane rigidification acts as a cold perception mechanism upstream of the

diacylglycerol kinase pathway in Arabidopsis cells. FEBS Lett., 580, 4218-4223.

Vazquez-Tello A., Ouellet F., Sarhan F. (1998) Low temperature-stimulated

phosphorylation regulates the binding of nuclear factors to the promoter of Wcs120, a

cold-specific gene in wheat. Mol. Gen. Genet., 257, 157-166.

Vézina L., Ferullo J., Laliberte G., Laberge S., Willemot C. (1997) Chilling and freezing

in plants. Plant Ecophysiology., 5, 61-100.

Vierheller T.L., Smith I.K. (1990) Effect of chilling on glutathione reductase and total

glutathione in soybean leaves (Glycine max (L) Merr). SPB Academic Publishing., The

Hague, 261-265.

Vigh L., Los D.A., Horvath I., Murata N. (1993) The primary signal in the biological

perception of temperature: Pd-catalyzed hydrogenation of membrane lipids stimulated

the expression of the desA gene in Synechocystis PCC6803. Proc. Natl. Acad. Sci.

USA., 90, 9090-9094.

Vogel J.T., Zarka D.G., Van Buskirk H.A., Fowler S.G., Thomashow M.F. (2005) Roles

of the CBF2 and ZAT12 transcription factors in configuring the low temperature

transcriptome of Arabidopsis. Plant J., 41, 195-211.

Volger H., Heber U., Berzborn R.J. (1978) Loss of function of biomembranes and

solubilization of membrane proteins during freezing. Biochim. Biophy. Acta., 511, 455-

469.

Wample R.L., Hartley S., Mills L. (2000) Dynamics of grapevine cold hardiness.

Proceedings of the ASEV 50th Anniversary Meeting, Seattle, Washington., 81-93.

Wang C.Y. (1995) Temperature preconditioning affects glutathione content and glutathione

reductase activity in chilled zucchini squash. J. Plant Physiol., 145, 148-152.

123

Warren G., McKown R., Marin A., Teutonico R. (1996) Isolation of mutations affecting

the development of freezing tolerance in Arabidopsis thaliana (L.) Heynh. Plant

Physiol., 111, 1011–1019.

Webb M.S., Uemura M., Steponkus P.L. (1994) A Comparison of Freezing Injury in Oat

and Rye: Two Cereals at the Extremes of Freezing Tolerance. Plant Physiol., 104, 467-

478.

Welin B.A., Olson A., Nylander M., Palva E.T. (1994) Characterization and differential

expression of dhn/lea/rab-like genes during cold acclimation and drought stress in

Arabidopsis thaliana. Plant Mol. Biol., 26, 131–144.

Willemot C., Hope H.J., Williams R.J., Michaud R. (1977) Changes in fatty acid

composition of winter wheat during frost hardening. Cryobiology, 14, 87–93.

Wise R.R., Naylor A.W. (1987) Chilling-enhanced photooxidation, The peroxidative

destruction of lipids during chilling injury to photosynthesis and ultrastructure. Plant

Physiol., 83, 272-277.

Wisniewski M., Webb R., Balsamo R., Close T.J., Yu X.M., Griffith M. (1999)

Purification, immunolocalization, cryoprotective, and antifreeze activity of PCA60: A

dehydrins from peach (Prunus persica). Physiol. Plant., 105, 600-608.

Wolber P.K., Deininger C.A., Southworth M.W., Vandekerckhove J., Montagu M.,

Warren G.J. (1986) Identification and purification of a bacterial ice-nucleation protein.

Proc. Natl. Acad. Sci. USA., 83, 7256-7260.

Worrall D., Elias L., Ashford D., Smallwood M., Sidebottom C., Lillford P., Telford J.,

Holt C. and Bowles D. (1998) A carrot leucine-rich-repeat protein that inhibits ice

recrystallization. Science., 282, 115-7.

Xiang Y, Huang Y, Xiong L. (2007) Characterization of stress-responsive CIPK genes in

rice for stress tolerance improvement. Plant Physiol., 144, 1416-1428.

Xin Z., Browse J. (1998) eskimo1 mutants of Arabidopsis are constitutively freezingtolerant.

Proc. Natl. Acad. Sci. USA., 95, 7799–7804.

Xin Z., Browse J. (2000) Cold comfort farm: The acclimation of plants to freezing

temperatures. Plant Cell and Environment., 23, 893-902.

Xing W.B., Rajashekar C.B. (2001) Glycine betaine involvement in freezing tolerance and

water stress in Arabidopsis thaliana. Environ. Exp. Bot., 46, 21-28.

Xiong L., Lee B., Ishitani M., Lee H., Zhang C., Zhu J.K. (2001) FIERY1 encoding an

inositol polyphosphate 1-phosphatase is a negative regulator of abscisic acid and stress

signaling in Arabidopsis. Genes Dev., 15, 1971-1984.

Xiong L., Lee H., Huang R., Zhu J.K. (2004) A single amino acid substitution in the

Arabidopsis FIERY1/HOS2 protein confers cold signaling specificity and lithium

tolerance. Plant J., 40, 536-545.

124

Xiong L., Zhu J.K. (2002) Molecular and genetic aspects of plant responses to osmotic

stress. Plant Cell Environ., 25, 131–139.

Xu H., Griffith M., Patten C.L., Glick B.R. (1998) Isolation and characterization of an

antifreeze protein with ice nucleation activity from the plant growth promoting

rhizobacterium Pseudomonas putida GR12- 2. Can. J. Microbiol., 44, 64-73.

Yamaguchi-Shinozaki K., Shinozaki K. (1993) The plant hormone abscisic acid mediates

the drought-induced expression but not the seedspecific expression of rd22, a gene

responsive to dehydration stress in Arabidopsis thaliana. Mol. Gen. Genet., 238, 17-25.

Yamaguchi-Shinozaki K., Shinozaki K. (1994) A novel cis-acting element in an

Arabidopsis gene is involved in responsiveness to drought, lowtemperature, or high-salt

stress. Plant Cell., 6, 251-264.

Yan L., Fu D., Li C., Blechl A., Tranquilli G., Bonafede M., Sanchez A., Valarik M.,

Yasuda S., Dubcovsky J. (2006) The wheat and barley vernalization gene VRN3 is an

orthologue of FT. Proc. Natl. Acad. Sci. USA., 103, 19581-19586.

Yan L., Loukoianov A., Blechl A., Tranquilli G., Ramakrishna W., SanMiguel P.,

Bennetzen J.L., Echenique V., Dubcovsky J. (2004) The wheat VRN2 gene is a

flowering repressor down-regulated by vernalization. Science, 303, 1640-1644.

Yan L., Loukoianov A., Tranquilli G., Helguera M., Fahima T., Dubcovsky J. (2003)

Positional cloning of the wheat vernalization gene VRN1. Proc. Natl. Acad. Sci. USA.,

100, 6263-6268.

Yancey P.H., Clark M.E., Hand S.C., Bowlus R.D., Somero G.N. (1982) Living with water

stress: evolution of osmolyte systems. Science, 217, 1214–1222.

Yeh S., Moffatt B.A., Griffith M., Xiong F., Yang D.S., Wiseman S.B., Sarhan F.,

Danyluk J., Xue Y.Q., Hew C.L., Doherty-Kirby A., Lajoie G. (2000) Chitinase

genes responsive to cold encode antifreeze proteins in winter cereals. Plant Physiol.,

124, 1251-1264.

Yelenosky G., Guy C.L. (1989) Freezing tolerance of citrus, spinach, and petunia leaf tissue.

Plant Physiol., 89, 444-451.

Yu L.H., Umeda M., Liu J.Y., Zhao N.M., Uchimiya H. (1998) A novel MT gene of rice

plants is strongly expressed in the node portion of the stem. Gene, 206 , 29-35.

Zhang J., Cui S., Li J., Wei J., Kirkham M.B. (1995) Protoplasmic factors, antioxidants

responses, and chilling resistance in maize. Plant Physiol. Biochem., 33, 567-575.

Zhang X., Fowler S.G., Cheng H., Lou Y., Rhee S.Y., Stockinger E.J., Thomashow M.F. (2004) Freezing-sensitive tomato has a functional CBF cold response pathway, but a

CBF regulon that differs from that of freezing-tolerant Arabidopsis. Plant J., 39, 905-

919.

125

Zhenga B., Halperinb T., Hruskova O., Adamb H.Z., Clarkea A.K. (2002)

Characterization of Chloroplast Clp proteins in Arabidopsis: Localization, tissue

specificity and stress responses Physiologia plantarum., 114, 92–101.

Zhou J., Goldsbrough P.B. (1994) Functional homologs of funga1 metallothionein genes

from Arabidopsis. Plant Cell., 6, 875-884.

Zhou J., Goldsbrough P.B. (1995) Structure, organization and expressionof the

metallothionein gene family in Arabidopsis. Mo1. Gen. Genet., 248, 318-328.

Zhou G. K., Xu Y., Liu J. Y. (2005) Characterization of a rice class II metallothionein gene:

tissue expression patterns and induction in response to abiotic factors. J. Plant Physiol.,

162, 686-696.

126

Appendix-I

Steps involved in cDNA subtractive hybridization

Total RNA isolation and mRNA enrichment

cDNA synthesis

(Tester and driver ds cDNA are prepared from two mRNA samples under comparison)

RsaI digestion

(Tester and driver cDNAs are separately digested to obtain shorter, blunt ended

molecule)

Adapter ligation

(Two tester populations are created with different adapters. Driver cDNA has no

adapters)

First hybridization

(68°C, differentially expressed sequences are enriched)

Second hybridization

(Templates for PCR amplification are generated from differentially expressed tester

sequences)

First PCR amplification

(Sequences <200 bp are eliminated and longer differentially expressed sequences are

exponentially amplified by PCR)

Second PCR amplification

(Background is reduced and differentially expressed sequences are further enriched)

Construction of subtracted cDNA library

(By cloning of subtracted cDNA from secondary PCR into cloning and sequencing

vector)

127

Appendix-II

Instruments

Agarose Gel Electrophoresis Unit - Tarson

Autoclave - Sanco

Cooling centrifuge - Heraeus Biofuge

Cooling Water bath - Amersham Biosciences

Cooling Incubator - Remi Instruments Ltd.

Centrivap concentrator - Biogentek

Deepfreezer (-20°C& -80°C ) - Vestfrost

DNA Thermal Cycler - BIO-RAD

Electronic Balance - Shimadzu

Filtration Unit - Riviera

Fridge - LG

Fume Hood - Labexcel

Gel Documentation System - Alpha Innotech Corporation

Hot Plate Stirrer - Tarson

Hot Air Oven - Macro Scientific Works

Hybridization Chamber - Amersham Biosciences

Incubator shaker - Scigenics

Icematic - Spectrum Associates

Laminar Air Flow - Klenzoids

Mini Centrifuge - Heraeus Biofuge

Microwave Oven - Inalsa

Micro Pipette - Qualigens

Power Pac - BIO-RAD

pH Meter - Systronics

Rocker - Scigenics

Real Time PCR - Stratagene

RO Water Assembly - Millipore

Spectrophotometer - LABOMED-INS

UV Cross linker - Amersham Biosciences

128

Appendix-III

Stock Solutions and Buffers

100 mM CaCl2

CaCl2 x 6 H2O 21.91 gm

H2O to 1 liter

100X Denhard solution Final concentration

Ficoll 400 10 gm 0.02% (w/v)

Polyvinyle pyrrolidone 10 gm 0.02% (w/v)

Bovine serum albumin 10 gm 0.02% (w/v)

H2O to 500 ml

Filter sterilizes and store at -20 °C in 10 ml aliquots.

10 mg/ml Ethedium bromide

Ethydium bromide 0.2 gm

H2O to 20 ml

Mix well and store at 4 °C in dark.

Caution- Ethydium bromide is a mutagen. Wear gloves while working with solution

and a mask when weighing the powder.

0.5 M Ethylenediamine Tetraacetic acid (EDTA) pH-8.0

Na2EDTA X 2 H2O 186.1 gm

H2O to 700 ml

Adjust pH to 8.0 with 10.0 N NaOH (~50 ml)

H2O to 1 liter

5 M NaCl

NaCl 292.2 gm

H2O to 1 liter

129

10 M NaOH

NaOH 400.0 gm

H2O to 1 liter

1 M Tris-HCL [tris(hydroxymethyle)aminomethane]

Tris base 121.1 gm

H2O to 800 ml

Adjust to desired pH with concentrated HCL, mix and add H2O to 1.0 liter.

3 M Sodium acetate (pH- 5.2)

Sodium acetate X 3H2O 408.1 gm

H2O to 800 ml

Adjust pH to 5.2 with glacial acetic acid and add H2O to 1 liter.

20 X SSC

Per liter Final 1X concentration

NaCl 175.3 gm 150 mM

Na-Citrate X H2O 88.2 gm 10 mM

H2O to 800 ml

Adjust pH to 7.0 with 1 M HCL and add H2O to 1 liter.

50 X TAE (Tris-acetate-EDTA) electrophoresis buffer

Per liter Final 1 X concentration

Tris base 242.0 gm 40.0 mM

Glacial acetic acid 57.1 ml 20 mM

0.5 M EDTA (pH-8.0) 100 ml 2.0 mM

H2O to 1 liter

The pH of diluted solution is ~ 8.5

130

TE (Tris-EDTA) Buffer

Per litre Final 1X concentration

1M Tris pH 7.4, 7.6 or 8.0 10.0 ml 10 mM

H2O to 1 liter

DNA extraction buffer

Per 500 ml Final 1X concentration

1 M Tris 50.0 ml 100 mM

5 M NaCl 140.0 ml 1.4 M

0.5 M EDTA 20.0 ml 20.0 mM

10.0 % CTAB 100.0 ml 2.0 %

Adjust volume to 500 ml with distill water. Add PVP (2%) and dissolve by heating up

to 60°C in water bath. βMercaptoethenol (0.2%) should be added prior to use.

Solutions for Plasmid Isolation

Solution I

50 mM Glucose

25 mM Tris- Cl (pH- 8.0)

10 mM EDTA (pH - 8.0)

Solution I was prepared in batches of approximately 100 ml, autoclaved for 15

min at 1.06 kg/cm2 and stored at 4 °C.

Solution II

0.2 N NaOH (Freshly diluted from a 10N stock)

1.0% SDS

Solution III (100 ml)

5M potassium Acetate 60 ml

Glacial Acetic acid 11.5 ml

Distilled Water 28.5 ml

The resulting solution is 3M with respect to Potassium, and 5M with respect to acetate.

131

Appendix-IV

Primers and Their Sequences

rDNA F 5` CACAATGATAGGAAGAGCCGAC 3`

rDNA R 5` CAAGGGAACGGGCTTGGCAGAAT 3`

Met F 5` ATGTCTTGCTGTGGTGGTAAC 3`

Met R 5` TCATTTGCAGGTGCAAGGGTTG 3`

W F 5` ATGAGTCCATCAAGCAGAGCATGG 3`

W R 5` ATTGTTGGGACCCCAACAGC 3`

cDNA Synthesis Primer 5‟-TTTTGTACAAGCTTNN-3‟

PCR Primer1 5‟-CTAATACGACTCACTATAGGGC-3‟

Nested PCR primer1 5‟-TCGAGCGGCCGCCCGGGCAGGT-3

Nested PCR primer2R 5‟-AGCGTGGTCGCGGCCGAGGT-3

Adaptor Sequences

Adaptor1

5‟CTAATACGACTCACTATAGGGCTCGAGCGGCCGCCCGGGCAGGT3‟

Adaptor2R

5‟CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGT3‟