Top Banner
Transcription of DNA to RNA
16

Transcription of DNA to RNA

Dec 25, 2014

Download

Technology

uchihasasuke23

 
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Transcription of DNA to RNA

Transcription of DNA to RNA

Page 2: Transcription of DNA to RNA

How does RNA differ from DNA?

DNA RNA

•Deoxyribonucleic acid•Double helix

•Ribonucleic acid•Single strand•Makes proteins

Both have different

nucleotides!

Both have different

nucleotides!

Page 3: Transcription of DNA to RNA

Differences in Nucleotides

RNA Nucleotides

DNA Nucleotides

• Guanine• Cytosine• Adenine• Uracil

• Guanine• Cytosine• Adenine• Thymine

G

T

A

C

G

U

A

C

RNA

DNA

Page 4: Transcription of DNA to RNA
Page 5: Transcription of DNA to RNA

What is transcription?•Transcription is the name given to the process where the information in a gene in a DNA strand is transferred to an RNA molecule.

Page 6: Transcription of DNA to RNA

Transfer RNA

Messenger RNA (mRNA)

Ribosome RNA

Page 7: Transcription of DNA to RNA

Transfer RNA•Transfers specific amino acids to growing polypeptide chains at the ribosomal site of protein synthesis during translation.

Page 8: Transcription of DNA to RNA

Messenger RNA (mRNA)•The form of RNA that mediates the transfer of genetic information from the cell nucleus to ribosomes in the cytoplasm, where it serves as a template for protein synthesis.

Page 9: Transcription of DNA to RNA

Ribosomal RNA•It’s a component of the ribosome, and is essential for protein synthesis in all living organisms.

Page 10: Transcription of DNA to RNA

RNA Polymerase Binds to DNA

Elongation

Termination

Page 11: Transcription of DNA to RNA

RNA Polymerase Binds to DNA•DNA is transcribed by an enzyme called RNA

polymerase. Specific nucleotide sequences tell RNA polymerase where to begin and where to end. RNA polymerase attaches to the DNA at a specific area called the promoter region.

Page 12: Transcription of DNA to RNA

Elongation•Certain proteins called transcription factors unwind

the DNA strand and allow RNA polymerase to transcribe only a single strand of DNA into a single stranded RNA polymer called messenger RNA (mRNA).

•The strand that serves as the template is called the antisense strand. The strand that is not transcribed is called the sense strand.

Page 13: Transcription of DNA to RNA

Termination• RNA polymerase moves along the DNA until it reaches

a terminator sequence. At that point, RNA polymerase releases the mRNA polymer and detaches from the DNA.

• The new mRNA is released from the RNA polymerase and ready to be used in the traslation protein.

Page 14: Transcription of DNA to RNA

http://www.youtube.com/watch?v=5MfSYnItYvg

Page 15: Transcription of DNA to RNA

SUMMARY• RNA is created from DNA template• RNA polymerase bonds to the promoter site of a DNA strand in order to

begin DNA transcription• It conbines with transcription factors to form the transcription iniciation

complex• RNA polymerase moves thru DNA and breaks hidrogen bonds• Only one strand of DNA is copied in the process of transcription• RNA nucleotides pair with complementary DNA nucleotides in order to

form a RNA strand (its known as mRNA; its the copy of the message contained in the gene)

• Ends when the RNA polymerase reaches the termination site of the DNA, the DNA strands unite again and the RNA moves away.

• The new mRNA is released from the RNA polymerase and ready to be used in the traslation protein.

Page 16: Transcription of DNA to RNA

Activity DNA-RNA

•ACTGGATCAAGTAGGATCATGAA

•TACGGATCGTTATTCGATAGTTCA

•TTTCGGATGGTCTAGGATAGTACG