Genomics in Mendelian Disorders: from the Lab to the Clinic CCAGATGCCCTGTTCCAGGAGGACAGCTACAAGAAACACCTGAAGCATCACTGTAACAAGTATGTTATTAGAGGGTGGACCTGGAGAGCTTAATTCCCTTTTTATTCTTTAAAAAATACATGCAGCCGGCCCTTCACGTCTGCAGATGCAGAACTCGCAGATTTGGAGGGTCAACTGAGGGACCTGAGCATCTGCGGATCTTGGTGTCTGAGGGGGGTCCTGGAACCATACTCCCGCGGATATGGAGGGACAGCTCTG TATTAAGACTTTTAAATGGTATAGTTATTGCCTTTGCACAGCCTTATCATTTTTCTTGAAATGTGGTGTCAAGTTGCAGGAGAGCGTACCTTTAGGTGACTGATTATTTTTTAACATGGTAAGATACACAACACAACGTTTACCATTTTTACCATTTATAAGTGAACAATTCATTGGCATTAATTACACTCACAATGCTGTATACTCACTATCTGTACCTGAAATGTTTCCATCTTCCCAAATATAAACACTGTATCAATTAAACA CCCAGATGCCCTGTTCCAGGAGGACAGCTACAAGAAACACCTGAAGCATCACTGTAACAAGTATGTTATTAGAGGGTGGACCTGGAGAGCTTAATTCCCTTTTTATTCTTTAAAAAATACATGCAGCCGGCCCTTCACGTCTGCAGATGCAGAACTCGCAGATTTGGAGGGTCAACTGAGGGACCTGAGCATCTGCGGATCTTGGTGTCTGAGGGGGGTCCTGGAACCATACTCCCGCGGATATGGAGGGACAGCTCTG TTATTAAGACTTTTAAATGGTATAGTTATTGCCTTTGCACAGCCTTATCATTTTTCTTGAAATGTGGTGTCAAGTTGCAGGAGAGCGTACCTTTAGGTGACTGATTATTTTTTAACATGGTAAGATACACAACACAACGTTTACCATTTTTACCATTTATAAGTGAACAATTCATTGGCATTAATTACACTCACAATGCTGTATACTCACTATCTGTACCTGAAATGTTTCCATCTTCCCAAATATAAACACTGTATCAATTAAACA Tony Roscioli FRACP PhD Clinical Geneticist, Sydney Children’s Hospital Visiting Scientist, the Garvan Institute
40
Embed
Tony Roscioli - Sydney Children's Hospital - Genomics provides the answers for families: From the clinic to the laboratory and back
Tony Roscioli delivered the presentation at the 2014 Genomics in Healthcare Conference.
The Genomics in Healthcare Conference 2014 explored the current uses of genomics and forecast the potential for the discipline. Supported by the Garvan Institute of Medical Research who aim to further the use of genomic information in healthcare, the conference covered the policy, economics, legal and social aspects of genomics.
For more information about the event, please visit: http://bit.ly/genomics14
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Clinical Geneticist, Sydney Children’s HospitalVisiting Scientist, the Garvan Institute
Summary
• Next Generation Sequencing in Context– Some Australian initiatives with a major health impact– The identification of disease genes
• The Costs to NSW of Specific diseases and cost savings achievable through genomics– Drug reactions, inherited diseases with disability
• Families where genomics has provided the answer with associated cost savings
• Overall pilot results of genomic testing in genetic disorders
Penicillin was one of the most important discoveries during WWIIBy the end of the war almost 2 million lives had been saved
Penicillin
Barry Marshall and Garry Warren
Peptic Ulcers treatment with Ranitidine/Clarithromycin
$650 million annually saved in the US
Peptic Ulceration
Lithium treatment for bipolar disorder
$9 billion saved annually in the US (Kirschner et al 1994)
Bipolar Disorders
John Cade
Genomics is Unique in our Time
- WGS is allowing many diagnoses to be made at a population scale
- It sits in a historical context – more important than the microscopewhich created a revolution in understanding in microbiologyby allowing the invisible to be investigated
- We only see what is visible – WGS makes all genes accessible to study
•Exome = Protein Coding Genome
•split amongst >180,000 exons in humans
• total length ~30Mb
• includes canonical splice sites, miRNAs and 5’ and 3’ untranslated regions
•Estimated that this 1% of the genome contains 85% of human mutations
Technology and Plummeting Costs are Driving
Genomic Approaches
Moore’s Law: the Mandatory Genomic Talk Slide
Detecting disease causing mutations:
A good thing but too many tests prior to NGS
• Confirms / Excludes specific diagnosis
• Determines the patient therapy eligibility
• Enable the systematic design of therapies based on
• Single affected female• Non-Consanguineous family• MR plus Cornelia de Lange gestalt• Possible de novo inheritance• Multiple investigations, microarray normal
• Exome performed in proband
• Both CADD and RVIS/PROVEAN consistent with pathogencity for SMC1A mutation – phenotype crucial
-The average cost per each admission in 2011-12 is $5,204
-The annual cost of medication-related admissions is
$1.2 billion
Birth 60 years
Drug ReactionAverage Cost $5200
Birth
WGS
60 years
Flagged Genomic RecordAlternative Drug
Cost Saving $5200
Pharmacogenomics
Population WGS
A proportion of $380 MILLION: 10-20%??$30-50 million saved?
Avoided Costs to NSW Health System:
Pharmacogenomics
Results flaggedIn Childhood
Birth 40-60 years
Birth 30 – 60 years
A child with a Severe disability
The Costs to Families and Society of
Severe Genetic Conditions
- Costs of Medical/Surgical care- Assisted home living- Medications- Loss of employment opportunities for parents- Relationship breakdown- Loss of reproductive confidence with fewer future children
The Costs to Families and Society of
Severe Genetic Conditions
- Overall costs to families and carers for all aspects of daily life:$500,000/year
- Many of the causes will be new (“de novo”) mutations with a low chance of recurrence
- Some may be inherited with a high chance of recurrence
- Even is a small number of families who carry a gene mutationidentified by WGS make the choice to have a second healthy child with IVF, this will result in a significant economic impact
The Ongoing Psychological Burden:
Guilt and Fear can be removed by Genomics
- Professor Di Donnai: “Never underestimate the power of a diagnosis even if nothingcan be done”
- The majority of families will have had a child with a severeintellectual disability as a “one off” event – WGS will provide them with an answer and restore their reproductive confidence
- The knowledge that the disability was due to a new mutation with a very low chance of occurring again and that the family have not caused the birth of a child with intellectual disability is often enough to lift the burden of guilt
Traditional Diagnosis cost also significant• SMN1 molecular testing $690
• Myotonic dystrophy DNA test on mother $506
• Neurological appt for assessment mother $110
• Myasthenia Gravis DNA testing $2800
• 2 Micoarrays –both babies $1200
• 3 Pathologists opinion both babies incl UK $720
• Laminin A molecular testing $1000
• Postmortem $3000
• Muscle biopsy $144.05
Total $10,170 vs 2 Exomes $2-3000
• MRI brain $441.14
• Muscle biopsy $144.05
• Skin biopsy $50.25
• Surgical Session 4 h $2651.81
• Anaesthetist session 4h $1884.43
• Day Stay $1946
• ICU 24h non ventilated $326
• EM concord $380
• Dry ice to Melbourne $80
• Mito analysis $1400
• SNP arrays $1200
• Nerve conduction $200
Total $10,703 vs 2 Exomes $2-3000
Assuming 50% Exome Diagnostic Rate• Average per family all costs:~$10,000 ( a recurrent estimate over many studies)
• Average per family for 2 Exomes:~$2000
• Assuming would only get to a diagnosis half then time:– Still a saving of $6000 per family
• Assume that half of the costs for medical care are still required– Still an average saving of $3000 per family
– Much more money will be saved in some families and to the health system
Running 100 exomes per year could savehalf a million dollars per year in standard diagnostic costs
And these saving will become more pronounced as genomic costs fall
Population WGS
Parents who are both carriers couldChoose IVF to start a pregnancy knowing
the baby would not a recessive disease if they are at risk
Modulated Costs in the NSW Health System:
Pre-conception genomic testing
Results flaggedIn early adulthoodFor family planning
Birth 20-30 years
Potential Savings in NSW
• Pharmacogenomic testing and management could save $30-50 Million / year
• Confirming de novo mutations in intellectual disability would increase the likelihood that families would have more children – with all the positives that brings
• Genomic testing is going to be the short path to a specific diagnosis with savings of at least $3000 per family where there is a child with a significant genetic disorder
• The lifetime cost for all the care that a person with a severe intellectual disability requires could be ~$20-30 million
• Some families where there is a high risk of recurrence are already requesting IVF to ensure they can have a healthy child – with the secondary effect of shifting future costs to other parts of the health budget
Cost Savings and People Investment
• We are beginning to show that money can be saved for the hospital system
• It will however require Investment for infrastructure and also for staff – geneticists, genetic counselorsand community education
Key messages
• Genomics is the key medical diagnostic technology of our time
• The rollout of NGS technologies for community testing is occurring in NSW but will require adequate funding for genetic and genomic staff as well as ongoing resources to support testing
• The application of NGS to multiple health problems will save resources across the entire health budget which could represent a funding mechanism for NGS
• Collaboration between the KCCG/Garvan and genomicists within hospitals will result in good outcomes and high quality reports to clinicians and families
•Garvan/KCCG Genomics and Bioinformatics –(Mattick/Dinger/Cowley/Kaplan/Miller/Schofield)•Students: Lisa Ewans, Paul Gray
Hooi Ling TeeohEmma Palmer
•Immunology: John Ziegler, Paul Gray•Neurology: Annie Bye, Michelle FarrarMichael Cardamone, Hugo SampaioIan Andrews, John Lawson•Genetics: Anne Turner, David Mowat, Edwin KirkMary-Louise Freckmann, Michelle Lipke, Rani Sachdev•Genetic Counsellors: Carolyn Shalhoub, Bec MacintoshJacqui Robinson, Lisa Bristowe