THE OF BIOLOGICAL Val. 262, No. 34, Issue of December 5, pp. … · 2001-07-20 · cDNA inserts of X rCBl (rat) and X hCEl (human), respectively. plating and screening until the labeled

THE JOURNAL OF BIOLOGICAL CHEMISTRY Val. 262, No. 34, Issue of December 5, pp. 16663-16670,1987 Printed in U. S. A.

Molecular Analysis of Human and Rat Calmodulin Complementary DNA Clones EVIDENCE FOR ADDITIONAL ACTIVE GENES IN THESE SPECIES*

(Received for publication, April 29, 1987)

Banani SenGupta$jll, Felix Friedbergg, and Sevilla D. Detera-WadleighSII From the $Clinical Neurogenetics Branch, Division of Zntramural Research Programs, National Institute of Mental Health, Bethesda. Marvland 20892 and the rjDeDartment of Biochemistry, Howard University College of Medicine, -~ Washington, D. C. 20059

A cDNA clone, X rCB1, encoding calmodulin was isolated from a rat brain expression library. The sequence was determined and compared to the structures of the previously described rat genes, X SC4 and X SC8 (Nojima, H., and Sokabe, H. (1986) J. Mol. Biol. 190, 391-400). Faithful sequence conservation is observed in the coding regions of X rCBl and X SC4, the bona fide gene. Both cDNAs encode identical amino acid sequence. Very limited sequence homology, however, is noted in the 3”untranslated segments of these clones. Surprisingly, when the X rCBl nucleotide structure is compared to the processed intronless gene, X SC8, extensive sequence homology is found both in the coding and noncoding regions. The inferred protein sequences of X SC8 and X rCB1, however, are divergent. Using a fragment of X rCBl to screen an expression library derived from a human embryonic cell line, a calmodulin cDNA clone, X hCE1, was isolated and characterized. Comparison of the sequence of X hCEl to the cDNA from human liver, hCWP (Wawrzynczak, E. J., and Perham, R. N. (1984) Biochern. Int. 9,177- 185), reveals substantial structural divergence. Strik- ingly poor homology is seen in the 5’- and 3”noncoding segments, but the coding regions were 85% homologous. Both X hCEl and hCWP encode proteins of identical primary structure which is equivalent to the protein sequence deduced from X rCBl and X SC4. Taken together these results suggest the existence of an additional actively transcribed calmodulin gene, not previously identified, in each of the human and rat genomes. Transcripts of X rCBl and X hCEl were observed in all tissues examined indicating the absence of tissue-specific expression. Calmodulin gene polymorphisms were detected using TaqI, HindIII, and MspI.

Calmodulin is a ubiquitous highly conserved protein containing 148 amino acids and four calcium binding domains (for review see Refs. 1 and 2). The amino acid sequence of calmodulin from various species has been elucidated (3-19).

* The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted

503468. to the GenBankTM/EMBL Data Bank with accession number(s)

(I Received fellowship support from a grant from American Feder- ation for Aging Research (to F. F.).

11 To whom correspondence should be addressed.

The manifold functions of calmodulin range from its importance in growth (10) and the cell cycle (20, 21) to its role in biological signal transduction and the synthesis and release of neurotransmitters (1, 22-25). Calmodulin action is medi- ated by its interaction with acceptor proteins, and the nature of this binding has been studied recently using a model peptide (26, 27). In order to dissect the specific role of some amino acid residues and various segments of the molecule, purified products of calmodulin proteolysis (28) and mutant calmodulins synthesized in Escherichia coli (29, 30) have been em- ployed.

The available data on the nucleotide sequence of calmodulin indicate that in certain species it is encoded by a single gene (8,10,11,18,19). In Drosophila melanoguster the gene consists of four exons interrupted by three introns (18, 19). Two or more calmodulin-like genes have been identified in chicken (31, 32), Xenopus lueuis (9), rat (5), trypanosomes (la), and Limulus (17). The chicken calmodulin gene contains eight exons separated by introns of variable size (31). A mutated gene which is not interrupted by introns has been characterized also in this species (32). Two nonallelic genes have been found in frog (9). Trypanosoma brucei contains three tan- demly repeated calmodulin genes of which at least two are processed (12). Each of the three Limulus genes consists of three exons separated by four introns (17). Nojima and So- kabe (5) isolated and characterized three calmodulin-like genes in rat and speculated that a fourth gene might exist. So far only one human calmodulin cDNA has been reported (33).

In order to obtain evidence for the existence of additional rat and human calmodulin genes, we screened two cDNA libraries derived from rat brain and a human embryonic cell line (34, 35). In the present study we describe the isolation and characterization of a full-length human calmodulin cDNA clone which contains multiple nucleotide substitutions when compared to the human liver cDNA that has been previously identified (33). We also report the successful identification of a rat calmodulin cDNA clone which qualifies as a candidate product of a fourth rat gene. The transcripts for these DNAs are examined in various tissues. Polymorphisms have been detected with TaqI, MspI, and HindIII.

EXPERIMENTAL PROCEDURES

Materials-All restriction endonucleases were purchased from New England Biolabs. The vectors pUC9, M13mp8, and M13mp18 were obtained from Pharmacia Biotechnology, Inc. ICN supplied the nylon membrane, Biotrans. The labeled nucleotide [a-”P]dCTP (3000 Ci/ mmol) was obtained from Du Pont-New England Nuclear. The Kle- now fragment of DNA polymerase I was obtained from either New England Biolabs or Bethesda Research Laboratories. Formamide was supplied by Fluka.

Screening of a Rat Brain cDNA Library-A X gtll cDNA library

16663

16664 H u m a n and Rat Calmodulin cDNA Clones

prepared using poly(A+) RNA from the brain of a 1-week-old rat (a generous gift of Drs. A. Dawsett, L. Fritz, and N. Davidson, California Institute of Technology) was screened using a 32P-labeled calmodulin cDNA probe from X . Laeuis, llG2 (9) (kindly supplied by Dr. I. Dawid, National Institute of Health and Human Development). For screening we followed the method described by Benton and Davis (36), except that the bacteriophage was cultured in E. coli on 150-mm LB plates for 12 h at 37 "C. Plaques were transferred onto nitrocel- lulose filters. Duplicate filters were made from each plate, and the filters were subsequently treated following the procedures described earlier (37) and dried under vacuum at 80 "C. Baked filters were soaked in 6 X SSC (1 X SSC is 0.15 M NaCl, 0.15 M sodium citrate) and prewashed at 42 "C overnight. The probe was labeled using [a- 32P]dCTP by the method of Feinberg and Vogelstein (38) to a specific activity of approximately 2 X lo9 cpm/pg. Prehybridization and hybridization buffers contained 5 X SSC, 5 X Denhardt's solution (1 X is 1% Ficoll, 1% polyvinylpyrrolidone, 1% bovine serum albumin), 0.05 M phosphate buffer (pH 6.5), 45% formamide, 1% sodium dodecyl sulfate, 250 pg/ml salmon sperm denatured DNA, and 100 pg/ml poly(A). Hybridization proceeded for 48 h at 42 "C. Thereafter, the filters were washed with 2 X SSC and 0.5% sodium dodecyl sulfate three times for 10 min at room temperature and once for 2 h with 0.1 X SSC and 0.5% SDS at 50 "C. Autoradiography was done at -70 "C overnight. Common signals in duplicate filters were eventually identified in the autoradiograms, and areas on the plates corresponding to these positively hybridizing clones were recovered and resuspended in SM buffer (50 mM Tris-C1, pH 7.5,O.l M NaC1, 10 mM MgC12, and 0.1% gelatin). More bacteriophage clones were replated at low plaque density, and then the plates were screened as before. Repetitive plaque screening yielded purified cDNA clones. Finally, the bacteriophage DNA was amplified and purified according to established procedures (37).

Screening of a Human cDNA Library-A X gtll cDNA library prepared using poly(A+) RNA from human embryonic cells, N Tera 2cl.Dl (39) (a generous gift of Drs. J. Skowronski and M. Singer), was screened with an 840-bp EcoRI fragment of rat calmodulin cDNA which encompasses the coding and 3"untranslated regions following the method described in the previous section. After 2 cycles of plaque purification 15 positive clones were isolated and bacteriophage DNA was prepared (37).

Subcloning of Calmodulin cDNAs and DNA Sequencing-The cDNA inserts from the human and rat calmodulin clones were isolated by cleavage with EcoRI followed by electrophoresis on 1% low melting point agarose gels. Three fragments were produced from the rat clone and two fragments from the human clone. All these fragments were ligated to pUC9 which has been previously cleaved with EcoRI and dephosphorylated. The resulting recombinants were used to trans- form E. coli JM 83. The plasmids were propagated in a 2-liter culture and purified in a cesium chloride gradient. The large EcoRI fragments obtained from both human and rat cDNAs were further digested with HincII. All the fragments were subcloned in bacteriophage M13, and the nucleotide sequence of each fragment was determined by Sanger's dideoxy chain termination method (40).

Northern Blotting-Total RNAs prepared from brain, liver, kidney, fetus, and teratocarcinoma cells by the method of Chirgwin et al. (41) were fractionated in formaldehyde gels and transferred to nylon membrane filters. The filters were prehybridized, hybridized, and washed according to the method described earlier except that 45% formamide was used in both the prehybridization and hybridization buffers (42).

Southern Blotting-Total genomic DNAs were prepared according to the method previously described (43). The DNAs were digested with the appropriate restriction enzyme following the manufacturer's recommended conditions. Fractionation of the DNA fragments was done by electrophoresis on 0.8% agarose gels. The DNAs were transferred to a nylon membrane following the method of Southern (44). Hybridization, washing, and autoradiography were accomplished as described under the Northern blotting procedure.

RESULTS

Isolation and Characterization of Rat Calmodulin cDNA Clone, XrCBI-A total of approximately lo5 recombinants from a cDNA expression library prepared from the brains of 1-week-old rats was plated and screened using a 32P-labeled probe derived from the llG2 clone (9). Positively hybridizing plaques were isolated and purified by additional cycles of

A. AhCE1 E E H R?? ZRR E

5' t I I 1 I [ I I I I

I 3' +- w - "

F - c"---( c"---l

E. ArCB1 E E E H R R R H

R R f i E

5' I I I I I J I I I 1111

1 3' - - P P - -

1 1 1 1 1 1 1 1 1 1 1 ~

0 0.1 0.2 0.3 0.4 0.5 0.6 0.7 6.8 0.9 1.0 1.1 Kb

FIG. 1. Sequencing strategy and restriction maps for human and rat calmodulin cDNAs. The cutting sites for the restriction enzymes are indicated by capital letters: R, EcoRI; H, HincII; R, RsaI. The open bar encompasses the coding region, and the arrows indicate the direction of sequencing as well as the length of the fragment sequenced. The schematic diagrams in A and B correspond to the cDNA inserts of X rCBl (rat) and X hCEl (human), respectively.

plating and screening until the labeled probe was bound to all plaques. The pure clone, X rCB1, was amplified and digested with EcoRI in order to release the insert. Three fragments with molecular sizes of approximately 840, 163, and 86 bp' were produced. Subcloning of the fragments was done in pUC9 and subsequently into M13mp8 or M13mp18 for sequencing. Plasmid subclones were designated as prCB1.84, prCB1.16, and prCB1.086 for the clones containing the 840-, 163-, and 86-bp fragments, respectively. Initially, the sequence of approximately 300 nucleotides was obtained from both the 5' and 3' ends of prCB1.84. The primary structure of the internal portion of prCB1.84 was derived after HincII digestion which produced three fragments as shown in Fig. 1. Subcloning of these fragments and subsequent sequencing produced over- laps (Fig. l), and the complete structure of prCB1.84 was obtained as depicted in Fig. 2. This clone was found to include the coding region for the COOH-terminal portion of the molecule starting from amino acid 67 and a long 3"noncoding segment with one polyadenylation signal, AATAAA, followed by 19 nucleotides and the poly(A) tract (Fig. 2).

Sequencing of prCB1.16 and prCB1.086 was achieved with- out further digestion and subcloning since these inserts are short. The 5'-untranslated region as well as the coding sequence for the 10 amino-terminal residues were contained in prCB1.086 (Fig. 2). The clone prCB1.16 was found to encode amino acids a t position 11-66; X rCB1, therefore, cor;esponds to a full-length mRNA for rat calmodulin (Fig. 2).

When the published amino acid sequence for rat testes calmodulin (4) is compared to that deduced from rat brain cDNA, discrepancies in the amide assignment were observed in several positions. The predicted amino acid sequence for the rat bona fide calmodulin gene, X SC4, identified previously by Nojima and Sokabe (5) is identical to the derived sequence for X rCBl indicating that the observed nucleotide mutations did not result in amino acid substitutions. As shown in Table I and Fig. 3, X rCBl and X SC4 exhibit identity in 84% of the nucleotides in the coding region. A strikingly limited homol-

The abbreviations used are: bp, base pair(s); kb, kilobase(s).

Human and Rat Calmodulin cDNA Clones 16665

220 230 240 250 260 270 280 V a l Asp A l a Asp G l y A m G l y Thr I l e Asp Phe Pro G l u Phe LN Thr kt kt A l a Arg LYI &kt L y r GTA GAT GCT CAT GGT UT GGC ACA ATT GAC TTT CCT GM TTT C l G ACA ATG AT0 OCA !&A AM ATG M A

360 370 380 390 400 410 420 Scr A l a 1 1 . G l u Leu A r p H I S V a l k t Thr A m Leu G l y G l u Lyr Leu lhr Asp G l u G l u V a l Asp G l u &kt ffiT GCT OCA GM CTT CGC UT GTG ATG ACA MC CTT GW W MG TTA ACA GAT GM GTT GAT GM AT0

A m ~ T W M T ~ n t t * 1 G n G T A T A T n G T T T l C ~ r * ~ T T A C M m 1070 I080 1090 1100 1110 1120

-G-ACUICIAIALM

FIG. 2. The nucleotide structure and predicted amino acid sequence of human and rat calmodulin cDNAs. The human and rat clones are designated as A hCEl and A rCB1, respectively. The lines refer to matched nucleotides, and the asterisks signify deletions. Nucleotide substitutions are indicated.

TABLE I Percent nucleotide homology of variocls calmodulins

to A hCEl and A rCBl 5"Noncoding Coding 3'-Noncoding

region region region X hCEl

A rCBl 86 91 87

A SC4 ( 5 ) 82 39 hCWP (25) 31 85 42 Chicken calmodulin (7) 35 92 85 X . laevis calmodulin (9) 44 91 60

A sca ( 5 ) 77 87 87

X rCBl

A s c 8 (5) 86 92 89 A SC4 (5) 84 37

ogy of 37% is observed when the 3"untranslated regions are compared. Surprisingly, the number of matched nucleotides in X rCBl and X SC8, the processed intronless rat gene (5), is very high in both coding and noncoding regions (Table I and Fig. 4). The major difference between these two clones, however, is reflected in the presence of 19 amino acid substitutions in X SC8 which is reminiscent of the finding in chicken calmodulin genes (32). There is even more extensive diver-

gence in the sequences of X rCBl and X SC9, the rat calmodulin pseudogene ( 5 ) .

Isolation and Characterization of Human Calmodulin cDNA Clone, X hCEl-The insert of the rat calmodulin clone, prCB1.84, was labeled with 32P and used to screen a recombinant library of X gtll and cDNA from a human teratocarcinoma cell line, NTera2cl.Dl (39). The positively hybridizing plaques were picked, purified, and the bacteriophage DNA was amplified. All of the isolated clones yielded two fragments upon EcoRI digestion. They were subcloned into pUC9, and the clones containing the 1039- and 86-bp fragments were designated as phCEll.0 and phCE1.086, respectively. These clones were amplified, purified, and subcloned into M13mp8. The restriction map and sequencing strategy are summarized in Fig. 1. Upon sequencing, we found that the precise location of the unique EcoRI site was between the triplets coding for amino acid residues 9 and 10 (Fig. 2). Clone phCE1.87 contained a 52-bp 5'-untranslated region and the sequences encoding the first 9 residues of human calmodulin. Since the primary structure of phCEll.0 could not be completely derived during the initial analysis, HincII digestion of the insert was done. The three fragments produced (Fig. 1) were each subcloned and sequenced. The largest fragment was found to encode residues 10-148. In addition, this fragment contained a 623-bp 3"noncoding segment with one polyadenylation site as shown in Fig. 2.

The predicted amino acid sequence is the same for X hCEl and X rCBl as illustrated in Fig. 2. A very high degree of conservation in the nucleotide sequences of X hCE1 and X rCBl is evident (Table I and Fig. 2).

Since we used a fragment of X rBC1 that contains both coding and 3'-untranslated regions to isolate a human calmodulin clone we obviously biased our selection toward the most homologous human sequence. Due to the structural similarity between X hCEl and X rCBl analogous observations are obtained when the sequence of either X hCEl or X rCBl is compared to X SC4, X SC8, and X SC9 ( 5 ) (Table I). The poly(A) attachment signal, AATAAA, in X SC8 is located approximately 200 nucleotides downstream from the corresponding site in X hCEl and X rCB1. Only one polyadenylation signal has been found in these clones.

We also examined the degree of homology between X hCEl and the human calmodulin cDNA isolated from a liver library by Wawrzynczak and Perham (33) which we refer to as the hCWP clone (Fig. 5 ) . Both human cDNAs encode the same amino acid sequence. In the coding region these human cDNAs share 85% of their nucleotides (Table I and Fig. 5 ) . A great number of mismatches occur in the 5'- and 3"untranslated portions of X hCEl and hCWP. In the 5"noncoding segment 36 out of 52 nucleotides are different (Fig. 5 ) . The 3"untranslated region of hCWP cDNA is shorter than that of X hCE1; therefore, a poly(A) attachment signal was not found in hCWP. In this region only 42% of the nucleotides are homologous when the insertions/deletions are disre- garded.

Expression of X hCEl and X rCB1-The transcripts of X hCEl and rCBl genes were examined in rat fetus and NTera2cl.Dl cells as well as in adult rat brain, liver, and kidney. Using the phCEll.0 insert as probe the mRNA was found to be around 1.4-kb long in all samples examined except in kidney where a 1.2-kb nucleotide transcript was observed (Fig. 6).

Since the phCEll.0 probes encompass both coding and noncoding regions these transcripts probably represent the expression of most, if not all, calmodulin genes in rat. In order to visualize the X hCEl-specific mRNA, a 376-bp RsaI frag-

16666 Human and Rat Calmodulin cDNA Clones

~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ T ~ T ~ T ~ ~ ~ T T ~ ~ ~ T G * C C A M : ~ C * C ~ G I M ; * G ~ ~ T C G C * C * C T ~ C ~ T T T C T C C C ~ A T T ~ ~ * C

ASC4 U X ~ ~ T C T C C C ~ A ~ ~ T C A ~ ~ ~

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ArCB1

X le 2e

1W 1# 15@ 1 6 4 17, 1 0 1 2e8 21e 220 2 w O G O C * ~ C O W C M T ~ M C C M T ~ T C A T C C C O T C C O C C C I C U ; A Y ; C K ; M ; C ~ O C A

~ * C C A T ~ W C W A M C O O C ~ O G C C * C T C T U ~ C C C O T : T ~ ~ G I C A C M E U A * ~ * G U ; G C ~ G A A C ~ D ~ A ~ ~ T C ~ T ~ T ~ ~ ~ w 49 50 W 7e 64 oe 1 0 8 1 le 12e 1% 1 4 .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

250 264 2?@ 28a 291 SI@ 321 338 34. A T ~ T T C C C ~ C ~ U T T C C ~ G * C M T C A T C C W C ” I G A A K ; * U U C A ~ ~ ~ C A A C A M ~ ~ * O M ; A Y X T ; T T C T C ~ C ~ ~ T W T A A E W T O O C M T ~ T ~ T ~ ~ ~

A T T ~ T T C C C G C A G T T C T T G T A T C A T ~ T ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ T T ~ I C T T T ~ T ~ T ~ T ~ T ~ T ~

3 s

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

15@ 16. 17@ 1 6 8 1 9 0 2.0 211 221 2% 2# 2% 26e

37e 3 M 390 4m 410 4 3 44. 4 s 460 47e G U C ; A G C T T C C C C A C G T C A T ~ T T ~ T l ~ l ~ l l C A l G A A * T W T ~ l ~ T ~ l ~ l ~ T ~ ~ ~ l T T C l A

# A O M C 1 O C O C C A C O l U l ~ l ~ l A X S A l ~ l ~ G A A * l W l ~ l A T l ~ l ~ l ~ l A l ~ l l C l A 278 28e 29@ 3ee 31e 3m 330 544 UI SII Sf0 36.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

4.0 WI b10 s2. $3. sm 56a 67s 5eb 591 ~ ~ ~ T W A G C G A U ; ~ ~ T C ~ ~ ~ ~ T ~ ~ ~ T ~ C T T C ~ ~ T C T T M - T T I O C C T T T ~ C T C ~ C T T ~ C ~ ~ ~ T A ~ C ~ C ~ ~ ~ ~ ~ ~ C ~ U . . . . . . . . . . . . . . . . . . . . . . . . ,. . . . . . . . . . . . . . . . . . . . . . . .... . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . .... U t A T C A T C A C l C C A M A l ~ T C 1 : l l l ~ l % l l l ~ T C l ~ l C A M T l G A A * l C T l l T A C l l K Z l C T l % ~ T T U T

. . . . Joe 4.8 41@ 42@ 438 448 458 4ee 4re 4ae 4.0 WI

A C A ~ ~ C C T C T ~ C A C C * A * T T A T M T T T K X ~ C C A T T C C * A C T T C T ~ T ~ T ~ ~ ~ T C T T T T A ~ T T T ~ T T ~ ~ T C C M T * A M U ; ~ A T T ~ T T A M A 12w 1218 122e 1238 1249 125e 1266 127, 12w X

FIG. 3. Sequence comparison of X rCBl uersus X SC4. Sequence alignment was performed by using NUCALN (49). The matched nucleotides are connected by two dots. Blank spaces between the top and bottom bases indicate nonidentity. Deletions are represented by straight lines. The sequence of A SC4 was taken from the published report by Nojima and Sokabe (5).

Human and Rat Calmodulin cDNA Clones 16667 X 10 20 w 4. w 6. 70

XrCBl CCWETCC*GTCCTTGTCTGTTCTCCTCTCOC*AIC~TUTTOC*OCATOOCTCICCMCTCICTG**C*C XSC8 ...................... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

~ ~ ~ ~ ~ M ~ ~ ~ T ~ T ~ ~ ~ T ~ T C C T T G T C T G T T T A T ~ T ~ ~ T ~ T T G T ~ T ~ T ~ T ~ T G ~

...................... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

X 10 20 w 4. w 7e 80 9, 1 . 0 110

130 14. 1% 180 17, 1 8 0 191 80 91 1 .0 1 l e 1 20 ~ T ~ ~ T T C * M C ~ T T T C T C C C T A T T T ~ ~ T ~ M T A A C ~ T ~ T W T ~ T C T C T ~ Aol; . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

~ T T ~ T T C A M W C C T T T C C C C C T A T T T W f * C C C A T C C G W T U G I C f f i T A A C ~ M G C A G C T C C G W T C C T W T ~ T C T C T ~ T ~ ~ 13. 14. 1 5 0 16. 170

2 .0 210 220 230 24. 250

190 2.0 210 220 2 w

26. 27e 2W 290 3.a 31,

C ~ ~ A T G A T C U T G A A C T ~ T ~ ~ T M T ~ T ~ T T C C C T G M T T C C T G * C M T W T ~ ~ T C ~ A C ~ ~ ~ ~ T G ~ ~ T T ~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C T C O I W ; A C A ~ W ~ C A C T ~ T ~ T ~ T C C T M T ~ T ~ T T C C C T G A I T T T C T C * C M ~ C A T G C C U W A A M T ~ ~ ~ T T ~ T T ~

2 w 26. 270 2W 291 310 320 330 34. 35.

32e 3w 34. 3% 36. 370 38. 391 4eo 410 420 43. G C G ~ ~ ~ ~ C T C ~ ~ T C ~ T M T ~ T ~ T A C A T ~ T ~ ~ T C C C C A C C T W T C I C ~ T T G ~ T ~ T ~ T T W ~ ~ T W T C ~ ~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ....................... . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G C G ~ ~ C C C ~ G ~ C T T ~ G A ~ ~ I ~ O C * C T A ~ * C T * C T C C * G C * C ~ T T T ~ * C G T C A ~ C ~ I I C C C T T O T T A * C ~ ~ ~ A T ~ T ~ T ~ T ~ T ~ M .......................

37) s o 398 4.0 4.e 420 4 w 440 450 480 478

44. 4% 46. 470 4ao 491 UI 51 0 520 5w 54. 550 ~ * G * C * ~ ~ ~ ~ ~ ~ ~ W T ~ T ~ * * C f f i T T T C T A C * U T ~ T ~ ~ ~ A M ; T C M C * C C C T G T * C ~ ~ G T T * M T T T C T T ~ T A C ~ T C T T ~ T T T ~ T T T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . G C U ; * C A T C C * T O O O G A T C C T C ~ T M T C T A T ~ T T T C T E C * U T ~ T ~ ~ ~ * * C T C ~ T ~ T A O C O T G T T ~ - ~ T T T C ~ T ~ ~ ~ T A T ~ ~ ~ ~ ~ ~ ~ ~ ~ ~

484 49e 5.0 510 520 530 54. 55. 56 . 57e 58.

56. 570 58. 59e 6w 610 620 6s. 64. 650 66@ T C T C ~ G T T T C T A * C T T A T C T C T * A A A G C T T C C ~ T G T C * C ~ A ~ ~ A T G ~ A ~ * C T A A T T * C C A C T C C * T T C C T C C A T C T T T C T ~ C C ~ T A T C ~ T C T ~ T C A T T C T C

~ C T T ~ C T T T C T M ~ T C A T C C C T A A M ~ C T T T C C C A * C T C T C ~ T A T ~ T G ~ A ~ ~ ~ ~ T A A T T U K ; * C C T C A T T C T T C W T C T T T C T T C C C T A T C T T C T T C C C T A T C T T A ~ C T C A T T C T C

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

590 6w 610 6 2 I 6M 64. 650 680 670 Wo 690 7.0

M T A C A ~ A M T W l A T M C ~ A C h C A T C T A T M l C T A T M ~ T A T A T A ~ T A T A l A C C A C M M T A T A T A M T A T A T I * *

1360 x 131e 1328 133e 1340 1350 136e 1370

FIG. 4. Sequence comparison of X rCBl versus X SC8. Sequence alignment was performed by using NUCALN (49). The matched nucleotides are connected by two dots. Blank spaces between the top and bottom bases indicate nonidentity. Deletions are represented by straight lines. The sequence of X SC8 was taken from the published report by Nojima and Sokabe (5).

16668 Human and Rat Calmodulin cDNA Clones X le 2e w 4. 50 6@ ?e 8e

XhCEl CCCAECTWOTOOTTCTCTOCTCGC C ~ C T C O C A M C C O O T * D C C C T T ~ ~ T ~ T ~ T ~ T ~ T T ~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . hCWP . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ~ T ~ T ~ T ~ T C G T ~ T ~ T ~ ~ C T O C ~ C T T C C T C C C f T C * C T ~ ~ A T C C C T C A T ~ T ~ T T ~ T

X le 2e w 4. 50 ?e 8e n 1.0 1 le

n 1.0 11e 12e 1W 14. 150 16@ 1 ?e 1 0 8 1W m ~ T T ~ T T T T T C A T T A T T T W C I A K ; A T C G T W T O T A T ~ ~ C A A C T T G O C A C T C T M T C A W T C T C T T ~ T ~ T T ~ . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

~ T T C U O C A l O C C T T C T C C C T A T l f C A T ~ T ~ T O C C k C C A f C * C A A C A A * G C A A C ~ ~ ~ T C T U T U O C T C * C f O T ~ T G M T T ~ T 134 1 4 . 150 16@ 1 ?e 1- 2.0 21e 22e 2 w

21e 22e 2 w 24. 250 26@ 27, 288 2 n m 31e 32a A T W T T M T C M G T U ; * T O C T C A T O C T M T ~ T T ~ T T T C C T G M T T T C T O * U A T C A T C C C ~ T C ~ T ~ T T U ; A C A A O C A T T C C C T . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A T U T C M T C M C T O C A T C C T W T ~ T M T ~ T T ~ T T ~ T T T T T ~ T A T W T C C C T A C ~ T C A M C * T A C ~ T ~ T C ~ ~ T ~ T ~ T T ~

250 26@ 27e 2 w 2w SI@ 32a sw 34. UI

450 46e 47e 408 4 n m 51@ 52@ 5 n s4e 550 5m W T O C ~ ~ T O C ~ C A Y ; T A M C T A T ~ T T T C T ~ T W T ~ T ~ C C T T C T A C * C M T G T C T T A M T T T C T T C T ~ T T G T T T A T T T O C C T T T T C T T T G T T T

C A T C C A C A C C C A C M C T C A A C T A T ~ T T ~ T * C U ; * T W T ~ T O C ~ T ~ C C T A C T T T C A A C T C C T T T T T ~ T C T ~ T ~ T T ~ T C T T T T A C T T ~ T

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 n m 51e 52e 53. 550 568 57) 500 HI

57e 58@ 5 n @em 61@ 62@ 6 M 64. 650 C T M C T T A T C T C T A A M C C T T T C T ~ T * C T C T ~ T A ~ ~ ~ C ~ A T ~ ~ ~ ~ ~ ~ A C C A CTlCATTCCTCC*TGTTTTCTTccc . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . C T T C C A A A A A A “

. . .. * “ A C T T U T T T A T T C A T T C l C T T T C T A T A T ~ T G M T C T C A A T C T C

61@ 62I 6- 64e 650 66@ 67e 68e 6 W 7.e

9.0 91) 92e ow 94. 950 960 97e 9m m 1.W * C T C - ~ A ~ C T ~ T ~ ~ ~ ~ T ~ T ~ T G T A T T A T ~ T ~ T ~ T * I C A C T A T T T T T T T C T A C T O C ~ O G T C T ~ ~ ~ ~ ~ C ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~

FIG. 5. Sequence comparison of A hCEl uersw hCWP. Sequence alignment was performed by using NUCALN (49). The matched nucleotides are connected by two dots. Blank spuces between the top and bottom bases indicate nonidentity. Deletions are represented by straight lines. The sequence of hCWP was taken from the published article by Wawrzynczak and Perham (33).

1e1e

ment spanning positions 533-909 was used as a probe (Figs. 1 and 2). In this region there are three areas of deletion/ insertion mutations and homology is limited; therefore, the specific expression of the X hCEl gene could be investigated. The results revealed that all tissues and cells analyzed contain the X hCEl transcript (Fig. 6). Parallel observations were obtained using X rCBl fragments as probes.

Southern Blotting and DNA Polymorphisms-A panel of human DNAs from 19 individuals was digested with a variety of restriction endonucleases, blotted and hybridized with either the phCEll.0 insert or a HincII 250-bp fragment derived from the 3”noncoding region from positions 884 to 1126 (Figs. 1 and 2). The restriction patterns obtained using two of these enzymes are depicted in Fig. 7. It is evident that there are multiple hybridizing fragments in each restriction digest. No differences in the patterns were observed using either

phCEll.0 or the HincII fragment probe. Restriction site polymorphisms were generated using TaqI

( A ) and HindIII ( B ) (Fig. 7). The patterns obtained from three different individuals are shown in lanes 1-3. With TaqI, the bands at 5.5 and 2.6 kb are variable and are, therefore, absent in some individuals. The 5.5-kb fragment was observed only in one of 19 individuals and the 2.6-kb band in 11 of 19 individuals. In the HindIII blots 10 of 19 individuals exhibit very intense bands at 7.4 and 7.8 kb as shown in panel B, lane 1. Additional fragments at 6.6 and 8.2 kb have been observed in 8 of 19 individuals as depicted in lane 2. A third type of pattern obtained is exemplified by lane 3 where fragment 7.8 kb is missing and the 6.6- and 7.4-kb bands have twice the intensity of the other bands. This was found in one of 19 individuals examined. Since there is a unique HindIII and TaqI cleavage site in X hCE1 cDNA, the polymorphisms

Human and Rat Calmodulin cDNA Clones 16669

1 2 3 4 5 ”

FIG. 6. Calmodulin mRNA in various rat tissues in an embryonic cell line. Isolation of total RNA, electrophoresis, and Northern transfer were performed according to the methods described under “Experimental Procedures.” In each lane approximately 20 pg of total RNA was applied. The sources of total RNAs are: lane 1 , rat kidney; lane 2, rat liver; lane 3, rat brain; lane 4, rat fetus; and lane 5 , NTera 2 cl.D1 cells. The sizes of the transcripts are given in kb which were inferred from an RNA ladder. Hybridization was done as described under “Experimental Procedures.”

observed here probably arose from either variations in the introns of one gene and/or from sequence diversity among the calmodulin genes. Similar types of polymorphisms were observed in MspI blots (data not shown).

DISCUSSION

We have isolated from a recombinant library of X gtll and human embryonic cell carcinoma cDNA, a full-length calmodulin clone, XhCE1. Comparison of the X hCEl structure with a previously identified human liver cDNA (33), hCWP, reveals multiple nucleotide differences particularly in the 5 ’ - and 3”noncoding regions. While these mutations did not result in amino acid replacement, the coding regions are only 85% homologous. In the 5’- and 3”untranslated regions, there is very limited homology between these two clones.

An analogous situation exists in rat calmodulin. Nojima and Sokabe ( 5 ) isolated a bona fide calmodulin gene, X SC4, which encodes the same amino acid sequence as X rCB1, X hCE1, and hCWP. In addition, they identified an intronless processed calmodulin gene, X SC8 and a pseudogene X SC9. The amino acid residues predicted from the nucleotide sequence of X SC8 and X SC9 indicate substitutions when compared to that of the bona fide calmodulin gene. Since X rCBl does not contain these amino acid mutations, this finding indicates that this cDNA was not derived from a

A B 1 2 3 1 2 3

- .

0.9 - h g 0.78 -

FIG. 7. Restriction patterns of calmodulin genes. Two auto- radiographs of Southern blots generated by digestion of human genomic DNAs with TaqI ( A ) and Hind111 ( R ) and hybridization with phCE1.9. Lanes 1-3 in A and B show the patterns obtained from three different individuals.

pseudogene. However, the nucleotide sequence of X rCBl is not completely homologous to the Nojima-Sokabe bona fide rat gene particularly in the 3”noncoding region where the two sequences are vastly divergent.

These results taken together provide evidence for the existence of two separate bona fide genes for both rat and human calmodulins. Alternatively, two allelic forms of an actively transcribed gene could be present in either rat or human. We believe that this is unlikely because of the extensive nucleotide substitutions found in the coding and noncoding regions of both X hCEl and X rCBl compared to hCWP and X SC4, respectively. The human and rat genomes, therefore, contain two or more separately transcribed calmodulin genes that generate products of the same amino acid sequences. Similar results have been reported by Chien and Dawid in X. Laeuk (9) and Tschudi and co-workers in trypanosomes (12). The existence of several expressed genes which are capable of encoding a single biologically active product confers a selec- tive advantage to the organism. This might be particularly important for calmodulin since this protein influences diverse essential processes in the cell. A recent elegant study by Davis and co-workers (10) has demonstrated that Saccharomyces cereuisiae which harbors a single calmodulin gene fails to survive when this gene is disrupted.

I t is interesting to note that the nucleotide structure of the processed intronless rat gene, X SC8, matches X rCBl very closely in both translated and untranslated segments. This degree of similarity is not shared by the noncoding regions of X rCBl and the other bona fide gene, X SC4. It is conceivable that X SC8 and the X rCBl genes arose from the duplication of a common ancestral gene which was, in turn, one of the products of a more ancient gene iteration. Since the X rCB1

16670 Human and Rat Calmodulin cDNA Clones

gene has not been isolated it is not known whether this gene managed to retain its introns.

The 5’- and 3”untranslated regions in addition to the coding segments of X hCEl and X rCBl are very extensively matched. The h hCEl gene is most probably the human analog of the rat X rCBl gene. Interspecies sequence conservation of the 3”noncoding portion has been documented in hypoxan- thine phosphoribosyltransferase and dihydrofolate reductase genes (45, 46).

Three classes of calmodulin sequences emerge when X hCE1 is compared to the nucleotide structure in other species. X hCEl and X SC8 which are most closely related to X hCEl both in the coding and noncoding portions constitute the first type. A second category includes hCWP and possibly X SC4 where nucleotide mismatch with A hCEl is high in both 5’ - and 3”untranslated segments but low in the coding region. Chicken and X . laevis calmodulins show poor homology in the 5”untranslated region with X hCE1, more faithful sequence conservation in the 3”noncoding segment, and greater than 90% homology in the translated region. This constitutes the third type of calmodulin sequence. In view of this, it is highly plausible that at least three processed calmodulin genes exist in the human as has been shown in the rat in this study and elsewhere (5). The complex restriction patterns observed in the Southern blots tend to validate the idea of the presence of several types of human calmodulin sequence.

The exact function of the 5 ’ - and 3“noncoding sequences in mRNAs is largely unknown. The 5”untranslated sequence might be related to tissue-specific expression as suggested by Hagenbuchle and co-workers (47) who found that a-amylases from liver and salivary gland are divergent only in this region. Using a 5”noncoding region probe from X hCEl in Northern blots revealed that this gene is not specifically expressed in any of the tissues examined which contrasts with the finding with chicken calmodulin pseudogene (32). Parallel observations were obtained using 3“untranslated segment probes from X hCE1. The transcript in kidney is slightly shorter than those isolated from other tissues; the reason for this is unclear. The size of expressed calmodulin mRNA does not correlate with development as illustrated by the identical results obtained with fetal, embryonic cell, and adult tissue mRNAs.

Studies by Chafouleas and co-workers (20, 21) have shown the importance of calmodulin in the cell cycle. In mouse histone H4 gene the 3”terminal region has been implicated in regulation of the gene during the cell cycle (48). Since the 3”untranslated segments of the two bona fide calmodulins in both the rat and human are vastly dissimilar, the role of these genes during the cell cycle can be examined separately. Also calmodulin genes specific for X hCEl and hCWP may be isolated and studied by exploiting the sequence diversity in the noncoding regions. We, therefore, have a tool for studying whether the active calmodulin genes are differentially regu- lated.

Acknowledgment-We wish to thank Dr. Tom Sargent for his expert help in preparing sequence homologies using the computer, Dr. D. N. SenGupta for his assistance during the early stages of sequencing, Drs. A. Dawsett, L. Fritz, and N. Davidson for the rat brain expression library, Drs. J. Skowronski and M. Singer for the human cDNA library, Dr. I. Dawid for the X . he& calmodulin clone, Dr. Peter Andrews for his gift of NTera 2cl.Dl cells, Dr. Elliot S. Gershon for his support, J. Guroff for her help with the graphic art, and S. Wentzel for her assistance in typing the manuscript.

REFERENCES 1. Klee, C. B., and Vanaman, T. C. (1982) Adu. Protein Chem. 35. 213-321 2. Cheung, W. Y. (1985) Harvey Lect. Series 79, 173-216 3. Sasagawa, T., Ericsson, L. H., Walsh, K. A., Schreiber, W. E., Fischer, E.

4. Dedman, J. R., Jackson, R. L., Schreiber, W. E., and Means, A. R. (1978)

, ~~~ ~”

H., and Titani, K. (1982) Biochemistry 21,2565-2569

J. Biol. Chem. 253.343-346

6. Watterson, D. M., Sharief, F., and Vanaman, T. C. (1980) J. Biol. Chem. 5. Nojima, H., and Sokabe, H. (1986) J . Mol. Biol. 190 , 391-400

7. Putkey, J. A., Ts’ui, K. F., Tanaka, T., LagacB, L., Stein, J. P., Lai, E. C.,

8. LagacB, L., Chandra, T., Woo, L. C., and Means, A. R. (1983) J. Biol. Chem.

9. Chien, Y. H., and Dawid, I. B. (1984) Mol. Cell. Biol. 4, 507-513

255,962-975

and Means, A. R. (1983) J. Biol. Chem. 2 5 8 , 11864-11870

258 , 1684-1688

IO. Davis, T. N., Urdea, M. S., Masiarz, F. R., and Thorner, J. (1986) Cell 4 7 ,

11. Goldhagen, H., and Clarke, M. (1986) Mol. Cell. Biol. 6 , 1851-1854 12. Tschudi, C., Young, A. S., Ruben, L., Patton, C. L., and Richards, F. (1985)

13. Jamieson, G. A., Jr., Blum, J. J., and Vanaman, T. C. (1980) in Calcium Proc. Natl. Acad. Sci. U. S. A. 8 2 , 3998-4002

Binding Proteins: Structure and Function (Siegel, F. L., and Wasserman, R. H., eds) pp. 165-172, Elsevier Scientific Publishing Co., Amsterdam

14. Kasai, H., Kato, Y., Isobe, T., Kawasaki, H., and Okuyama, T. (1980) Biomed. Res. 1,248-264

15. Toda, H., Yazawa, M., Kondo, K., Honma, T., Narita, K., and Yagi, K. (1981) Biochem. J . 1493-1505

16. Yazawa, M., Yagi, K., Toda, H., Kondo, K., Narita, K., Yamazaki, R., Sobue, K., Kakiuchi, S., Nagao, S., and Nozawa, Y. (1981) Biochem. Eiophys. Res. Commun. 9 9 , 1051-1057

423-431

17. Liu, T.-Y., and Cheng, S. M. (1987) Fed. Proc. 4 6 , 2000 18. Yamanaka, M. K., Saugstad, J. A,, Hanson-Painton, O., McCarthy, B. J.,

and Tobin, S. L. (1987) Nucleic Acids Res. 15 , 3335-3348 19. Smith, V. L., Doyle, K. E., Maune, J. F., Munjaal, R. P., and Beckingham,

K. (1987) J. Mol. Biol. 196,471-485 20. Chafouleas, J. G., Bolton, W. E., Hidaka, H., Boyd, A. E., 111, and Means,

A. R. (1982) Cell 28,41-50 21. Chafouleas, J. G., Lagace, L., Bolton, W. E., Boyd, A. E., 111, and Means,

A. R. (1984) Cell 36,73-81 22. Sieghart, W., Forn, J., and Greengard, P. (1979) Proc. Natl. Acad. Sci. U.

S. A. 7 6 , 2475-2479 23. Yamanchi, T., and Fujisawa, H. (1982) in Calmodulin and Intracellular CaZ+

(Kakiuchi, S., Hodaka, H., and Means, A. R., eds) pp. 267-280, Plenum

24. Nairn, A. C., Hemmings, H. C., Jr., and Greengard, P. (1985) Annu. Reu. Publishing Corp., New York

25. Bruce Graves, C., Gale, R. D., Laurino, J. P., and McDonald, J. M. (1986) Biochem. 54,931-976

26. Kaetzel, M. A,, and Dedman, J. R. (1987) J. Bial. Chem. 262,3726-3729 J. Biol. Chem. 261,10429-10438

27. gaudier, J., Mochly-Rosen, D., Newton, A., Lee, S-H., Koshland, D. E., Jr., and Cole, R. D. (1987) Biochemistry 26,2886-2893

28. Newton, D. L., Oldewurtel, M. D., Krinks, M. H., Shiloach, J., and Klee, C. B. (1984) J . Biol. Chem. 259 , 4419-4426

29. Roberts, D. M., Crea, R., Malecha, M., Alvarado-Urbina, G., Chiarello, R. H., and Watterson, D. M. (1985) Biochemistry 24,5090-5098

30. Putkey, J. A,, Slaughter, G. R., and Means, A. R. (1985) J. Biol. Chem. 260,4704-4712

31. Simmen, R. C. M., Tanaka, T., Ts’ui, K. F., Putkey, V. A., Scott, M. J., Lai, E. C., and Means, A. R. (1985) J. Biol. Chem. 260,907-912

32. Stein, J. P., Munjaal, R. P., Lagace, L., Lai, E. C., OMalley, 9. W., and Means, A. R. (1983) Proc. Natl. Acad. Sei. U. S. A. 80,6485-6489

33. Wawrzynczak, E. J., and Perham, R. N. (1984) Biochem. Int. 9, 177-185 34. SenGupta, B., Friedberg, F., and Detera-Wadleigh, S. D. (1986) Fed. Proc.

35. SenGupta, B., Friedberg, F., and Detera-Wadleigh, S. D. (1987) Fed. Proc.

36. Benton, W. D., and Davis, R. W. (1977) Science 196,180-182 37. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982) Molecular Cloning, A

Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY

4 5 , 1693

4 6 , 2001

38. Feinberg, A. P., and Vogelstein, A. P. (1983) Anal. Biochem. 132,6-13 39. Andrews, P., Damjanov, I., Simon, D., Banting, G. S., Carlin, C., Dracopoli,

40. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U.

41. Chirmin. J. M.. Przvbvla. A. E.. MacDonald. R. J.. and Rutter. W. J.

N. C., and Fogh, J. (1984) Lab. Inuest. 50,147-162

S. A. 74 , 5463-5467

(1579) Eiochemist& l“8,’5294-5299

Anderson. S.. and Gershon. E. S. (1987) Nature 325.806-808 42. Betera-Wadleigh, S. D., Berrettini, W. H., Goldin, L. R., Boorman, D.,

43. Woo, S. L. C., Lidsky, A. S., Guttler,’F., Chandra, T., and Robson, K. J. H.

44. Southern, E. M. (1975) J. Mol. Biol. 98,503-517 45. Kim, S. H., Moores, J. C., David, D., Respess, J. G., Jolly, D. N., and

46. Chen, M.-J., Shimada, T., Moulton, A. D., Cline, A,, Humphries, R. K.,

47. Hagenhuchle, O., Tosi, M., Schibler, U., Bovey, R., Wellauer, P. K., and

48. Luscher, B., Stauber, C., Schindler, R., and Schumperli, D. (1985) Proc.

49. Wilbur, W. J., and Lipman, D. J. (1983) Proc. Natl. Acad. Sci. U. S. A. 80,

(1983) Nature 306 , 151-155

Friedman, T. (1986) Nucleic Acids Res. 14,3103-3118

Maizel, J., and Nienhuis, A. W. (1984) J. Biol. Chem. 259 , 3933-3943

Young, R. A. (1981) Nature 289,643-646

Natl. Acad. Sci. U. S. A. 8 2 , 4389-4393

726-730

THE OF BIOLOGICAL Val. 262, No. 34, Issue of December 5, pp. … · 2001-07-20 · cDNA inserts of X rCBl (rat) and X hCEl (human), respectively. plating and screening until the labeled

Documents