The multispecies coalescent: implications for inferring species trees James Degnan 21 February 2008
Mar 26, 2015
The multispecies coalescent: implications for inferring species trees
James Degnan
21 February 2008
Outline
1 .Background-- gene trees vs. species trees
-- coalescence and incomplete lineage sorting
2 .Inferring species trees-- Concatenation
-- Consensus Trees
3 .Conclusions
Population Genetics and Phylogenetics
Population genetics: traditionally used to analyze single populations.
Phylogenetics: What is the best way to infer relationships between
populations/species?
Graphic by Mark A. Klinger, Carnegie Museum of Natural History, Pittsburgh
Desirable properties of species tree estimators
1 .Statistical consistency (sample size = # of genes)
2 .Efficiency
3 .Robustness to violations in assumptions
Bridging the popgen/phylo divide
“Closer integration of population-genetic factors in phylogenetics, including further insights into gene-tree/species tree, and horizontal gene transfer.” --from Mike Steel’s website, My pick for five directions in phylogenetics that will grow in the next five years (2006).
“Incorporation of explicit models of lineage sorting will be needed for continued development of phylogenetic inference near the species level.” –Maddison and Knowles (2006).
The coalescent process
Past
Present
One population
Multiple populations/species
Present
Past
Gene tree in a species tree
Model species tree with gene tree
A B C DThe gene tree is a random variable. The gene tree distribution is parameterized by the species tree topology and internal branch lengths.
How can we compute probabilities of gene trees given species trees?
-General case solved by Degnan and Salter (2005) and implemented by program COAL. Also allows individuals sampled in species i. 0in
-Under a coalescent model, probabilities for gene trees with three species were derived by Nei (1987): 1-(2/3)e-T
-Probabilities for the gene tree to match the species tree topology for 4 and 5 species given by Pamilo and Nei (1988).
-All 30 species tree/gene tree combinations for 4 species given by Rosenberg (2002).
Definition: a coalescent history is a list of the populations in which each coalescent event occurs.
A B C DThis coalescent history: (1,3,3)
Other coalescent histories: (2,3,3), (3,3,3)
Gene tree probabilities
histories
ShistoriesGSG ]|,Pr[]|Pr[
Gene tree probabilities
histories
ShistoriesgGSgG ]|,Pr[]|Pr[
)()(),( bbvbuhistories b
b Tpw
internal branches of S
combinatorial enumeration, complexity only known in special cases
u coalesce into v
probability coalescences are consistent with g
branch length
Data from Ebersberger et al. 2007. Mol. Biol. Evol. 24:2266-2276.
Theoretical distribution based on parameters from Rannala and Yang, 2003. Genetics 164:1645-1656.
1.2
4.2t/N=
y
x
Definition: a gene tree which is more probable than the gene tree matching the species tree is called an anomalous gene tree (Degnan and Rosenberg, 2006).
Theorem 1. For the asymmetric species tree topology with four species and for any species tree topology with more than four species, there exist branch lengths such that at least one gene tree is anomalous (Degnan and Rosenberg, 2006).
Is species tree inference consistent in this setting?
1 .Concatenation?
2 .Consensus?
Species Tree inference—concatenation
Species Trees are often estimated by concatenating several gene sequences and analyzing as one (data from Chen and Li, 2001).
Gene 1 Human CTTGAATAATTTTTACChimp CTTCAATAATTTTTACGorilla TTTGAATAATTTTTACOrang CTTGAATAATTTTTAT
Gene 2TAGAGTTTCCTTGTGGTGTAGAGTTTCCTTGTGGTATAGAGTTTCCTTGTGGTACAGAGTTTCCTTGTGGTC
Gene 3CGGTTTTGGTTTTGGTTTCRGTTT
Concatenation and gene tree discordanceHow does concatenation perform when sequences are generated
from different topologies?CGGTTTTGGTTATGGTTATAGTTA
CGATTATGATTATAATTTTGAATT
TGCTATTGCTATTGCTATCCCTAT
Species tree:
y = 1.0, x = 0.05
yx
Simulated gene trees
concatenated
sequence
CGGTTTTGGTTATGGTTATAGTTA
CGATTATGATTATAATTTTGAATT
TGCTATTGCTATTGCTATCCCTAT
Trees inferred from concatenated sequences (Kubatko and Degnan, 2007)
y = 1.0, x = 0.05
Number of genes
Is species tree inference consistent in this setting?
1 .Concatenation? No.
2 .Consensus?
Consensus (majority-rule)
Types of consensus trees
Greedy—sort clades by their proportions. Accept the most frequently observed clades one at a time that are compatible with already accepted clades. Do this until you have a fully resolved tree.
Majority rule—consensus tree has all clades that were observed in > 50% of trees.
R*—for each set of 3 taxa, find the most commonly occurring triple e.g., (AB)C, (AC)B or (BC)A. Build the tree from the most commonly occurring triple.
)AB(D, (CD)B are two rooted triples
Asymptotic consensus trees
Consensus trees are usually statistics, functions of data like x-bar.
Definition: an asymptotic consensus tree is the tree that is obtained by computing the consensus tree using topology probabilities from the
multispecies coalescent model .
Motivation: if there are a large number of independent loci, observed gene tree, clade, and rooted triple proportions should approximate their theoretical probabilities.
Simulated gene treesGreedy consensus tree
Greedy consensus tree
Simulated gene treesGreedy consensus treeR* consensus tree
Greedy consensus tree
Majority-rule: unresolved zone
Too-greedy zone
Is species tree inference consistent in this setting?
1 .Concatenation? No.
2 .Consensus? Yes (R*), no for greedy and majority-rule .
Are consensus trees inconsistent estimators of species trees?
Theorem 2. (i) Majority-rule asymptotic consensus trees (MACTs) do not have any clades not on the species tree. (ii) Majority-rule unresolved zones exist for any species tree topology with n ≥ 3 species.
Theorem 4. R* asymptotic consensus trees (RACTs) always match the species tree.
Theorem 3. Greedy asymptotic consensus trees (GACTs) can be misleading estimators of species trees for the 4-species asymmetric tree and for any species tree with n > 4 species.
What about finite samples?
If you sample 10 loci, you could have:
All 10 match the species tree
9 match the species tree, 1 disagrees
8 match the species tree, 2 disagree, etc.
You can consider gene trees as categories and use multinomial probabilities for the probability of your sample
samples
knk
n
kk TnncIpp
nn
nTnnc k )),,((
!!
!]),,(Pr[ 11
11
1
R* consensus, y = 0.4, x = 0.6
Conclusion
Coalescent gene tree probabilities can be used to prove or disprove the statistical consistency of species tree estimators.
Number of genes
Pro
babi
lity
R* consensus, y = x = 0.1