The latest version is at ...acquired bortezomib resistance(18-20). However, free β5 subunits are catalytically inactive, and contain a pro-sequence that would preclude bortezomib

Page 1

NRF2 and POMP in Bortezomib Resistance

The Nuclear Factor (Erythroid-derived 2)-like 2 and Proteasome Maturation Protein Axis Mediates

Bortezomib Resistance in Multiple Myeloma

Bingzong Li1,2

, Jinxiang Fu1, Ping Chen

1, Xueping Ge

1, Yali Li

1, Isere Kuiatse

2, Hua Wang

2, Huihan

Wang2, Xingding Zhang

2, and Robert Z. Orlowski

2,3

From the1Department of Hematology, the Second Affiliated Hospital of Soochow University, Suzhou

215006, Jiangsu, China, the 2Department of Lymphoma&Myeloma, The University of Texas MD

Anderson Cancer Center, Houston, TX, USA,and the 3Department of Experimental Therapeutics, The

University of Texas MD Anderson Cancer Center, Houston, TX, USA.

Running title: NRF2 and POMP in Bortezomib Resistance

To whom correspondence should be addressed: Dr. Robert Z. Orlowski, The University of Texas MD

Anderson Cancer Center, Department of Lymphoma & Myeloma, 1515 Holcombe Blvd., Unit 429,

Houston, TX 77030-4009, E-mail: [email protected], Telephone 713-794-3234, Fax 713-563-

5067

Keywords:multiple myeloma, drug resistance, ATRA, bortezomib, NRF2, POMP

Background:Acquired proteasome inhibitor

resistance emerges in myeloma patients through

incompletely understood mechanisms.

Results:Activation of Nuclear factor (erythroid-

derived 2)-like 2 (NRF2) and Proteassemblin

(POMP) was linked to bortezomib resistance,

while their inhibition reversed resistance.

Conclusion:The NRF2/POMP axis contributes to

bortezomib resistance.

Significance:NRF2/POMP axis inhibition can be

translated to the clinic to reverse bortezomib

resistance and induce chemosensitization.

ABSTRACT

Resistance to the proteasome inhibitor

bortezomib is an emerging clinical problem

whose mechanisms have not been fully elucidated.

We considered the possibility that this could be

associated with enhanced proteasome activity in

part through the action of Proteasome maturation

protein (POMP). Bortezomib-resistant myeloma

models were used to examine the correlation

between POMP expression and bortezomib

sensitivity. POMP expression was then modulated

using genetic and pharmacologic approaches to

determine the effects on proteasome inhibitor

sensitivity in cell lines and in vivo models.

Resistant cell lines were found to overexpress

POMP, and while its suppression in cell lines

enhanced bortezomib sensitivity, POMP

overexpression in drug-naïve cells conferred

resistance. Overexpression of POMP was

associated with increased levels of Nuclear factor

(erythroid-derived 2)-like (NRF2), and NRF2 was

found to bind to and activate the POMP promoter.

Knockdown of NRF2 in bortezomib-resistant

cells reduced POMP levels and proteasome

activity, while its overexpression in drug-naïve

cells increased POMP and proteasome activity.

The NRF2 inhibitor all-trans retinoic acid (ATRA)

reduced cellular NRF2 levels, and increased the

anti-proliferative and pro-apoptotic activities of

bortezomib in resistant cells, while decreasing

proteasome capacity. Finally, the combination of

ATRA with bortezomib showed enhanced activity

against primary patient samples, and in a murine

model of bortezomib-resistant myeloma.Taken

together, these studies validate a role for the

NRF2/POMP axis in bortezomib resistance, and

identify NRF2 and POMP as potentially attractive

targets for chemosensitization to this proteasome

inhibitor.

http://www.jbc.org/cgi/doi/10.1074/jbc.M115.664953The latest version is at JBC Papers in Press. Published on October 19, 2015 as Manuscript M115.664953

Copyright 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

2

INTRODUCTION

Inhibition of the function of the ubiquitin-

proteasome pathway with the proteasome

inhibitor bortezomib is an accepted standard of

care for the treatment of relapsed and/or

refractory multiple myeloma both alone(1,2), and

as part of rationally designed combination

regimens(3). In addition, bortezomib-based

therapies have been incorporated into the front-

line setting for patients with newly diagnosed

myeloma(4-7), and are being considered in other

settings as well, including as part of maintenance

therapy(8). Indeed, together with other advances,

such as the development of immunomodulatory

agents, bortezomib has contributed to a doubling

in the overall survival of myeloma patients over

the last decade(9-12). Myeloma cells may be

especially sensitive to proteasome inhibitors

because protein turnover capacity is reduced

during plasma cell differentiation(13). This

increases proteasome load relative to capacity,

thereby triggering cellular stress and enhancing

reliance on the unfolded protein response for

survival, which is easily overwhelmed by

proteasome inhibitors through their rapid

induction of ubiquitin-protein conjugates. Indeed,

the ratio of proteasome load to capacity may

determine apoptotic sensitivity to bortezomib,

with plasma cells having a high load and/or low

capacity showing sensitivity(14). However, even

in patients whose disease initially responds very

well to bortezomib, resistance eventually

develops in the majority, thereby limiting the

reuse of regimens that were previously

successful(15-17).

Initial studies in leukemia cell lines described

a role for over-expression of the β5 proteasome

subunit targeted by bortezomib, and showed that

shRNA-mediated knockdown of β5 to some

extent restored bortezomib sensitivity (18-

20).Also, mutations in the β5 subunit’s

bortezomib binding pocket were implicated in

acquired bortezomib resistance(18-20). However,

free β5 subunits are catalytically inactive, and

contain a pro-sequence that would preclude

bortezomib binding(21,22), while β5 mutations

were later found to be absent from patient-derived

samples(23,24). A more recent study

demonstrated that proteasome inhibitor resistance

occurred through emergence of plasmablasts with

reduced immunoglobulin production(25). These

precursor cells have a decreased proteasome load

and better balance between load and capacity,

thereby reducing cellular stress and apoptotic

sensitivity. If this were the only mechanism of

acquired resistance, however, all refractory

patients would have oligo-secretory or non-

secretory myeloma, which is not the case(15-17).

We therefore approached this area with the

hypothesis that increased proteasome capacity

could cause resistance by also modulating the

load/capacity ratio in a manner that would reduce

cell stress(26). Moreover, we considered the

possibility that this could occur by enhancing the

efficiency of assembly of the 20S proteasome

core particle. This occurs through the coordinated

action of proteasome assembly chaperones (PACs)

1-4, and of Proteasome maturation protein

(POMP; Proteassemblin)(21,22), and since the

latter is responsible for assembly of the

catalytically active subunit rings, we focused on

this chaperone.

In the current study, using previously

established and validated myeloma models of

bortezomib resistance(27), we report findings

demonstrating that POMP over-expression is

indeed associated with resistance. Its expression

was sufficient by itself to confer resistance, and

POMP activation was associated with induction

of an upstream transcription factor, Nuclear factor,

erythroid 2-like 2 (NRF2), and with enhanced

proteasome activity. Finally, suppression of

either NRF2 or POMP using either short hairpin

(sh) RNAs or a pharmacologic agentrestored

sensitivity in cell lines, primary plasma cells, and

an in vivo myeloma model.

EXPERIMENTAL PROCEDURES

Cell lines and primary samples—Drug-naïve and

bortezomib-resistant myeloma cell lines were

developed and maintained as described

previously(27). Cell line authentication was

performed by our Cell Line Characterization Core

using short tandem repeat profiling. Bortezomib

was removed from culture for at least seven days

prior to all experiments, unless indicated

otherwise, to negate the possibility that

proteasome inhibitor-induced oxidative stress was

impacting upon NRF2 and POMP expression.

3

Primary plasma cells were purified from bone

marrow aspirates collected from patients under an

approved protocol from the Institutional Review

Board at the Second Affiliated Hospital of

Soochow University after informed consent was

obtained in compliance with the Declaration of

Helsinki. The clinical history, including prior

treatments, of the patients whose samples were

used is shown in Table 1.

Viability assays—Proliferation and viability

assays with bortezomib (Selleck Chemical;

Houston, TX) and all-trans retinoic acid

(ATRA)(Sigma-Aldrich; Saint Louis, MO) were

performed as described previously (28). Briefly,

cell lines or primary samples were treated with

the indicated compound for a minimum of 24

hours, unless otherwise indicated, followed by the

addition of the tetrazolium reagent WST-1.

Colorimetric detection of metabolic activity was

then obtained on a Perkin Elmer Victor3V plate

reader (Waltham, MA). Data were normalized to

vehicle controls, which were arbitrarily set at 100%

viability, and all data points are represented as the

mean with the standard deviation (SD).

Immunoblotting—Cells were harvested and

lysed in 1x Lysis Buffer (Cell Signaling

Technology; Danvers, MA), followed by

resolution on gradient gels (Thermo Fisher

Scientific; Carlsbad, CA), transferred to

nitrocellulose (Bio-Rad Laboratories, Inc.;

Hercules, CA), and probed with the indicated

antibodies. Primary anti-POMP, anti-NRF2, anti-

Kelch-like ECH-associated Protein 1 (KEAP1)

and anti-cleaved Caspase 3 antibodies were from

Cell Signaling Technology (Beverly, MA),

the20S proteasome β5subunit (PSMB5) antibody

was from Santa Cruz Biotechnology, while anti-

β-Actin was from Sigma-Aldrich. Densitometric

quantitation was obtained using ImageJ software

(National Institutes of Health;

http://rsbweb.nih.gov/ij/), and normalized to β-

Actin, and either vehicle-treated or wild-type

controls, which were arbitrarily set to 1. Real-time RT-PCR—Real-time PCR was

carried out as described previously, with some

modifications (28). Briefly, total RNA was

isolated from cultured cells or tumor tissues using

Trizol (Thermo Fisher Scientific), and cDNA was

synthesized using a High Capacity cDNA Reverse

Transcription kit (Applied Biosystems; Foster

City, CA). Quantitative real-time (q) PCR was

performed using the TaqMan Gene Expression

Master Mix and the POMP (FAM™), NRF2

(FAM™), proteasome β5 subunit, and

Glyceraldehyde 3-phosphate dehydrogenase

(GAPDH; VIC®) TaqMan Gene Expression

Assays as multiplexed, triplicate samples on a

StepOnePlus PCR System (Applied Biosystems).

Relative quantification was done using the

comparative CT method after normalization to the

internal GAPDH control, where all samples were

then normalized to wild-type or vehicle controls.

POMP and NRF2 silencing—Six Lentiviral-

based shRNAs targeted to POMP, eight

Lentiviral-based shRNAs targeted to NRF2, or a

non-specific scrambled control (Sigma-Aldrich)

were transfected with the packaging vectors

psPAX2 and pMD2.G into 293T cells by calcium

chloride to produce the Lentiviruses. Two days

later, the supernatants were collected, filtered,

concentrated, and used for experiments or frozen

at −80°C. KAS-6/1 bortezomib-resistant (V10R)

and OPM-2 V10R cells were transduced by using

Lentiviruses with polybrene (8μg/mL; Sigma-

Aldrich), and infected cells were selected with 2

μg/mL puromycin. The expression of POMP or

NRF2 was determined by Western blot analysis

and real-time PCR. Two of the Lentiviral-based

shRNAs targeted to POMP, constructs 3 and 5,

and two for NRF2, constructs 6 and 8, were

validated for further studies. POMP shRNA

Lentiviral vectors contained two target-specific

constructs:

CCGGGGGTCTATTTGCTCCGCTAAACTCG

AGTTTAGCGGAGCAAATAGACCCTTTTTG;

CCGGCTATTGGATTTGAGGATATTCCTCG

AGGAATATCCTCAAATCCAATAGTTTTTG.

NRF2 shRNA Lentiviral vectors also contained

two target-specific constructs:

CCGGGCACCTTATATCTCGAAGTTTCTCGA

GAAACTTCGAGATATAAGGTGCTTTTT;

CCGGCCGGCATTTCACTAAACACAACTCG

AGTTGTGTTTAGTGAAATGCCGGTTTTT.

Sequences from POMP construct 3 were then also

used in some transient transfection assays to

knockdown POMP without subsequent antibiotic

selection. Non-targeting shRNAs (KO-NT) or

shRNAs targeting POMP (KO-3) were introduced

by electroporation using the Neon® Transfection

System (Thermo Fisher Scientific).

POMP and NRF2 expression—pCMV6-XL5

vectors containing POMP or NRF2 cDNAs were

4

purchased from OriGene (Rockville, MD).

POMP or NRF2 were subcloned into Lentiviral

vector transfer plasmids pCDH-CMV-MCS-EF1-

coGFP to generate pCDH-CMV-POMP-EF1-

coGFP or pCDH-CMV-NRF2-EF1-coGFP. The

recombinant pCDH-CMV-POMP-EF1-coGFP

vector, pCDH-CMV-NRF2-EF1-coGFP vector,

or the control vector pCDH-CMV-MCS-EF1-

coGFP was transfected with the packaging

vectors psPAX2 and pMD2.G into 293T cells by

calcium chloride to produce Lentiviruses. KAS-

6/1 and OPM-2 cells were infected with control,

or either POMP- or NRF2-expressing

Lentiviruses, and expression was verified by

qPCR and Western blotting.

Proteasome activity assays—Chymotrypsin-

like (ChT-L) proteasome activity was assayed in a

total volume of 200 μL using 96-well plates

performed according to the manufacturers

instructions (Promega; Madison, WI). Briefly,

Proteasome-Glo™ Cell-Based Reagentwas

prepared by reconstituting the luciferin detection

reagent, Proteasome-Glo™ Cell-based buffer, and

the Suc-LLVY-Glo™ substrate was then added to

an equal volume of samples containing 15,000

cells, and incubated for a minimum of 5–10

minutes before luminescence measurements.

Chromatin immunoprecipitation (ChIP)—Cells

were first cross-linked with 2% paraformadehyde

for 10 minutes at 37°C and sonicated. DNA-

protein complexes were isolated with a ChIP

assay kit (EMD Millipore; Billerica, MA)

according to the manufacturer’s instructions with

antibodies against NRF2 (Abcam; Cambridge,

MA). The precipitated DNA was purified and

quantified by real-time PCR. Primers used were

as follows: 5’-CCTCCAACCTCATCTCAT-3’

(forward) and 5’-

CTGAATAGCTGGGACTACA-3’ (reverse). The

results were normalized relative to the input

control.

Luciferase assay—Luciferase (luc) reporter

assays were performed using the LightSwitch

Dual Assay System (SwitchGear

Genomics;Carlsbad, CA) according to the

manufacturer’s instructions. KAS-6/1 and KAS-

6/1 V10R cells were transiently transfected in

triplicate with either empty-luc or POMP-luc,

along with a Cypridina TK control construct and

empty pCMV6-XL5 vector or pCMV6-XL5-

NRF2 by electroporation using the Neon®

Transfection System (Thermo Fisher Scientific).

The Renilla luciferase/Cypridina luciferase ratio

was calculated to normalize for transfection

efficiency.

Electrophoretic mobility shift assay—DNA-

protein binding assays were carried out with

nuclear extract from KAS-6/1 V10Rcells with 3’-

biotinylated synthetic complementary

oligonucleotides (Sigma-Aldrich). The sequence

of the oligonucleotide used was 5’-

CTCCAGCCTAGGTGACACAGCAAGA-3’,

and the labeled oligonucleotides were annealed by

mixing equal molar amounts of the two single-

stranded oligonucleotides, heating to 95°C for 5

minutes, followed by ramp cooling to 25°C over a

period of 45 minutes. Nuclear extracts were

prepared using the Nuclear/Cytosol Fractionation

Kit (BioVision; Carlsbad, CA) following the

manufacturer’s instructions. Binding reactions

were carried out for 20 minutes at room

temperature in the presence of 50 ng/μL poly(dI-

dC), 0.05% Nonidet P-40, 5 mM MgCl2, 10 mM

EDTA, and 2.5% glycerol in 1× binding

bufferusing 20 fmol of biotin-end-labeled target

DNA and 4μg of nuclear extract. Additionally, 4

pmol of unlabeled probe was added to some

binding reactions as a specific competitor DNA.

Assays were loaded onto native 4%

polyacrylamide gels pre-electrophoresed for 60

min in 0.5× Tris borate/EDTA, and

electrophoresed at 100 V before being transferred

onto a positively charged nylon membrane in 0.5×

Tris borate/EDTA at 100 V for 30 minutes.

Transferred DNAs were cross-linked to the

membrane at 120 mJ/cm2 and detected using

horseradish peroxidase-conjugated streptavidin

according to the manufacturer’s instructions using

the LightShift chemiluminescent EMSA kit

(Thermo Fisher Scientific).

Xenograft modeling—Bortezomib-resistant

KAS-6/1 cells (7x106cells/mouse) were

subcutaneously xenografted into 6-week old non-

obese diabetic severe combined

immunodeficiency (NOD/SCID) mice (NOD.Cg-

Prkdc(scid) Il2rg(tm1Wjl)/SzJ; Jackson

Laboratories; Bar Harbor, ME) with MatriGel

(BD Biosciences; San Jose, CA) under a protocol

approved by the institutional Animal Care and

Use Facility. The mice were randomized into four

groups with five subjects in each cohort, and

treatments were administered by intraperitoneal

5

injection using peanut oil as a carrier thrice

weekly, starting on day 7 post-implantation.

Tumors were monitored by caliper measurement,

and tumor volume was determined using the

equation volume=0.4LxW2. The CONTRAST

statement in PROC MIXED procedure in SAS

(SAS Institute, Inc.; Cary, NC) was used to

compare the tumor growth rates between each

pair of groups. The tumor volume was log-

transformed to satisfy the normality assumption

of the models.Tumors were removed for qPCR or

Western blot assays at the indicated timepoint.

Pair-wise differences between the combination

group (bortezomib + ATRA) vs. ATRA alone,

combination vs. bortezomib, combination vs.

control, bortezomib vs. control and ATRA vs.

control were examined using the ESTIMATE

statement in PROC MIXED for each time point.

Statistically significant determinations were made

by calculation of the probability of χ2.

RESULTS

Bortezomib-resistant cells over-express

POMP—Previous studies from our group

determined that bortezomib-resistant myeloma

cells exposed to proteasome inhibitors showed a

more rapid recovery of the chymotrypsin-like

proteasome activity(27). We considered the

possibility that this could be due to more rapid

assembly of new proteasomes and increased

proteasome capacity, and analysis of gene

expression profiling data comparing bortezomib-

resistant cells with their sensitive counterparts

revealed up-regulation of POMP(data not

shown).To further validate these findings, we

performed qPCR comparing bortezomib-resistant

(V10R) RPMI 8226, OPM-2, ANBL-6, and KAS-

6/1 cells with their wild-type (WT), vehicle-

treated and drug-naïve counterparts passaged in

parallel. Bortezomib-resistant cells consistently

showed enhanced POMP mRNA levels in each of

the cell line models studied (Figure 1A), with, for

example, up to a ten-fold increase in RPMI 8226

V10R cells compared to their WT controls.

These enhanced messenger levels led to an

increased accumulation of POMP protein as

judged by Western blotting (Figure 1B), with up

to a 4-fold increase, for example, in the RPMI

8226 cells. Finally, to determine if POMP levels

were increased in primary samples, Western

blotting was performed on CD138+ plasma cells

from four bortezomib-naïve patients and three

bortezomib-resistant patients. The latter showed a

consistently higher POMP expression level

(Figure 1C), supporting the hypothesis that higher

POMP levels may be associated with bortezomib

resistance.

POMP modulates bortezomib sensitivity—

Since a number of mechanisms may be

simultaneously activated to confer bortezomib

resistance in myeloma cell lines, we sought to

confirm that changes in POMP were alone

sufficient to modulate sensitivity. We therefore

generated KAS-6/1 V10R cells infected with

Lentiviral vectors expressing either a control,

non-targeting (NT) shRNA, or one of two

different shRNAs that successfully suppressed

POMP (KO-3 and KO-5)(Figure 2A). When

these cells were then treated with either vehicle or

bortezomib, compared to the parental KAS-6/1

V10R and NT controls, the KO-3 and -5 cells

with lower levels of POMP were consistently

more sensitive to proteasome inhibition(Figure

2B). Moreover, the resistance to bortezomib in

V10R cells almost fully reversed to the levels of

KAS-6/1 wild-type (WT) cells(Figure 2B), which

was associated with inhibited proteasome

chymotrypsin-like activity(Figure 2C). To

confirm these findings further, we compared

OPM-2 V10R and NT cells that had high levels of

POMP expression with OPM-2 KO-3 and -5 cells

(Figure 2G). As had been the case in the KAS-

6/1 models, OPM-2 cells with lower levels of

POMP were more sensitive to rechallenge with

bortezomib, which produced a greater decline in

viability (Figure 2H) and chymotrypsin-like

activity(Figure 2I).

It also was of interest to determine whether

over-expression of POMP was by itself able to

confer a bortezomib resistant phenotype. To that

end, we used drug-naïve KAS-6/1 WT cells and

constructed clones that bore either the empty

over-expression vector (OE-control) or POMP

(OE-POMP)(Figure 2D). Contrary to what was

seen with POMP suppression, when POMP was

over-expressed, bortezomib resistance(Figure 2E)

and enhanced chymotrypsin-like activity(Figure

2F) were seen in KAS-6/1 cells. Notably, over-

expression of POMP in OPM-2 cells (Figure 2J)

similarly reduced sensitivity to bortezomib

(Figure 2K), and enhanced chymotrypsin-like

activity (Figure 2L), indicating that POMP is

6

indeed a modulator of proteasome inhibitor

sensitivity.

To further examine if POMP levels were

associated with bortezomib resistance, POMP

overexpressing (POMP-OE) KAS-6/1 cells

(Figure 2M) and OPM-2 (Figure 2N) cells were

transiently transfected with non-targeting shRNAs

(KO-NT), or with shRNAs targeting POMP (KO-

3).Transfection with the POMP shRNAs

consistently made the POMP over-expressing

cells more sensitive to proteasome inhibition than

the non-targeting controls, though they did not

return sensitivity to the level of WT cells because

of incomplete POMP suppression (not shown).

NRF2 regulates POMP expression—No direct

inhibitors of POMP function have yet been

described, and with the hope of finding an

approach that could suppress POMP expression to

sensitize bortezomib-resistant cells, we studied

the POMP promoter and found a consensus

binding site for NRF-2 within the -2833 to -2842

region of POMP promoter. Also, a ChIP

sequencing study in lymphoblastoid cells had

suggested that the POMP promoter could be a

target for NRF2 binding(29). To determine if

NRF2 indeed influenced POMP expression in

myeloma cells, we first studied the bortezomib-

resistant V10R cells by qPCR and found that, as

had been the case for POMP (Figure 1), they

expressed higher levels of NRF2 mRNA than

their wild-type counterparts (Figure 3A). In

KAS-6/1 cells, for example, NRF2 levels were

increased almost 4-fold in the resistant versus the

sensitive cells. Moreover, this resulted in higher

levels of NRF2 protein expression, as determined

by Western blotting comparing the V10R and WT

cells (Figure 3B). For example, again in the

KAS-6/1 models, NRF2 levels were increased by

two-fold in the bortezomib-resistant cells. To

determine if NRF2 levels were increased in

primary samples, Western blotting was performed

on CD138+ plasma cells from the same four

bortezomib-naïve patients and three bortezomib-

resistant patients used earlier. The latter showed a

relatively higher NRF2 expression level (Figure

3C), supporting the hypothesis that higher NRF2

levels may be associated with higher POMP

levels and bortezomib resistance.

NRF2, along with KEAP1, are parts of a

signaling pathway that is important in cell defense

and survival, including in response to anti-oxidant

stress(30). Since POMP has also been linked to

anti-oxidant defenses(31), this was another reason

we had focused on NRF2 as a target of interest

among the many transcription factors that bound

near the POMP promoter. To more directly test

this possibility, we first performed ChIP in KAS-

6/1 cells using either an anti-NRF2 antibody or

control IgG, followed by PCR to detect sequences

near the POMP promoter. While non-specific

IgG did not appreciably precipitate such

sequences, they were comparatively enriched

when anti-NRF2 antibodies were used (Figure

4A). Moreover, the enrichment was even greater

in the KAS-6/1 V10R bortezomib-resistant cells,

suggesting that there was greater binding of

NRF2. Next, we used a biotin labeled probe

corresponding to one of the NRF2 consensus sites

and nuclear extract from KAS-6/1 V10R cells,

which produced a strong protein-DNA complex in

a mobility shift assay (Figure 4B, lane 2) that

could be competed with cold probe (Figure 4B,

lane 3). Finally, we prepared vectors containing

either the POMP promoter upstream of a Renilla

luciferase gene as a reporter (pPOMP-RenSP), or

the thymidine kinase promoter upstream of a

Cypridina luciferase reporter (pTK-Cluc), which

was used as a transfection control. Compared to

an empty vector Renilla luciferase reporter

(Empty-RenSP; Figure 4C, lane 1), transfection of

the POMP reporter and an empty vector

(pCMV6-XL5) revealed enhanced activity

(Figure 4C, lane 2), consistent with a basal level

of POMP activity in myeloma cells. Notably,

when the POMP reporter was co-transfected with

a vector expressing NRF2 (pCMV6-XL5-NRF2),

a substantial increase in POMP promoter activity

was seen (Figure 4C, lane 3), consistent with an

activating effect of NRF2 on the POMP promoter.

NRF2 regulates proteasome activity—Our

previous data suggested a direct role for the

NRF2/POMP axis in proteasome activity, so to

test that more directly, we developed KAS-6/1

V10R bortezomib-resistant cells in which NRF2

was knocked down. Compared to WT or NT

control cells, suppression of NRF2 with one of

two different shRNAs reduced downstream

POMP levels (Figure 5A), and this was associated

with a reduction in the chymotrypsin-like

proteasome activity (Figure 5B). When these cells

were then treated with either vehicle or

bortezomib, compared to the parental KAS-6/1

7

V10R and NT controls, the KO-6 and -8 cells

with lower levels of NRF2 were consistently

more sensitive to proteasome inhibition, and the

level of bortezomib sensitivity almost reverted to

that of KAS-6/1 WT cells (Figure 5C). These

findings were confirmed in OPM-2 bortezomib-

resistant cells, where NRF2 knockdown reduced

POMP expression (Figure 5G), proteasome

activity (Figure 5H), and cell viability (Figure 5I).

Conversely, when NRF2 was over-expressed in

KAS-6/1 WT drug-naïve cells, POMP expression

also increased (Figure 5D), as did proteasome

activity (Figure 5E), with an up to five-fold or

more induction, and cell viability (Figure 5F).

Finally, qualitatively comparable data were

obtained when NRF2 was over-expressed in drug-

naïve OPM-2 cells (Figure 5J, 5K and 5L).

Together, these data support the hypothesis that

activation of the NRF2/POMP axis is associated

with increased proteasome capacity, which could

make myeloma cells more resistant to proteasome

inhibition by reducing the imbalance between

load and capacity.

Inhibition of NRF2 sensitizes bortezomib-

resistant cells—The involvement of NRF2 in

bortezomib resistance provided us with an avenue

to suppress the NRF2/POMP pathway, since

retinoic acid has been described to inhibit NRF2

activity through activation of retinoic acid

receptor alpha(32). Since ATRA is a clinically

relevant agent in this class which is a standard of

care for promyelocytic leukemia(33), we

examined the possibility that it could be applied

to bortezomib resistance. First, we exposed KAS-

6/1 V10R cells to the indicated concentrations of

ATRA, bortezomib or both for 24 hours, and

noted that bortezomib alone enhanced the levels

of both NRF2 and POMP, while these decreased

with exposure to ATRA alone. ATRA in

combination with bortezomib also inhibited the

levels of both NRF2 and POMP compared to

single-agent treatment with bortezomib (Figure

6A). Notably, there was no associated change in

the levels of KEAP1, which serves as an adaptor

for the E3 ubiquitin ligase responsible for

ubiquitination of NRF2(34). Compared to the

vehicle controls, the single agent ATRA or

bortezomib treatments showed only a slight

ability to reduce the viability of KAS-6/1 V10R

cells (Figure 6B), but the combination regimens

were much more effective in this regard. ATRA

and bortezomib together produced a greater level

of apoptosis, as measured by the appearance of

the cleaved, activated form of caspase 3 (Figure

6C), and the enhanced activity of the

combinations was associated with a greater

reduction in the chymotrypsin-like proteasome

activity (Figure 6D). Importantly, ATRA showed

similar effects in OPM-2 bortezomib-resistant

cells, where it reduced NRF2 and POMP levels

(Figure 6E), enhanced the ability of bortezomib to

reduce cell viability (Figure 6F) and induced

caspase cleavage (Figure 6G), and suppressed

proteasome activity (Figure 6H).

To examine the possibility that ATRA could

enhance the action of bortezomib in drug-

sensitive cells, we performed comparable

experiments in KAS-6/1 and OPM-2 WT cells.

Similar trends were observed in KAS-6/1 (Figure

6I, 6J, 6K and 6L) and OPM-2 cells (Figure 6M,

6N, 6O and 6P), in that ATRA in combination

with bortezomib inhibited the levels of both

NRF2 and POMP compared to single-agent

treatment with bortezomib, and enhanced cell

death. However, the level of enhanced cell death

was smaller than that in the BR cells, in part

because, as expected, bortezomib alone produced

a much more dramatic effect.

ATRA enhances bortezomib activity against

primary samples and in vivo—To inform the

design of future clinical trials, we next examined

the possibility that ATRA could enhance the

efficacy of bortezomib against CD138+ primary

plasma cells from patients with multiple myeloma.

In samples where bortezomib showed minimal

activity, as defined by a less than 20% reduction

in viability as a single agent, such as in MM8 and

MM9 (Figure 7A), addition of ATRA, which

itself showed even less efficacy, showed an

enhanced reduction in viability with the

combination. The same was true in samples

where bortezomib showed greater activity, such

as MM10 through MM12, where again ATRA

increased the ability of bortezomib to reduce

viability. Finally, it was also of interest to

validate these findings in vivo using a

bortezomib-resistant xenograft model. Seven days

after inoculation of KAS-6/1 V10R cells, subject

mice were randomized to treatment with

intraperitoneal injections of vehicle, bortezomib,

ATRA, or the combination, and tumor volumes

were determined from measurements performed

8

by an investigator blinded to the treatment

assignments. Bortezomib and ATRA alone did

show some activity in this setting, but the

bortezomib and ATRA combination regimen

reduced tumor volume (Figure 7B) compared to

either agent alone. These differences reached

statistical significance (Figure 7C), supporting the

possibility that this approach could be translated

to the clinic to overcome bortezomib resistance.

We next tested whether treatment with

bortezomib and ATRA changed expression of

POMP or the 20S proteasome β5 subunit targeted

by bortezomib expression at day 32. ATRA alone

inhibited the mRNA levels of both POMP (Figure

7D, left panel) and the β5 proteasome subunit

(PSMB5; Figure 7D, right panel) compared to the

vehicle controls, while bortezomib alone

stimulated expression of these two genes. In

contrast, the addition of ATRA to bortezomib

significantly reduced POMP and β5 expression

compared to bortezomib alone, and these returned

to levels comparable to those seen in vehicle-

treated controls. Finally, both POMP and β5

expression at the protein level changed in a

pattern consistent with that of their mRNAs

(Figure 7E).

DISCUSSION

The proteasome inhibitor bortezomib is an

important part of the standard of care for

myeloma patients(1-7), and carfilzomib, a

second-generation irreversible inhibitor has

recently been approved in the relapsed and

refractory setting(35). Following the lead of

bortezomib, carfilzomib is being further

developed as part of rationally designed regimens

for patients with either relapsed disease(36,37) or

newly diagnosed myeloma(38). Moreover,

proteasome inhibitors with novel properties are

being developed, such as marizomib, which may

inhibit all three of the major proteolytic activities

of the proteasome, as well as orally bioavailable

inhibitors including ixazomib and oprozomib(39).

In this light, and considering the contribution of

this class of drugs to the improving outcomes in

myeloma(9-12), it seems reasonable to expect that

they will remain part of the standard of care for

this disease for many years to come. However,

due perhaps in part to their incorporation into the

treatment of newly diagnosed patients, resistance

to proteasome inhibitors is an emerging clinical

problem, especially since such patients have an

especially poor prognosis. Indeed, bortezomib-

refractory patients who were also relapsed

following, refractory to, or ineligible to receive

immunomodulatory agents, have been reported to

have a median survival of less than one year(40).

This indicates a strong need to better understand

the mechanisms underlying bortezomib resistance

since this could lead to the design of regimens to

overcome this phenotype, which would extend the

utility of these drugs and, more importantly, if

validated, prolong patient survival.

Our current study has identified POMP as a

modulator of bortezomib resistance in myeloma,

since its overexpression was seen in resistant cell

lines and primary samples (Figure 1). POMP

suppression with shRNAs restored sensitivity,

while its overexpression in drug-naïve cells was

sufficient to induce resistance (Figure 2). Also,

starting with the observation that NRF2 was

induced in bortezomib-resistant cells as well

(Figure 3), we have documented that NRF2

controls POMP levels in myeloma through an

impact on transcription from the POMP promoter

(Figure 4). Notably, overexpression or

suppression of either POMP (Figure 2) or NRF2

(Figure 5) had a consistently greater differential

impact on bortezomib sensitivity in KAS-6/1 cells

than it did in OPM-2 cells. Interestingly, OPM-2

cells expressed higher basal levels of both POMP

and NRF2, and this may explain the differential

effects in these cell lines. A high basal level of

POMP and NRF2 could blunt the impact of a

further overexpression, while a fixed reduction of

either would leave higher levels in OPM-2 cells

than in KAS-6/1 cells, thereby blunting the

impact of shRNAs. These findings are consistent

with a recent study that linked activation of NRF2

by tert-butylhydroquinone and other approaches

to increased POMP expression and pluripotency

in human embryonic stem cells(41). Moreover,

antioxidants and oxidative stress have been shown

to enhance proteasome subunit expression

through signaling pathways involving NRF2

(42,43). However, since overexpression of

POMP was by itself sufficient to induce

bortezomib resistance in drug-naïve cells (Figure

2), this suggests that the compendium of NRF2-

regulated genes was not required for this

phenotype, and that POMP may be rate-limiting.

In addition, this observation is especially

9

interesting since NRF1 was previously implicated

in the recovery of mammalian cells from

proteasome inhibition by up-regulating

proteasome subunit expression(44). Together,

these findings suggest that NRF1 and NRF2 may

work in a coordinated fashion, with the former

inducing proteasome subunits, while the latter

enhances proteasome assembly, both of which

would be needed to restore full proteasome

function. Since knockdown of NRF2 reduced

proteasome activity, and its overexpression

enhanced proteasome capacity (Figure 5), we then

studied the NRF2 inhibitor ATRA, which

sensitized resistant cells to bortezomib, and also

to some extent enhanced bortezomib efficacy in

sensitive cells, though to a much lesser extent

(Figure 6). The lesser impact of ATRA in

sensitive cells was expected, as bortezomib shows

strong activity against drug-naïve myeloma

models, and baseline levels of POMP in sensitive

cells are lower (Figure 1). Notably, ATRA

consistently reduced levels of both NRF2 and

POMP in bortezomib-naïve and –resistant cells

either alone, or in combinations with bortezomib.

Our finding of increased activation of NRF2 is

consistent with the data of Stessman et al(45) ,

who found in mouse and human cell line models

of myeloma that bortezomib resistance produced

a gene signature enriched for downstream targets

of this transcription factor, though they did not

look at what downstream NRF2 effectors could

be involved.

ATRA with bortezomib enhanced activity

against primary plasma cells and, in our in vivo

studies, against a murine model of bortezomib

resistance(Figure 7). We used a subcutaneous

xenograft model in these studies, which probably

best represents myeloma with an extramedullary

plasmacytoma. This has been associated with a

poor clinical prognosis in myeloma patients (46),

and may be linked to bortezomib-resistance(47),

but does not fully recapitulate a physiologically

relevant bone marrow microenvironment. Thus,

studies in a systemic myeloma model, or a

humanized model providing bone cells, immune

cells, and the appropriate cytokine milieu (48)

could provide further insights into the utility of

ATRA as an approach to resensitize to

bortezomib. In our in vivo modeling, ATRA

reduced POMP mRNA and protein levels, which

was expected based on its impact on the NRF2-

POMP axis. Also of interest was that 5 subunit

protein and mRNA expression levels were

suppressed by ATRA. The reduction of 5

protein could be due to the short half-life of the

5 precursor (49), whose turnover could be

enhanced when it cannot be incorporated into

proteasomes because of reduced POMP levels.

Alternatively, or in addition to that, ATRA may

have a direct effect on the PSMB5 gene to reduce

promoter transcription and thereby protein levels,

which would provide another mechanism for it to

enhance the activity of bortezomib. Additional

studies will therefore be needed to fully elucidate

the effects of ATRA on proteasome biogenesis

pathways. However, since inhibition of NRF2

and POMP using shRNAs was sufficient to

enhance the efficacy of bortezomib, at least part

of ATRA’s sensitization likely is due to its effect

on the NRF2/POMP axis.

POMP is a proteasome assembly chaperone

which is involved in the addition of subunits to a

pre-formed ring of seven subunits(50), and

generates a hemi-proteasome once ring

assembly is completed. Two of these hemi-

proteasomes are then combined to form the 20S

core particle, which contains all of the proteolytic

activities of the proteasome(21,22). In addition,

POMP can bind to endoplasmic reticulum

membranes to facilitate proteasome assembly

close to one of the major sites at which

proteasomes function(51), but POMP is

ultimately cleaved by the proteasome once the

latter is activated(21,22). A number of studies

have previously shown that transient inhibition of

the proteasome produces up-regulation of

proteasome subunit synthesis(52,53), as cells

attempt to restore normal protein homeostasis.

POMP is also up-regulated under such conditions,

but it has not been completely clear if this was

due to coordinate regulation of POMP with

proteasome subunits, or if this was simply

because POMP degradation was suppressed by

proteasome inhibition. Our data show that POMP

over-expression can be a genetically stable,

acquired phenotype in proteasome inhibitor-

resistance, since these cells were free of

bortezomib treatment for as long as eight weeks

or more. Also, in that POMP over-expression or

suppression was by itself sufficient to confer

resistance or sensitization to bortezomib,

10

respectively, our findings indicate that POMP

alone, aside from any impact on NRF2, is a

mediator of bortezomib sensitivity. Thus, our cell

lines may serve to some extent as models of what

is seen clinically, since retreatment with

bortezomib, even in patients who had all

previously responded well to this agent, produces

response rates of only 50-60%(54,55), indicating

a rapid acquisition of resistance. Moreover, the

involvement of POMP may provide some

indication of why these patients have a poor

overall prognosis, since both NRF2(56) and

POMP(30) have been linked to cellular defense

mechanisms against electrophilic and oxidative

stress. In that other drugs used against myeloma

work in part by generating reactive oxygen

species, including alkylating agents and

anthracyclines, activation of the NRF2/POMP

axis may reduce sensitivity to these other drug

classes as well.

Finally, our translational studies suggest that

strategies targeting and suppressing the

NRF2/POMP axis may be attractive ones to

enhance bortezomib sensitivity in drug-naïve

patients, and to restore some sensitivity in drug-

resistant patients. Approaches that should be

successful in this regard include the use of NRF2

inhibitors, or of agents that would induce KEAP1,

which would contribute to turnover of NRF2(57)

and thereby reduce POMP levels. In this work,

we have validated ATRA as one such strategy and

this is clinically relevant, since ATRA is already

in use against acute promyelocytic leukemia(33).

A regimen of ATRA with bortezomib could

therefore be piloted first in phase I to determine

its safety, and then to examine its ability to

overcome resistance to this proteasome inhibitor

in larger, preferably randomized phase II or III

studies.

ACKNOWLEDGEMENTS

This work was supported by The MD

Anderson Cancer Center SPORE in Multiple

Myeloma (P50 CA142509), and the authors

would like to also thank the MD Anderson

Characterized Cell Line Core Facility, which is

supported by the Cancer Center Support Grant

(CA16672). B.L. would like to acknowledge

grant support from the National Natural Science

Foundation of China (81172256 and 81272631),

Applied Basic Research Programs of Suzhou City

(No.SYS201546) and China Postdoctoral Science

Foundation fundedproject (2014M550307).

R.Z.O. would also like to acknowledge support

from the Florence Maude Thomas Cancer

Research Professorship, R01 CA184464, and

thank the Brock Family Myeloma Research Fund,

the Yates Ortiz Myeloma Fund, the Jay Solomon

Myeloma Research Fund, and the Diane & John

Grace Family Foundation.

DISCLOSURE OF CONFLICTS OF

INTEREST

R.Z.O. has served on advisory boards for

Millennium: The Takeda Oncology Company,

which developed and markets bortezomib, and for

Onyx Pharmaceuticals, which developed and

markets carfilzomib, and received research

funding from both entities, but these funds did not

support the current line of investigation. The

other authors have no relevant conflicts of interest

to disclose.

AUTHORSHIP CONTRIBUTIONS

B.L. designed and performed the majority of the

experiments, analyzed the data, prepared the

figures, and wrote a draft of the manuscript. J.F.

facilitated access to primary samples.J.F.,

P.C.,X.G. and Y.L. assisted with some

experiments and were involved in data analysis

and manuscript preparation, and provided

statistical analysesof mouse xenograft modeling.

I.K., H.W., and X.D.-Z. performed in vivo

experiments. H.W. generated Lentiviral

constructs. R.Z.O. provided research guidance,

supervised the work herein, and proofed the

manuscript.

Page 11

REFERENCES

1. Richardson, P. G., Barlogie, B., Berenson, J., Singhal, S., Jagannath, S., Irwin, D., Rajkumar, S. V., Srkalovic, G., Alsina, M., Alexanian, R., Siegel, D., Orlowski, R. Z., Kuter, D., Limentani, S. A., Lee, S., Hideshima, T., Esseltine, D. L., Kauffman, M., Adams, J., Schenkein, D. P., and Anderson, K. C. (2003) A phase 2 study of bortezomib in relapsed, refractory myeloma. N Engl J Med 348, 2609-2617

2. Richardson, P. G., Sonneveld, P., Schuster, M. W., Irwin, D., Stadtmauer, E. A., Facon, T., Harousseau, J. L., Ben-Yehuda, D., Lonial, S., Goldschmidt, H., Reece, D., San-Miguel, J. F., Blade, J., Boccadoro, M., Cavenagh, J., Dalton, W. S., Boral, A. L., Esseltine, D. L., Porter, J. B., Schenkein, D., and Anderson, K. C. (2005) Bortezomib or high-dose dexamethasone for relapsed multiple myeloma. N Engl J Med 352, 2487-2498

3. Orlowski, R. Z., Nagler, A., Sonneveld, P., Blade, J., Hajek, R., Spencer, A., San Miguel, J., Robak, T., Dmoszynska, A., Horvath, N., Spicka, I., Sutherland, H. J., Suvorov, A. N., Zhuang, S. H., Parekh, T., Xiu, L., Yuan, Z., Rackoff, W., and Harousseau, J. L. (2007) Randomized phase III study of pegylated liposomal doxorubicin plus bortezomib compared with bortezomib alone in relapsed or refractory multiple myeloma: combination therapy improves time to progression. J Clin Oncol 25, 3892-3901

4. San Miguel, J. F., Schlag, R., Khuageva, N. K., Dimopoulos, M. A., Shpilberg, O., Kropff, M., Spicka, I., Petrucci, M. T., Palumbo, A., Samoilova, O. S., Dmoszynska, A., Abdulkadyrov, K. M., Schots, R., Jiang, B., Mateos, M. V., Anderson, K. C., Esseltine, D. L., Liu, K., Cakana, A., van de Velde, H., and Richardson, P. G. (2008) Bortezomib plus melphalan and prednisone for initial treatment of multiple myeloma. N Engl J Med 359, 906-917

5. Harousseau, J. L., Attal, M., Avet-Loiseau, H., Marit, G., Caillot, D., Mohty, M., Lenain, P., Hulin, C., Facon, T., Casassus, P., Michallet, M., Maisonneuve, H., Benboubker, L., Maloisel, F., Petillon, M. O., Webb, I., Mathiot, C., and Moreau, P. (2010) Bortezomib plus dexamethasone is superior to vincristine plus doxorubicin plus dexamethasone as induction treatment prior to autologous stem-cell transplantation in newly diagnosed multiple myeloma: results of the IFM 2005-01 phase III trial. J Clin Oncol 28, 4621-4629

6. Cavo, M., Tacchetti, P., Patriarca, F., Petrucci, M. T., Pantani, L., Galli, M., Di Raimondo, F., Crippa, C., Zamagni, E., Palumbo, A., Offidani, M., Corradini, P., Narni, F., Spadano, A., Pescosta, N., Deliliers, G. L., Ledda, A., Cellini, C., Caravita, T., Tosi, P., and Baccarani, M. (2010) Bortezomib with thalidomide plus dexamethasone compared with thalidomide plus dexamethasone as induction therapy before, and consolidation therapy after, double autologous stem-cell transplantation in newly diagnosed multiple myeloma: a randomised phase 3 study. Lancet 376, 2075-2085

7. Sonneveld, P., Schmidt-Wolf, I. G., van der Holt, B., El Jarari, L., Bertsch, U., Salwender, H., Zweegman, S., Vellenga, E., Broyl, A., Blau, I. W., Weisel, K. C., Wittebol, S., Bos, G. M., Stevens-Kroef, M., Scheid, C., Pfreundschuh, M., Hose, D., Jauch, A., van der Velde, H., Raymakers, R., Schaafsma, M. R., Kersten, M. J., van Marwijk-Kooy, M., Duehrsen, U., Lindemann, W., Wijermans, P. W.,

12

Lokhorst, H. M., and Goldschmidt, H. M. (2012) Bortezomib induction and maintenance treatment in patients with newly diagnosed multiple myeloma: results of the randomized phase III HOVON-65/ GMMG-HD4 trial. J Clin Oncol 30, 2946-2955

8. Anderson, K. C., Alsina, M., Bensinger, W., Biermann, J. S., Cohen, A. D., Devine, S., Djulbegovic, B., Faber, E. A., Jr., Gasparetto, C., Hernandez-Illizaliturri, F., Huff, C. A., Kassim, A., Krishnan, A. Y., Liedtke, M., Meredith, R., Raje, N., Schriber, J., Singhal, S., Somlo, G., Stockerl-Goldstein, K., Treon, S. P., Weber, D., Yahalom, J., Yunus, F., Shead, D. A., and Kumar, R. (2013) Multiple myeloma, version 1.2013. J Natl Compr Canc Netw 11, 11-17

9. Mahindra, A., Laubach, J., Raje, N., Munshi, N., Richardson, P. G., and Anderson, K. (2012) Latest advances and current challenges in the treatment of multiple myeloma. Nat Rev Clin Oncol 9, 135-143

10. Pozzi, S., Marcheselli, L., Bari, A., Liardo, E. V., Marcheselli, R., Luminari, S., Quaresima, M., Cirilli, C., Ferri, P., Federico, M., and Sacchi, S. (2013) Survival of multiple myeloma patients in the era of novel therapies confirms the improvement in patients younger than 75 years: a population-based analysis. Br J Haematol 163, 40-46

11. Kumar, S. K., Dispenzieri, A., Lacy, M. Q., Gertz, M. A., Buadi, F. K., Pandey, S., Kapoor, P., Dingli, D., Hayman, S. R., Leung, N., Lust, J., McCurdy, A., Russell, S. J., Zeldenrust, S. R., Kyle, R. A., and Rajkumar, S. V. (2014) Continued improvement in survival in multiple myeloma: changes in early mortality and outcomes in older patients. Leukemia 28, 1122-1128

12. Ozaki, S., Harada, T., Saitoh, T., Shimazaki, C., Itagaki, M., Asaoku, H., Kuroda, Y., Chou, T., Yoshiki, Y., Suzuki, K., Murakami, H., Hayashi, K., Mina, R., Palumbo, A., and Shimizu, K. (2014) Survival of Multiple Myeloma Patients Aged 65-70 Years in the Era of Novel Agents and Autologous Stem Cell Transplantation. A Multicenter Retrospective Collaborative Study of the Japanese Society of Myeloma and the European Myeloma Network. Acta Haematol 132, 211-219

13. Cenci, S., Mezghrani, A., Cascio, P., Bianchi, G., Cerruti, F., Fra, A., Lelouard, H., Masciarelli, S., Mattioli, L., Oliva, L., Orsi, A., Pasqualetto, E., Pierre, P., Ruffato, E., Tagliavacca, L., and Sitia, R. (2006) Progressively impaired proteasomal capacity during terminal plasma cell differentiation. EMBO J 25, 1104-1113

14. Bianchi, G., Oliva, L., Cascio, P., Pengo, N., Fontana, F., Cerruti, F., Orsi, A., Pasqualetto, E., Mezghrani, A., Calbi, V., Palladini, G., Giuliani, N., Anderson, K. C., Sitia, R., and Cenci, S. (2009) The proteasome load versus capacity balance determines apoptotic sensitivity of multiple myeloma cells to proteasome inhibition. Blood 113, 3040-3049

15. Chen, D., Frezza, M., Schmitt, S., Kanwar, J., and Dou, Q. P. (2011) Bortezomib as the first proteasome inhibitor anticancer drug: current status and future perspectives. Curr Cancer Drug Targets 11, 239-253

16. Laubach, J. P., Mitsiades, C. S., Roccaro, A. M., Ghobrial, I. M., Anderson, K. C., and Richardson, P. G. (2009) Clinical challenges associated with bortezomib therapy in multiple myeloma and Waldenstroms Macroglobulinemia. Leukemia & lymphoma 50, 694-702

13

17. Orlowski, R. Z., and Kuhn, D. J. (2008) Proteasome inhibitors in cancer therapy: lessons from the first decade. Clin Cancer Res 14, 1649-1657

18. Lu, S., Yang, J., Song, X., Gong, S., Zhou, H., Guo, L., Song, N., Bao, X., Chen, P., and Wang, J. (2008) Point mutation of the proteasome beta5 subunit gene is an important mechanism of bortezomib resistance in bortezomib-selected variants of Jurkat T cell lymphoblastic lymphoma/leukemia line. The Journal of pharmacology and experimental therapeutics 326, 423-431

19. Lu, S., Chen, Z., Yang, J., Chen, L., Zhou, H., Xu, X., Li, J., Han, F., and Wang, J. (2009) The effects of proteasome inhibitor bortezomib on a P-gp positive leukemia cell line K562/A02. International journal of laboratory hematology

20. Oerlemans, R., Franke, N. E., Assaraf, Y. G., Cloos, J., van Zantwijk, I., Berkers, C. R., Scheffer, G. L., Debipersad, K., Vojtekova, K., Lemos, C., van der Heijden, J. W., Ylstra, B., Peters, G. J., Kaspers, G. L., Dijkmans, B. A., Scheper, R. J., and Jansen, G. (2008) Molecular basis of bortezomib resistance: proteasome subunit beta5 (PSMB5) gene mutation and overexpression of PSMB5 protein. Blood 112, 2489-2499

21. Marques, A. J., Palanimurugan, R., Matias, A. C., Ramos, P. C., and Dohmen, R. J. (2009) Catalytic mechanism and assembly of the proteasome. Chem Rev 109, 1509-1536

22. Murata, S., Yashiroda, H., and Tanaka, K. (2009) Molecular mechanisms of proteasome assembly. Nat Rev Mol Cell Biol 10, 104-115

23. Politou, M., Karadimitris, A., Terpos, E., Kotsianidis, I., Apperley, J. F., and Rahemtulla, A. (2006) No evidence of mutations of the PSMB5 (beta-5 subunit of proteasome) in a case of myeloma with clinical resistance to Bortezomib. Leukemia research 30, 240-241

24. Lichter, D. I., Danaee, H., Pickard, M. D., Tayber, O., Sintchak, M., Shi, H., Richardson, P. G., Cavenagh, J., Blade, J., Facon, T., Niesvizky, R., Alsina, M., Dalton, W., Sonneveld, P., Lonial, S., van de Velde, H., Ricci, D., Esseltine, D. L., Trepicchio, W. L., Mulligan, G., and Anderson, K. C. (2012) Sequence analysis of beta-subunit genes of the 20S proteasome in patients with relapsed multiple myeloma treated with bortezomib or dexamethasone. Blood 120, 4513-4516

25. Leung-Hagesteijn, C., Erdmann, N., Cheung, G., Keats, J. J., Stewart, A. K., Reece, D. E., Chung, K. C., and Tiedemann, R. E. (2013) Xbp1s-negative tumor B cells and pre-plasmablasts mediate therapeutic proteasome inhibitor resistance in multiple myeloma. Cancer Cell 24, 289-304

26. Orlowski, R. Z. (2013) Why proteasome inhibitors cannot ERADicate multiple myeloma. Cancer Cell 24, 275-277

27. Kuhn, D. J., Berkova, Z., Jones, R. J., Woessner, R., Bjorklund, C. C., Ma, W., Davis, R. E., Lin, P., Wang, H., Madden, T. L., Wei, C., Baladandayuthapani, V., Wang, M., Thomas, S. K., Shah, J. J., Weber, D. M., and Orlowski, R. Z. (2012) Targeting the insulin-like growth factor-1 receptor to overcome bortezomib resistance in preclinical models of multiple myeloma. Blood 120, 3260-3270

28. Bjorklund, C. C., Baladandayuthapani, V., Lin, H. Y., Jones, R. J., Kuiatse, I., Wang, H., Yang, J., Shah, J. J., Thomas, S. K., Wang, M., Weber, D. M., and Orlowski, R. Z. (2014) Evidence of a role for CD44 and cell adhesion in

14

mediating resistance to lenalidomide in multiple myeloma: therapeutic implications. Leukemia 28, 373-383

29. Chorley, B. N., Campbell, M. R., Wang, X., Karaca, M., Sambandan, D., Bangura, F., Xue, P., Pi, J., Kleeberger, S. R., and Bell, D. A. (2012) Identification of novel NRF2-regulated genes by ChIP-Seq: influence on retinoid X receptor alpha. Nucleic Acids Res 40, 7416-7429

30. Jaramillo, M. C., and Zhang, D. D. (2013) The emerging role of the Nrf2-Keap1 signaling pathway in cancer. Genes Dev 27, 2179-2191

31. Chondrogianni, N., and Gonos, E. S. (2007) Overexpression of hUMP1/POMP proteasome accessory protein enhances proteasome-mediated antioxidant defence. Exp Gerontol 42, 899-903

32. Wang, X. J., Hayes, J. D., Henderson, C. J., and Wolf, C. R. (2007) Identification of retinoic acid as an inhibitor of transcription factor Nrf2 through activation of retinoic acid receptor alpha. Proc Natl Acad Sci U S A 104, 19589-19594

33. De Braekeleer, E., Douet-Guilbert, N., and De Braekeleer, M. (2014) RARA fusion genes in acute promyelocytic leukemia: a review. Expert Rev Hematol 7, 347-357

34. Kobayashi, A., Kang, M. I., Okawa, H., Ohtsuji, M., Zenke, Y., Chiba, T., Igarashi, K., and Yamamoto, M. (2004) Oxidative stress sensor Keap1 functions as an adaptor for Cul3-based E3 ligase to regulate proteasomal degradation of Nrf2. Mol Cell Biol 24, 7130-7139

35. Siegel, D. S., Martin, T., Wang, M., Vij, R., Jakubowiak, A. J., Lonial, S., Trudel, S., Kukreti, V., Bahlis, N., Alsina, M., Chanan-Khan, A., Buadi, F., Reu, F. J., Somlo, G., Zonder, J., Song, K., Stewart, A. K., Stadtmauer, E., Kunkel, L., Wear, S., Wong, A. F., Orlowski, R. Z., and Jagannath, S. (2012) A phase 2 study of single-agent carfilzomib (PX-171-003-A1) in patients with relapsed and refractory multiple myeloma. Blood 120, 2817-2825

36. Niesvizky, R., Martin, T. G., 3rd, Bensinger, W. I., Alsina, M., Siegel, D. S., Kunkel, L. A., Wong, A. F., Lee, S., Orlowski, R. Z., and Wang, M. (2013) Phase Ib dose-escalation study (PX-171-006) of carfilzomib, lenalidomide, and low-dose dexamethasone in relapsed or progressive multiple myeloma. Clin Cancer Res 19, 2248-2256

37. Wang, M., Martin, T., Bensinger, W., Alsina, M., Siegel, D. S., Kavalerchik, E., Huang, M., Orlowski, R. Z., and Niesvizky, R. (2013) Phase 2 dose-expansion study (PX-171-006) of carfilzomib, lenalidomide, and low-dose dexamethasone in relapsed or progressive multiple myeloma. Blood 122, 3122-3128

38. Jakubowiak, A. J., Dytfeld, D., Griffith, K. A., Lebovic, D., Vesole, D. H., Jagannath, S., Al-Zoubi, A., Anderson, T., Nordgren, B., Detweiler-Short, K., Stockerl-Goldstein, K., Ahmed, A., Jobkar, T., Durecki, D. E., McDonnell, K., Mietzel, M., Couriel, D., Kaminski, M., and Vij, R. (2012) A phase 1/2 study of carfilzomib in combination with lenalidomide and low-dose dexamethasone as a frontline treatment for multiple myeloma. Blood 120, 1801-1809

39. Lawasut, P., Chauhan, D., Laubach, J., Hayes, C., Fabre, C., Maglio, M., Mitsiades, C., Hideshima, T., Anderson, K. C., and Richardson, P. G. (2012) New proteasome inhibitors in myeloma. Curr Hematol Malig Rep 7, 258-266

15

40. Kumar, S. K., Lee, J. H., Lahuerta, J. J., Morgan, G., Richardson, P. G., Crowley, J., Haessler, J., Feather, J., Hoering, A., Moreau, P., LeLeu, X., Hulin, C., Klein, S. K., Sonneveld, P., Siegel, D., Blade, J., Goldschmidt, H., Jagannath, S., Miguel, J. S., Orlowski, R., Palumbo, A., Sezer, O., Rajkumar, S. V., and Durie, B. G. (2012) Risk of progression and survival in multiple myeloma relapsing after therapy with IMiDs and bortezomib: a multicenter international myeloma working group study. Leukemia 26, 149-157

41. Jang, J., Wang, Y., Kim, H. S., Lalli, M. A., and Kosik, K. S. (2014) Nrf2, a regulator of the proteasome, controls self-renewal and pluripotency in human embryonic stem cells. Stem Cells

42. Kwak, M. K., Wakabayashi, N., Greenlaw, J. L., Yamamoto, M., and Kensler, T. W. (2003) Antioxidants enhance mammalian proteasome expression through the Keap1-Nrf2 signaling pathway. Mol Cell Biol 23, 8786-8794

43. Pickering, A. M., Linder, R. A., Zhang, H., Forman, H. J., and Davies, K. J. (2012) Nrf2-dependent induction of proteasome and Pa28alphabeta regulator are required for adaptation to oxidative stress. The Journal of biological chemistry 287, 10021-10031

44. Radhakrishnan, S. K., Lee, C. S., Young, P., Beskow, A., Chan, J. Y., and Deshaies, R. J. (2010) Transcription factor Nrf1 mediates the proteasome recovery pathway after proteasome inhibition in mammalian cells. Mol Cell 38, 17-28

45. Stessman, H. A., Baughn, L. B., Sarver, A., Xia, T., Deshpande, R., Mansoor, A., Walsh, S. A., Sunderland, J. J., Dolloff, N. G., Linden, M. A., Zhan, F., Janz, S., Myers, C. L., and Van Ness, B. G. (2013) Profiling bortezomib resistance identifies secondary therapies in a mouse myeloma model. Molecular cancer therapeutics 12, 1140-1150

46. Biran, N., Jagannath, S., and Chari, A. (2013) Risk stratification in multiple myeloma, part 1: characterization of high-risk disease. Clinical advances in hematology & oncology : H&O 11, 489-503

47. Moriuchi, M., Ohmachi, K., Kojima, M., Tsuboi, K., Ogawa, Y., Nakamura, N., and Ando, K. (2010) Three cases of bortezomib-resistant multiple myeloma with extramedullary masses. The Tokai journal of experimental and clinical medicine 35, 17-20

48. Paton-Hough, J., Chantry, A. D., and Lawson, M. A. (2015) A review of current murine models of multiple myeloma used to assess the efficacy of therapeutic agents on tumour growth and bone disease. Bone 77, 57-68

49. Zhang, N., Liang, J., Tian, Y., Yuan, L., Wu, L., Miao, S., Zong, S., and Wang, L. (2010) A novel testis-specific GTPase serves as a link to proteasome biogenesis: functional characterization of RhoS/RSA-14-44 in spermatogenesis. Molecular biology of the cell 21, 4312-4324

50. Witt, E., Zantopf, D., Schmidt, M., Kraft, R., Kloetzel, P. M., and Kruger, E. (2000) Characterisation of the newly identified human Ump1 homologue POMP and analysis of LMP7(beta 5i) incorporation into 20 S proteasomes. J Mol Biol 301, 1-9

16

51. Fricke, B., Heink, S., Steffen, J., Kloetzel, P. M., and Kruger, E. (2007) The proteasome maturation protein POMP facilitates major steps of 20S proteasome formation at the endoplasmic reticulum. EMBO Rep 8, 1170-1175

52. Meiners, S., Heyken, D., Weller, A., Ludwig, A., Stangl, K., Kloetzel, P. M., and Kruger, E. (2003) Inhibition of proteasome activity induces concerted expression of proteasome genes and de novo formation of Mammalian proteasomes. The Journal of biological chemistry 278, 21517-21525

53. Fuchs, D., Berges, C., Opelz, G., Daniel, V., and Naujokat, C. (2008) Increased expression and altered subunit composition of proteasomes induced by continuous proteasome inhibition establish apoptosis resistance and hyperproliferation of Burkitt lymphoma cells. J Cell Biochem 103, 270-283

54. Wolf, J., Richardson, P. G., Schuster, M., LeBlanc, A., Walters, I. B., and Battleman, D. S. (2008) Utility of bortezomib retreatment in relapsed or refractory multiple myeloma patients: a multicenter case series. Clinical advances in hematology & oncology : H&O 6, 755-760

55. Hrusovsky, I., Emmerich, B., von Rohr, A., Voegeli, J., Taverna, C., Olie, R. A., Pliskat, H., Frohn, C., and Hess, G. (2010) Bortezomib retreatment in relapsed multiple myeloma - results from a retrospective multicentre survey in Germany and Switzerland. Oncology 79, 247-254

56. Namani, A., Li, Y., Wang, X. J., and Tang, X. (2014) Modulation of NRF2 signaling pathway by nuclear receptors: Implications for cancer. Biochim Biophys Acta

57. Magesh, S., Chen, Y., and Hu, L. (2012) Small molecule modulators of Keap1-Nrf2-ARE pathway as potential preventive and therapeutic agents. Med Res Rev 32, 687-726

17

Figure Legends

Figure 1. Bortezomib-resistance and POMP levels in myeloma cell lines. (A)Bortezomib-sensitive (WT)

and bortezomib-resistant (V10R) myeloma cell lines, including RPMI 8226 (8226), OPM-2, ANBL-6,

and KAS-6/1 cells, were subjected to qPCR to detect POMP mRNA content, which was analyzed using

the comparative CT method and normalized to GAPDH as an internal control. POMP expression in drug-

naïve 8226 cells was arbitrarily set at 1.0, and data are provided from three independently performed

experiments ± standard deviation. The student’s paired t-test was used to determine statistical

significance (*p<0.05vs. WT). (B)POMP protein levels were evaluated in these same cell lines by

immunoblotting, and compared to β-Actin as a loading control. Densitometry was performed to quantify

POMP levels, which were normalized to RPMI 8226 WT cells arbitrarily set to 1.0. A representative

autoradiograph is shown from one of two independently performed experiments. (C) POMP and β-Actin

levels are shown by Western blotting in primary plasma cells from four patients who were bortezomib-

naïve, and three patients who were previously bortezomib-exposed and clinically bortezomib refractory.

Densitometry was performed to quantify POMP levels, which were normalized to MM1 cells arbitrarily

set to 1.0.

Figure 2. Influence of POMP on bortezomib sensitivity. (A)KAS-6/1 bortezomib resistant cells (KAS-

6/1 V10R) were infected with Lentiviral vectors expressing a scrambled sequence, non-targeting shRNA

(KO-NT), or one of two different shRNAs targeting POMP (KO-3 and KO-5). The success of POMP

knockdown was verified with Western blotting, and compared to β-Actin as a loading control.

Densitometry was performed to quantify POMP levels, which were normalized to KAS-6/1 V10R cells

arbitrarily set to 1.0. A representative autoradiograph from one of two independent experiments is shown.

(B) The cells described in panel A and KAS-6/1 drug-naive cells (KAS-6/1 WT) were then exposed to

bortezomib for 24 hours at the indicated concentrations, and viability was determined with the tetrazolium

reagent WST-1. Data presented are from three independently performed experiments, and are presented

as the mean ± standard deviation(* p < 0.05 vs. KAS-6/1 V10R or KO-NT). (C) The proteasome activity

of the cells described in panel A was examined as described in the Materials and Methods. Data are from

three independent experiments, and are presented as the mean ± standard deviation (*p < 0.05 vs. KAS-

6/1 V10R or KAS-6/1 V10R KO-NT).(D) KAS-6/1 drug-naive cells (KAS-6/1 WT) were infected with

Lentiviral vectors without a cDNA insert (OE-control), or the cDNA for POMP (OE-POMP). The

success of POMP overexpression was verified with Western blotting, and compared to β-Actin as a

loading control. Densitometry was performed to quantify POMP levels, which were normalized to KAS-

6/1 WT cells arbitrarily set to 1.0. A representative autoradiograph from one of two independent

experiments is shown. (E)The cells described in panel D were then exposed to bortezomib for 24 hours at

the indicated concentrations, and viability was determined with the tetrazolium reagent WST-1. Data

presented are from three independently performed experiments, and are presented as the mean ± standard

deviation (* p < 0.05 vs. KAS-6/1 WT or OE-control).(F) Proteasome activity in the cells described in

panel D was examined as described in the Materials and Methods. Data are from three independent

experiments, and are presented as the mean ± standard deviation (*p < 0.05 vs. KAS-6/1 WT or KAS-6/1

OE-control). (G) OPM-2 bortezomib resistant cells (OMP-2 V10R) were infected with Lentiviral vectors

expressing a scrambled sequence, non-targeting shRNA (KO-NT), or one of two different shRNAs

targeting POMP (KO-3 and KO-5). The success of POMP knockdown was verified with Western blotting,

and compared to β-Actin as a loading control. Densitometry was performed to quantify POMP levels,

which were normalized to OMP-2 V10R cells arbitrarily set to 1.0. A representative autoradiograph from

one of two independent experiments is shown. (H) The cells described in panel G and OPM-2 drug-

naive cells (OPM-2 WT)were then exposed to bortezomib for 24 hours at the indicated concentrations,

and viability was determined with the tetrazolium reagent WST-1. Data presented are from three

independently performed experiments, and are presented as the mean ± standard deviation (* p < 0.05 vs.

OPM-2 V10R or KO-NT). (I) The proteasome activity of the cells described in panel G was examined as

18

described in the Materials and Methods. Data are from three independent experiments, and are presented

as the mean ± standard deviation (*p < 0.05 vs. OPM-2 V10R or OPM-2 V10R KO-NT). (J) OPM-2

drug-naive cells (OPM-2 WT) were infected with Lentiviral vectors without a cDNA insert (OE-control),

or the cDNA for POMP (OE-POMP). The success of POMP overexpression was verified with Western

blotting, and compared to β-Actin as a loading control. Densitometry was performed to quantify POMP

levels, which were normalized to OPM-2 WT cells arbitrarily set to 1.0. A representative autoradiograph

from one of two independent experiments is shown. (K) The cells described in panel J were then

exposed to bortezomib for 24 hours at the indicated concentrations, and viability was determined with the

tetrazolium reagent WST-1. Data presented are from three independently performed experiments, and are

presented as the mean ± standard deviation (* p < 0.05 vs. OPM-2 WT or OE-control). (L) Proteasome

activity in the cells described in panel J was examined as in the Materials and Methods. Data are from

three independent experiments, and are presented as the mean ± standard deviation (*p < 0.05 vs. OPM-2

WT or OPM-2 OE-control). (M) KAS-6/1 cells with POMP overexpressed (OE-POMP cells) were

transiently transfected with non-targeting shRNAs (OE-shRNA-control) or shRNAs targeting POMP

(OE-shRNA-POMP).The cells and KAS-6/1 wild-type cells (KAS-6/1 WT) were then exposed to

bortezomib for 24 hours at the indicated concentrations, and viability was determined with the tetrazolium

reagent WST-1. Data presented are from three independently performed experiments, and are presented

as the mean ± standard deviation (* p < 0.05 vs. OE-POMP and OE-shRNA-control). (N)OPM-2 cells

with POMP overexpressed (OE-POMP cells) were transiently transfected with non-targeting shRNAs

(OE-shRNA-control) or shRNAs targeting POMP (OE-shRNA-POMP).The cells and OPM-2 wild-type

cells (OPM-2 WT) were then exposed to bortezomib for 24 hours at the indicated concentrations, and

viability was determined with the tetrazolium reagent WST-1. Data presented are from three

independently performed experiments, and are presented as the mean ± standard deviation(* p < 0.05 vs.

OE-POMP and OE-shRNA-control).

Figure 3. Bortezomib resistance and NRF2 levels in myeloma cell lines. (A) Bortezomib-sensitive (WT)

and bortezomib-resistant (V10R) myeloma cell lines, including RPMI 8226 (8226), OPM-2, ANBL-6,

and KAS-6/1 cells, were subjected to qPCR to detect NRF2 mRNA content, which was analyzed using

the comparative CT method and normalized to GAPDH as an internal control. NRF2 expression in drug-

naïve 8226 cells was arbitrarily set at 1.0, and representative data are shown from one of three

independent experiments along with the standard deviation (* p < 0.05 vs. WT). (B) NRF2 protein levels

were evaluated in these same cell lines by immunoblotting, and compared to β-Actin as a loading control.

Densitometry was performed to quantify NRF2 levels, which were normalized to 8226 WT cells

arbitrarily set to 1.0. A representative autoradiograph is shown from one of two independently performed

experiments. (C) NRF2 protein levels were evaluated in the primary myeloma cells by immunoblotting,

and compared to β-Actin as a loading control. Densitometry was performed to quantify NRF2 levels,

which were normalized to the MM1 sample arbitrarily set to 1.0. A representative autoradiograph is

shown from one of two independently performed experiments.

Figure 4. NRF2 and the POMP promoter. (A) Chromatin immunoprecipitation assays were performed

using either non-specific immunoglobulins (IgG) or antibodies specific for NRF2. Primers described in

the Materials and Methods were then used in quantitative real-time PCR assays to detect the pull-down of

sequences near the putative NRF2 binding site identified near the POMP promoter. The results were

normalized to the input control, and all data are shown as the mean ± standard deviation (*p < 0.01) from

three independently performed experiments. (B) Electrophoretic mobility shift assays were performed

using an oligonucleotide representing one of the putative NRF2 binding sites from the POMP promoter.

Binding reactions were prepared by incubating nuclear extracts with a biotin-labeled probe in the

presence (+) or absence (-) of a 200-fold molar excess of specific DNA (unlabeled probe). Complexes

were separated on 4% native polyacrylamide gels by electrophoresis, transferred to positively charged

nylon membrane, and visualized using a streptavidin-horse radish peroxidase conjugate. (C) Luciferase

19

reporter assays were used to examine the ability of NRF2 to activate the POMP promoter in KAS-6/1

cells. These were co-transfected in triplicate with constructs containing either no promoter with a Renilla

luciferase promoter (Empty-RenSP), or a POMP-Renilla luciferase reporter (pPOMP-RenSP), along with

a thymidine kinase promoter-Cypridina luciferase reporter (pTK-Cluc) as a transfection control. In

addition, either an empty expression vector (pCMV6-XL5) or the same vector with the NRF2 cDNA

(pCMV6-XL5-NRF2) were transfected. Luciferase activities were then measured, and Renilla luciferase

activity was first normalized to the Cypridina luciferase activity. Then, the activity of the Empty-RenSP

vector in cells transfected with pTK-Cluc and pCMV6-XL5-NRF2 was arbitrarily set at 1.0, and the

activity elsewhere was normalized to this value (*p < 0.05).

Figure 5. NRF2, POMP, and proteasome activity. (A) KAS-6/1 bortezomib resistant cells were

transfected with Lentiviral vectors expressing a scrambled sequence, non-targeting shRNA (KO-NT), or

one of two different shRNAs targeting and suppressing NRF2 (KO-6 and KO-8). Knockdown of NRF2,

and its impact on downstream POMP, was examined by Western blotting, and compared to β-Actin as a

loading control. Densitometry was performed to quantify NRF2 and POMP levels, which were

normalized to KAS-6/1 V10R cells arbitrarily set to 1.0. A representative autoradiograph from one of two

independent experiments is shown. (B) The proteasome activity of the cells described in panel A was

examined as described in the Materials and Methods. Data are from three independent experiments, and

are presented as the mean ± standard deviation (*p < 0.05 vs. KAS-6/1 V10R or KAS-6/1 V10R KO-NT).

(C) The cells described in panel A and KAS-6/1 bortezomib sensitive (KAS-6/1 WT) cells were then

exposed to bortezomib for 24 hours at the indicated concentrations, and viability was determined with the

tetrazolium reagent WST-1. Data presented are from three independently performed experiments, and are

presented as the mean ± standard deviation (* p < 0.05 vs. KAS-6/1 V10R or KO-NT). (D) KAS-6/1

bortezomib sensitive (KAS-6/1 WT) cells were transfected with control Lentiviral vectors (KAS-6/1 OE-

control) or Lentiviral vectors containing the NRF2 cDNA (KAS-6/1 OE-NRF2). Expression of NRF2

and POMP was examined with Western blotting and compared to β-Actin as a loading control.

Densitometry was performed to quantify NRF2 and POMP levels, which were normalized to KAS-6/1

WT cells arbitrarily set to 1.0. A representative autoradiograph from one of two independent experiments

is shown. (E) Proteasome activity in the cells described in panel D was examined as in the Materials and

Methods. Data are from three independent experiments, and are presented as the mean ± standard

deviation (*p < 0.05 vs. KAS-6/1 WT or KAS-6/1 OE-control). (F) The cells described in panel D were

then exposed to bortezomib for 24 hours at the indicated concentrations, and viability was determined

with the tetrazolium reagent WST-1. Data presented are from three independently performed experiments,

and are presented as the mean ± standard deviation (* p < 0.05 vs. KAS-6/1 OE-NRF2). (G) OPM-2

bortezomib resistant cells were transfected with Lentiviral vectors expressing a scrambled sequence, non-

targeting shRNA (KO-NT), or one of two different shRNAs targeting and suppressing NRF2 (KO-6 and

KO-8). Knockdown of NRF2, and its impact on downstream POMP, was examined by Western blotting,

and compared to β-Actin as a loading control. Densitometry was performed to quantify NRF2 and POMP

levels, which were normalized to OPM-2 V10R cells arbitrarily set to 1.0. A representative

autoradiograph from one of two independent experiments is shown. (H) The proteasome activity of the

cells described in panel G was examined as described in the Materials and Methods. Data are from three

independent experiments, and are presented as the mean ± standard deviation (*p < 0.05 vs. OPM-2

V10R or OPM-2 V10R KO-NT). (I) The cells described in panel G and OPM-2 bortezomib sensitive

(OPM-2 WT) cells were then exposed to bortezomib for 24 hours at the indicated concentrations, and

viability was determined with the tetrazolium reagent WST-1. Data presented are from three

independently performed experiments, and are presented as the mean ± standard deviation (* p< 0.05 vs.

OPM-2 V10R or KO-NT). (J) OPM-2 bortezomib sensitive (OPM-2 WT) cells were transfected with

control Lentiviral vectors (OPM-2 OE-control) or Lentiviral vectors containing the NRF2 cDNA (OPM-2

OE-NRF2). Expression of NRF2 and POMP were examined with Western blotting and compared to β-

Actin as a loading control. Densitometry was performed to quantify NRF2 and POMP levels, which were

normalized to OPM-2 WT cells arbitrarily set to 1.0. A representative autoradiograph from one of two

20

independent experiments is shown. (K)Proteasome activity in the cells described in panel J was examined

as in the Materials and Methods. Data are from three independent experiments, and are presented as the

mean ± standard deviation (*p < 0.05 vs. OPM-2 WT or OPM-2 OE-control). (L) The cells described in

panel J were then exposed to bortezomib for 24 hours at the indicated concentrations, and viability was

determined with the tetrazolium reagent WST-1. Data presented are from three independently performed

experiments, and are presented as the mean ± standard deviation (* p < 0.05 vs. OPM-2 OE-NRF2).

Figure 6. ATRA and bortezomib sensitivity. (A) KAS-6/1 bortezomib resistant cells (KAS-6/1 V10R)

were exposed to the indicated concentrations of ATRA,bortezomib, or both for 24 hours, and expression

of NRF2, KEAP1 and POMP was examined by Western blotting, all relative to β-Actin as a loading

control. A representative autoradiograph from one of two independent experiments is shown.

Densitometry was performed to quantify NRF2, KEAP1 and POMP levels, which were normalized to the

vehicle control arbitrarily set to 1.0. (B) KAS-6/1 bortezomib resistant cells were treated with the

indicated concentrations of ATRA, bortezomib, or both for 24 hours. Cellular viability measurements

were then performed using the WST-1 assay as described in the Materials and Methods. All data points

were normalized to the vehicle control, which was arbitrarily set at 100% viability. Mean viability values

are provided from three independently performed experiments ± standard deviation, and the student’s

paired t-test was used to determine statistical significance (*p<0.05). (C) Levels of apoptosis were

determined in cells treated as described in panel B by Western blotting to detect the cleaved fragment of

caspase 3, with β-Actin as a loading control. A representative autoradiograph from one of two

independent experiments is shown. Densitometry was performed to quantify cleaved caspase 3 level,

which was normalized to the vehicle control arbitrarily set to 1.0. (D) Proteasome chymotrypsin-like

activity was measured as described in the Materials and Methods in cells treated as above. All data points

were normalized to the vehicle control, which was arbitrarily set at 100% activity. Mean proteasome

activity values are provided from three independent experiments ± standard deviation, and the student’s

paired t-test was used to determine statistical significance (*p<0.05). KAS-6/1 bortezomib sensitive cells

(KAS-6/1 WT) were exposed to the indicated concentrations of ATRA, bortezomib or both for 24 hours.

Abundance of NRF2, KEAP1 and POMP, cellular viability, and abundance of cleaved caspase3 and

proteasome chymotrypsin-like activity are shown in I, J, K, and L, respectively. (E) OPM-2 bortezomib

resistant cells (OPM-2 V10R) were exposed to the indicated concentrations of ATRA, bortezomib or both

for 24 hours, and expression of NRF2, KEAP1, and POMP were tested by Western blotting, all relative to

β-Actin as a loading control. A representative autoradiograph from one of two independent experiments

is shown. Densitometry was performed to quantify NRF2, KEAP1 and POMP levels, which were

normalized tothe vehicle controlarbitrarily set to 1.0. (F) OPM-2 bortezomib resistant cells were treated

with the indicated concentrations of ATRA, bortezomib, or both for 24 hours. Cellular viability

measurements were then performed using the WST-1 assay as described in the Materials and Methods.

All data points were normalized to the vehicle control, which was arbitrarily set at 100% viability. Mean

viability values are provided from three independently performed experiments ± standard deviation, and

the student’s paired t-test was used to determine statistical significance (*p<0.05). (G) Levels of

apoptosis were determined in cells treated as described in panel F by Western blotting to detect the

cleaved fragment of caspase 3, with β-Actin as a loading control. A representative autoradiograph from

one of two independent experiments is shown. Densitometry was performed to quantifythe cleaved

caspase 3 levels, which were normalized to the vehicle controlarbitrarily set to 1.0. (H) Proteasome

chymotrypsin-like activity was measured as described in the Materials and Methods in cells treated as

above. All data points were normalized to the vehicle control, which was arbitrarily set at 100% activity.

Mean proteasome activity values are provided from three independent experiments ± standard deviation,

and the student’s paired t-test was used to determine statistical significance (*p<0.05). OPM-2

bortezomib sensitive cells (OPM-2 WT) were exposed to the indicated concentrations of ATRA,

bortezomib or both for 24 hours. Expression of NRF2, KEAP1 and POMP, cellular viability, expression

of cleaved caspase3, and proteasome chymotrypsin-like activity are shown in panels M, N, O and P,

respectively.

21

Figure 7. Efficacy of ATRA and bortezomib against primary cells and in vivo. (A) Purified CD138+

plasma cells obtained from patients with myeloma were treated for 48 hours with vehicle, bortezomib,

ATRA, or the combination at the indicated concentrations, and viability was then analyzed using the

WST-1 assay. All values were normalized to the vehicle control, which was set arbitrarily at 100%, and

presented as the average of triplicate measurements on the same day ± standard deviation (*p < 0.05). (B)

Immunodeficient mice were subcutaneously implanted with bortezomib-resistant KAS-6/1 cells, and after

seven days were randomized to treatment with either vehicle, bortezomib (0.5 mg/kg), ATRA (40 mg/kg),

or the combination, with treatment given thrice weekly via intraperitoneal injections. Tumor growth was

monitored by caliper measurement, and calculated as the tumor volume using the equation (0.4 x L x

W^2). Standard deviation is shown for each timepoint from a cohort of five mice in each treatment group.

(C) Measured tumor volumes from mouse xenografts from day 21 through day 32 of the experiment

described in panel B are shown in greater detail. Statistically significant values are determined by the

conditional χ2-test and indicated by * which denotes p<0.05 vs. vehicle, bortezomib, or ATRA. (D)

Quantitative PCR analysis was performed to determine POMP and β5 levels in xenograft tumors treated

with vehicle, bortezomib, ATRA, or the combination. (E) POMP and β5 levels in xenograft tumors were

determined by immunoblotting. Densitometry was performed to quantify POMP and β5 levels, which

were normalized to the control arbitrarily set to 1.0(*p<0.05).

22

Table 1. Characteristics of myeloma patients whose primary plasma cells were studied.

Abbreviations: M, male; F, female; ISS, International Staging System; DS, Durie-Salmon Staging

System; VAD, vincristine, doxorubicin,and dexamethasone; MP, melphalan plus prednisone; PAD,

bortezomib, doxorubicin, plus dexamethasone; VMP, bortezomib, melphalan, and prednisone; VDT,

bortezomib, dexamethasone, and thalidomide; DVD, pegylated liposomaldoxorubicin, vincristine,

and dexamethasone; MPR, melphalan, prednisone, and lenalidomide; M2, carmustine, vincristine,

cyclophosphamide, melphalan, and prednisone.

* Two months before sample collection; ** Four months before sample collection; *** Six months

before sample collection; **** Six months before sample collection; ***** One year before sample

collection. ****** Four years before sample collection.

Patient

No.

Sex Age

(yr)

Clinical

Stage (ISS)

Clinical

Stage (DS)

Previous

Treatment

Para protein Percentage of

plasma cells

(%)

Bone

lesions

MM1 F 59 Ⅰ ⅢA No IgG-κ 19.0 Yes.

MM2 M 74 Ⅱ ⅢA No IgG-κ 58.0 Yes

MM3 F 58 Ⅱ ⅢA No IgG-κ 16.0 Yes

MM4 F 66 Ⅱ ⅢA VAD×6;

MP×2*

Non-secretary 90.0 Yes

MM5 M 69 Ⅲ ⅢB PAD×1;

VMP×3;

VDT×3**

λ-Light Chain 80.0 Yes

MM6 M 81 Ⅲ ⅢB PAD×1*** IgG-λ 5.0 No.

MM7 M 67 Ⅲ ⅢA DVD×5;

MPR×1; VDT×2;

M2×1****

IgG-λ 37.0 Yes

MM8 M 65 Ⅲ ⅢA VAD×6***** λ-Light Chain 60.0 Yes

MM9 M 84 Ⅲ ⅢB VDT×2****** IgG-λ 55.0 Yes

MM10 M 73 Ⅲ ⅢA No IgG-κ 93.0 Yes

MM11 F 64 Ⅱ ⅡA No IgG-λ 19.0 No

MM12 M 64 Ⅰ ⅢA No IgG-κ 16.0 Yes

23

Figures

Figure 1

24

Figure 2

25

Figure 3

26

Figure 4

27

Figure 5

28

Figure6

29

Figure 7