THE JO~AL OF BIOLOGICAL CHEMISTRY No. 23, Issue of June … · 2001-06-27 · THE JO~AL OF BIOLOGICAL CHEMISTRY 0 1994 by The American Society for Biochemistry and Molecular Biology,

THE J O ~ A L OF BIOLOGICAL CHEMISTRY 0 1994 by T h e American Society for Biochemistry and Molecular Biology, Inc.

Vol. 269, No. 23, Issue of June 10, pp. 16223-16228, 1994 Printed in U.S.A.

Effect of Selenium Deficiency on wpe I 5’IDeiodinase” (Received for publication, March 2, 1994)

Diane DePalo, William B. Kinlaw, Chengquan ZhaoS, Hanna Engelberg-KukaS, and Donald L. St. GermainO From the Departments of Medicine and Physiology, Dartmouth Medical School, Lebanon, New Hampshire 03756 and the Department of Molecular Biology, The Hebrew University, Hadussah Medical School, Jerusalem, 91010 Israel

The type I iodothyronine 5”deiodinase (5’-DI) present in rat liver and kidney has recently been demonstrated to be a selenoprotein. The goal of the present study was to examine in detail the effect of selenium (Se) defi- ciency on 5”DI at the protein and mRNA levels. In wean- ling rats fed a selenium-deficient @e(-)) diet for 6 weeks, 5”DI activity was decreased 91 and 69% relative to con- trol activities in liver and kidney, respectively. Adminis- tration of 3,5,3‘-triiodothyronine resulted in a 2-fold in- crease in 5“DI activity in control animals, but had little or no effect on 5”DI activity in Se(-) animals. Western analysis using a specific antiserum directed against a bacterial fusion protein containing the carboxyl-termi- nal half of the 5”DI protein demonstrated that this de- crease in 5”DI activity in Se(-) animals was explained by a marked decrease in 5”DI protein. Administration of Se to Se(-) animals resulted in parallel increases in 5”DI protein and activity over a 72-h time period. It was also shown that selenium deficiency was accompanied by a 409’0 decrease in 5”DI mRNA levels in the kidney, but not in the liver. In both tissues, the administration of 3,5,3’- triiodothyronine resulted in increased 5“DI mRNA lev- els which were not altered by selenium status. These studies indicate that selenium deficiency decreases 5”DI activity by decreasing the amount of 5’-D1 protein. The mechanism of this impairment in enzyme synthesis appears to be a defect in translation, presumably due to a block in the UGA-directed selenocysteine incorpora- tion in selenium deficiency.

Type I iodothyronine 5“deiodinase (5’-DIl1 is one of the prin- ciple enzymes involved in the intrathyroidal and peripheral metabolism of thyroid hormones and has recently been demon- strated to contain a selenocysteine residue at the catalytic site (1). In eukaryotic organisms a specific stem-loop structure in the 3“untranslated region of the mRNA encoding selenocys- teine-containing proteins is required for recognition of the codon UGA as a site for incorporation of selenocysteine rather than as a termination signal (2). Such stem-loops have been

* This study was supported by National Institutes of Health Grants DK-42271 (to D. L. S.) and DK-43142 (to W. B. K.), the Norris Cotton Cancer Center Core Grant CA.23108, and by the Harry Kay Founda- tion. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

cal School, Dept. of Medicine and Physiology, 1 Medical Center Dr., 8 To whom all correspondence should be addressed: Dartmouth Medi-

Lebanon, NH 03756. Tel.: 603-650-7910; Fax: 603-650-6130. The abbreviations used are: 5’-DI, type I iodothyronine 5”deiodi-

nase; GPX, glutathione peroxidase; GST, glutathione S-transferase; IPTG, isopropyl-1-thio-P-D-galactopyranoside; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; Se(-), selenium deficient; Se(+), selenium sufficient; T,, 3,5,3’-triiodothyronine; rT,, 3,3’,5’-triiodothyronine.

identified in the mFtNAs for three mammalian selenoproteins: 5’-DI, glutathione peroxidase (GPX), and selenoprotein P (2-5).

Previous studies have demonstrated that the alterations in GPX and selenoprotein P levels that occur in selenium defi- ciency are a result of complex processes involving both trans- lational and pretranslational mechanisms (6). In the case of the 5‘-DI, selenium deficiency in the rat results in a marked de- crease in enzyme activity in the liver (7). This is accompanied by a decrease in the labeling of this protein with the affinity reagent N-bromoacetyl-[12511~-thyroxine, suggesting a decrease in cellular enzyme content (8). However, the effects of selenium deficiency on pretranslational processes influencing 5’-DI ac- tivity have not been well defined, nor has the level of protein expression been determined directly by immunoblotting meth- ods using specific antiserum.

In the present study, we examined the effects of selenium deficiency on both 5’-DI mRNA and protein levels in euthyroid and hyperthyroid rats. Protein levels were determined by uti- lizing antiserum directed against the carboxyl-terminal portion of the 5‘-DI protein which had been produced in a recombinant bacterial expression system. These studies show that the sele- nium status exerts its major effect on 5“DI activity at the translational level.

MATERIALS AND METHODS Animals and Protocols-Weanling Sprague-Dawley rats (40-50 g)

were obtained from Charles River Laboratories (Wilmington, MA) and fed a Torula yeast-based semisynthetic diet (Teklad Premier, Madison, WI) for 6 weeks. The selenium deficient @e(-)) diet (product TD86298) contained 0.016 mg of seleniumkg of chow; the selenium replete @e(+)) control diet (product TD87177) was the same formulation supplemented with 0.1 mg of seleniumkg of chow as sodium selenite (Na,SeO,). Ani- mals were housed in plastic cages and provided deionized water ad libitum. There was no difference in body weight between the groups throughout the study. Three days prior to sacrifice, rats in the Se(+) (n = 12) and the Se(-) (n = 14) groups were each divided into two sub- groups; rats in one group received a daily injection of T, (3,5,3’-triiodo- thyronine, 50 pg/lOO g of body weight, subcutaneously) to render them hyperthyroid, and rats in the other group were injected comparably with vehicle.

In a second experiment, 14 rats were fed a Se(-) diet for 10 weeks. Beginning 5 days prior to sacrifice, the rats were injected daily with T, (50 pgL00 g of body weight). Rats were then assigned to four subgroups and injected intraperitoneally with either phosphate-buffered saline ( n = 4) or selenium (200 pg of seleniumkg of body weight as Na,SeO, (Sigma) in phosphate-buffered saline) at 72 h (n = 3), 24 h (n = 3), or 8 h (n = 4) prior to sacrifice. Animals in the 72-h group received daily injections of selenium.

One rat was rendered hypothyroid by placing methimazole (0.05%) in the drinking water for 3 weeks prior to sacrifice.

All experimental protocols were approved by the Animal Research Review Committee.

Tissue Preparation and Subcellular Fractionation-Total RNA was prepared as described previously (9). Additional liver and kidney were also homogenized in 5‘-DI assay buffer (0.25 M sucrose, 0.02 M Tris/HCl, pH 7.0, 1 m~ EDTA, 10 mug of tissue) for subsequent determination of 5“DI activity. Subcellular fractionation was performed using the meth- ods of Visser et al. (10).

16223

16224 Effect of Selenium

A .

5”CAGCTGCACCTGACClTCAllTCTTCTCAAAmGACCAG 378 * * 401 5”CACCmTCAl lTClTCTCAAA-3’ Primer 1

Ban HI

Deficiency on Q p e I 5”Deiodinase

-insert +insert

M T+ P- P+

E.

5’-CllTGCATCCCACCTGGACACATGCCTCACiITCThGGGGGCC-3‘ 756 I I I I I I l l I I I I I* I *I1 I I780 3-GGACCTGTGTACGGA-ATGIIBBsiATG5’ Primer2

Em RI

FIG. 1. Nucleotide sequences of primers used for amplification of the carboxyl-terminal portion of the 5”DI cDNA coding re- gion. Sequence on the top of each panel represents the 5”DI cDNA and the three-digit number represents the base number from the transla- tional start site. TGA designates the selenocysteine codon, whereas TAG represents the translational stop codon. Asterisks indicate the mismatches in the primer. A, sequence of the 5’ (sense) PCR primer. B, sequence of the 3’ (antisense) PCR primer.

\Bacterial Expression of 5‘-DI Protein-A fusion protein consisting of glutathione S-transferase (GST) and the carboxyl-terminal half of the 5”DI was expressed in Escherichia coli using the pGEX-2T vector (Pharmacia Biotech Inc.). Preparation of the expression construct in- volved amplification by polymerase chain reaction (PCR) of the 3‘-half of the 5”DI coding region using oligonucleotide primers containing either a BamHI (5”primer) or EcoRI (3”primer) restriction sites (Fig. 1). The full-length 5”DI cDNA used as a template in the PCR was generously provided by M. Berry and P. R. Larsen (1). The PCR product was subcloned into pCRlOOO (Invitrogen, San Diego, CA); the BamHI- EcoRI fragment was isolated and ligated with the BarnHIIEcoRI-cut pGEX-2T to yield pGEX-GST-B’-DI. Sequence analysis confirmed that this contained the carboxyl-terminal portion of the coding region of the 5”DI cDNA in the same reading frame as the GST sequence.

A culture of E. coli strain JM109 (Alac-pro)/F’proABlacIq was trans- formed with pGEX-GST-5“DI and expression induced with 0.1 mM iso- propyl-I-thio-P-u-galactopyranoside (IFTG) for 1.5 h. Centrifugation of the bacterial lysate and subsequent analysis by SDS-polyacrylamide gel electrophoresis (PAGE) demonstrated that the fusion protein was found in the insoluble pellet. To effect partial purification, the pellet was washed with 7 M urea and subjected to SDS-PAGE, after which the fusion protein band was excised from the gel, lyophilized, pulverized, and injected into rabbits.

Antiserum Preparation-New Zealand White rabbits (East Acres Bio- logicals of Southbridge, Southbridge, MA), were immunized subcutane- ously with 250 pg of the gel-purified GST-B’-DI fusion protein in com- plete Freund’s adjuvant and boosted at 3-week intervals with 100 pg of the same antigen preparation in incomplete adjuvant.

Preparation of Acetone Powders-Acetone powders for use in block- ing experiments were prepared according to the method of Harlowe and Lane (11).

Western Blot AnalysisSDS-PAGE was performed according to the methods of Laemmli (12). Proteins were transferred from the gels to Immobilon membranes (Millipore Corporation, Bedford, M A ) at 78 V and 250 mA for 3 h in 25 mM Tris, 192 mM glycine, and 20% methanol at 10 “C (13) using a transblot apparatus (Bio-Rad). Nonspecific binding was blocked by incubation in 5% non-fat dry milk (Carnation, Los An- geles, CA) in TBST solution (10 mM Tris/HCl, pH 8.0,150 mM NaCl, and 0.05% Tween 20) overnight at 4 “C. Blots were incubated with anti-GST- 5‘-DI, anti-GST-5“DI preabsorbed with bacterially expressed GST, or preimmune serum overnight a t 4 “C in 5% milWTBST. The anti-GST- 5”DI (8 pl) was preabsorbed with 400 pg of purified GST by incubation overnight a t 4 “C with shaking prior to use in Western blot analysis. Blots were washed (15 min x 3) in TBST prior to incubation with alkaline phosphatase-conjugated goat anti-rabbit IgG (Promega, Madi- son, WI or Kirkegaard and Perry, Gaithersburg, MD) for 45 min in TBST at room temperature. Blots were washed (15 min x 3) in TBST. Color development was with nitro blue tetrazolium and 5-bromo-4- chloro-3-indoyl phosphate.

RNA Solution Hybridization Assay-5’-DI mRNA levels were quan- tified by a solution hybridization assay as described previously (14) using a 714-base pair cRNA which encompasses 92% of the coding region. Northern blot analysis was as described previously (14).

5’-Deiodinase Actiuity-5’-DI activity in tissue homogenates and subcellular fractions were assayed as described previously (E), using 1.2 PM 3,3’,5‘-triiodothyronine (rT.J and 20 mM dithiothreitol. Reaction mixtures contained 1-20 pg of protein.

49.5

32.5

27.5

18.5 kD

formed with nonrecombinant pGEX (-insert) or pGEX-GST- FIG. 2. Western blot analysis of lysates from bacteria trans-

5”DI (+insert) vectors. The expected size of the nonrecombinant pGEX and pGEX-GST-5”DI proteins were 26 and 40 kDa, respectively. Proteins were probed with a 1:2500 dilution of anti-GST-5”DI serum. The lanes are indicated as follows: M , molecular mass ladder; lanes marked T and P refer to the total cell lysate and pellet, respectively, with (+) or without (-) induction of IFTG.

Atomic Absorption Spectrometry-Plasma selenium concentration was measured by atomic absorption spectrometry, using a Varians graphite furnace Spectra AA 300 Zeeman Atomic Spectrophotometer, which has an automatic background correcting system; a solution of 0.1% nitric acid and palladium was used as a chemical modifier (IO pl of 500 mg/ml). SeO, (c[Sel= 1.000 2 0.002 gAiter) was used as standard. Three sequential determinations for each sample were averaged to ob- tain a mean value.

Glutathione Peroxidase Activity-GPX activity was quantitated by the coupled enzyme procedure of Lawrence and Burk (16). The reaction mixture contained 50 mM potassium phosphate buffer, pH 7, 1 mM EDTA, 1 mM NaN,, 1 mM GSH, 1 enzyme unit/ml glutathione disulfide- reductase. The serum sample (0.1 ml) was added to 0.8 ml of reaction mixture and preincubated for 5 min a t 25 “C before initiation of the reaction by the addition of 0.1 ml of H,O, (2.5 mnr). Absorbance a t 340 nm was recorded for 5 min. One unit of activity catalyzes the oxidation of 1.0 pmol of NADPH reduced per min. The blank reaction, in which distilled water was substituted for sample, was subtracted from each assay.

Statistical Analysis-Data are expressed as the mean * S.E. Statis- tical analysis was by the Student’s t test or the Bonferoni (17) or least significant difference (18) methods when multiple comparisons were made.

RESULTS

Characterization of 5”DI AntiserumSDS-PAGE of proteins from IPTG-induced bacteria transformed with the pGEX-GST- 5’-DI recombinant plasmid revealed the presence of a 40-kDa band (not present in bacteria transformed with the pGEX-ST vector alone) which represented the expressed fusion protein (data not shown). Western blot analysis of these bacterial ly- sates, using antiserum from one of four rabbits immunized with the partially purified GST-B‘-DI fusion protein, identified both the fusion protein and GST (Fig. 2).

Immobilized liver microsomes prepared from hyper- and hy- pothyroid rats were probed with the anti-GST-5’-DI, and a 27.5-kDa band representing the type I 5”DI was detected (Fig. 3A) . Consistent with the differences in 5”DI activity observed in these samples, the intensity of the band in the hyperthyroid sample was much greater than that detected in hypothyroid- ism. When duplicate blots were incubated with preimmune serum, no band was detectable a t 27.5 kDa (data not shown). Specificity of this was further demonstrated by probing West-

Effect of Selenium Deficiency on o p e I5“Deiodinase 16225

A. M HYPER HYPO

FIG. 3. Characterization of anti- GST-5“DI serum. A, Western blot anal- ysis of hyper- and hypothyroid liver mi- crosomal protein probed with a 15000 dilution of anti-GST-B’-DI serum. R, Western blot analysis of subcellular frac- tions of hyperthyroid liver probed with a 1:2500 dilution of serum. The blot in left panel was probed with anti-GST-5“DI se- rum, whereas the blot in right panel was probed with anti-GST-5”DI preabsorbed 32.5 with bacterially expressed GST. Lanes are labeled as follows: Mic, microsomes; N u , nuclei; Cyt, cytosol; and Mil . mito- chondria. C, 5”DI activity corresponding to each subcellular fraction probed in R. Each lane in A and B contains 100 and 20 k D pg of protein, respectively. M designates molecular mass markers.

6.

27.5

49.5

32.5

27.5 c

18.5 kD

M Mic Nuc Cyt Mit M Mic Nuc Cyt Mi!

4 w

Unblocked Blocked

C. Liver 5’DI Activities

Mic Nuc Cyt Mlt

Subcellular Fraction

ern blots of liver microsomal proteins with anti-GST-B’-DI t h a t activities determined in each subcellular fraction as demon- had been preincubated overnight with an acetone powder made strated in Fig. 3, R and C . The highest activity and protein level from the lysate of recombinant bacteria. Under these condi- were observed in the microsomal fraction, consistent with prior tions, binding to a 27.5-kDa band was not observed (data not reports (19). Lesser amounts of activity and protein were de- shown). tected in the mitochondria and nuclei and likely represent con-

We examined the subcellular distribution of the 27.5-kDa tamination with microsomes. A duplicate Western blot prohed protein. The intensity of the band corresponded with the 5”DI with anti-GST-fj’-DI that was preabsorbed with bacterially ex-

16226 Effect of Selenium Deficiency on Qpe I5”Deiodinase TARI.E I

Effrcts of a selrniurn-deficient diet on serum selenium levels. glutathione peroxidasr. and S‘-DI artir-it.v Values represent the mean S.E. of n animals per group.

Group Serum

n n GPX activity Selenium content

uni t s lml n g l m l

6 637.5 t 2.2 290.4 t 20.0 5 6 490.0 2 1.2” 272.0 20.0 4

7 23.5 1.4 <10.Oh 6 7 25.3 t 3.0 <lO.Oh 6

35.4 t 1.9 5 42.8 2 2.4 78.8 T 8.1 5 96.1 t 12.4

3.1 t 0.4“ 6 13.3 1.0“ 7.1 t 1.7‘ 6 10.2 t 1.1‘

” p < 0.001 us. Se(+) vehicle-injected.

‘ p < 0.001 us. Se(+) T,-injected. Below the level of detection hy atomic absorption spectrometry.

pressed GST showed the same pattern of immunoreactivity as in the blot probed with the unblocked anti-GST-5”DI. This further demonstrates the specificity of the antiserum for the 5’-DI protein. A tissue survey (data not shown) indicated the presence of a 27.5-kDa band only in those tissues known to contain 5”DI activity (liver, kidney, and thyroid).

Effects of a Se(-) Diet on Serum Selenium Levels and GPX Activity, and Tissue 5’-DI Protein and Actiuity-As demon- strated in Table I, serum selenium levels and the activity of the selenium-containing enzyme GPX were markedly decreased in rats fed a Se(-) diet for 6 weeks. Of note, hyperthyroid Se(+) rats had significantly lower values of GPX activity than did Se(+) euthyroid animals.

In vehicle-injected animals, selenium deficiency resulted in 69 and 91% decreases in kidney and liver 5”DI activity, respec- tively (Table I). Hyperthyroidism resulted in a 2-fold increase in 5”DI activity in the liver and kidney in Se(+) animals, whereas in Se(-) rats the 5“DI activity in these tissues was not changed.

Enzyme activity and immunoreactivity of the 5”DI in liver microsomes were closely correlated (Fig. 4). In Se(+) animals, T, induced a significant increase in the 27.5-kDa protein, whereas in selenium deficiency, the protein was undetectable in both vehicle- and T,-injected animals.

Effects of Selenium Deficiency on 5”DI mRNA Leuels--5’-DI mRNA levels were determined in liver and kidney of Se(+) and Se(-) animals. As demonstrated in Table II,5’-DI mRNA levels in euthyroid animals were considerably higher in the kidney than in liver, consistent with our previous report (14). In kid- ney, selenium deficiency resulted in a 40% decrease in 5”DI mRNA(p < 0.001; Table II), whereas levels in the liver were not significantly changed (Table 11). In hyperthyroid animals, mRNA levels were markedly increased in both liver and kidney, and this response was unaffected by selenium deficiency.

Northern blot analysis was used to characterize the mRNA species hybridizing to the cRNA probe used in the solution hybridization assay. Hepatic and renal poly(A)+ RNA from eu- thyroid Se(+), hyperthyroid Se(+), euthyroid Se(-), and hyper- thyroid Se(-) rats demonstrated a single band located at ap- proximately 1.9 kilobases (data not shown), consistent with previous reports (1, 14, 20).

Effects of Selenium Supplementation in Rats Previously Fed a Sef-) Diet-Given the marked decreases in 5”DI protein and activity in the liver and kidney of Se(-) rats, we examined the effects of selenium repletion on these parameters. Rats were fed a Se(-) diet for 10 weeks and then injected with T, to induce 5’-DI mRNA levels. Animals were then separated into four groups and injected with vehicle or selenium at 72, 24, or 8 h prior to sacrifice. Selenium repletion resulted in a significant increase in Fi’-DI activity at 24 h in kidneys. By 72 h, the activity reached the level observed in hyperthyroid, Se(+) rats

-*I %-I M T3 V T3 V

49.5

32.5

27.5

18.5 I kD

FIG. 4. Western blot analysis of rat liver microsomal protein from Se(+) and Se(-) rats. Samples \vrrr probed with a 1:2500 dilu- tion of anti-GST-5”DI serum. Lanes contain 100 pg of pmtrin from one rat from each of the fnllowing groups: .W+/T,. Sd+ I rat injrcted with T,; Sef+lV, Se(+) rat injrctrd w t h vehicle; SrI-/T,, S@-I rat injrcted with T,; Sef-jV, Ser-1 rat injrcted with vehicle. .W dc4matx-s molrcular mass markers.

TARI.E I1 Effects of a selenium-drficient dzel on S‘-DI rnRN.4 l t -rdn in

l i w r and krdnev Values represent the mean t S.E. of n animals per group.

5’-Dl mRNA

Livrr K~dnev

pg 1~1g toto1 R.YA

Croup n ~~

.~

Se( + ) Vehicle 6 0.15 t 0.03 1.97 t 0.11 T, 6 5.86 = 0.99 5.79 = 0.60

T, 7 4.62 t 0.95 5.30 = 0.71

Se(-) Vehicle 7 0.12 t 0.01 1.09 0.15“

-~ “ p < 0.001 L’R. Se(+) vehicle-injected.

in the first experiment. Asimilar pattern was noted in the liver (Fig. 5 ) .

Western blot analysis of liver microsomal proteins from each experimental group demonstrated a close correlation between 5”DI immunoreactivity and enzyme activity (Fig. 6). Similar results were found for kidney microsomes (data not shown).

As shown in Fig. 7, Se repletion had no effect on 5”DI mRNA levels in liver from hyperthyroid animals, consistent with the lack of effect of selenium on hepatic mRNA levels demonstrated earlier. In contrast, selenium administration resulted in a

Effect of Selenium Deficiency on o p e I5”Deiodinase 16227

*

Control 8 hours 24 hours 72 hours Treatment Group

FIG. 5 . Effects of selenium injection on 5”DI activity in kidney and liver homogenates of Se(-) rats. Values represent the mean * S.E. of three to four animals per group. *, p < 0.001; +, p < 0.05; and #, p < 0.002 versus control.

A. M C 8h 24h 72h

49.5

32.5

27.5

18.5 kD

4

B.

=- 500 0 1

Liver 5’Dl Activities

h 400 -

E .- 300-

E 4 200 - c 2. > .- .- < ti 100- - 2 0 I i I

. control ’ 8 hours ‘24 hours ‘72 hours ’ Treatment Group

FIG. 6. Analysis of rat liver microsomal 5”DI protein and ac- tivity levels after selenium administration to Se(-) rats.A, West- ern blot was probed with a 1:2500 dilution of serum. Each lane contains 100 pg of liver microsomal protein representing one rat from each of the following groups: C, Se(-) control; 8, 24, and 72 h after repleting sele- nium injection. M designates molecular mass marker. B, the graph shows the 5”DI activity that corresponds with each sample.

rapid 2-fold increase in kidney mRNA levels that persisted for 72 h.

DISCUSSION

Studies of the regulation of the iodothyronine deiodinases have been hampered by the lack of established purification schemes for these proteins. To circumvent this problem, we expressed the carboxyl-terminal half of the 5’-DI as a fusion protein with GST in E. coli and used that protein as an antigen

control 8 hours 24 hours 72 hours Treatment Group

Se(-) diet on 5”DI mRNA levels in kidney and liver. * indicates p FIG. 7. Effects of selenium repletion on hyperthyroid rats fed a

< 0.05 versus control.

to raise specific antiserum. Using this antiserum, we have dem- onstrated that decreased 5”DI activity in the liver and kidney of Se(-) rats is secondary to a decrease in the cellular content of the 5‘-DI protein. Furthermore, by quantitating the levels of 5’-DI mRNA in these tissues in euthyroid and hyperthyroid animals, we have demonstrated conclusively that the de- creased enzyme content is secondary to reduced translational efficiency of the mRNA and that this is reversed within 72 h by selenium repletion.

The secondary structure of the mRNA appears to dictate in part the recognition of UGA as a codon for selenocysteine in- corporation; selenocysteine insertion is not obtained when the stem-loop structure has been disturbed or specific nucleotides in the loop have been changed (21,22). In E. coli, the stem-loop structure is present directly downstream from the UGA codon (21), whereas in eukaryotes, an analogous stem-loop structure is not found in the open reading frame, but located in the 3“untranslated region of the mRNA (2). Such stem-loops have been identified in the type I 5’-DI mRNA (2) as well as those encoding GPX (2) and selenoprotein P (4). Our initial attempts to express the 5’-DI protein in E. coli utilized a construct that contained the entire coding region of the gene. Only the amino- terminal half of the 5‘-DI up to the codon UGA was expressed, due to these differences in the mechanism for insertion of sel- enocysteine residues into polypeptides in E. coli versus eukary- otic organisms. The immunization of several rabbits and chick- ens with this amino-terminal fusion protein, the 5’-DI component of which is extremely hydrophobic, failed to induce production of a useful antiserum.2

Several lines of evidence suggest, however, that the anti- serum obtained by immunization with the carboxyl-terminal fusion protein reacts with the 5”DI protein. These include the observations that (a) antiserum, but not preimmune serum, recognizes the 5“DI-GST fusion protein present in recombi- nant bacterial lysates; ( b ) the antiserum identifies a 27.5-kDa protein in subcellular fractions of rat liver that correspond with the distribution of 5’-DI activity; (c) the 27.5-kDa protein is increased in abundance in microsomes from hyperthyroid rats and markedly decreased in hypothyroidism; ( d ) detection of the 27.5-kDa band is specifically blocked by preincubation of the antiserum with an acetone powder prepared from lysates of recombinant bacteria expressing the 5“DI-GST fusion protein; and (e) the 27.5-kDa band is detected when probed with anti- GST-5”DI preabsorbed with bacterially expressed GST.

Previous studies have shown that selenium deficiency re- sults in a marked reduction in levels of the selenoproteins GPX and selenoprotein P and that both pretranslational and trans- lational factors appear to be involved in this response (6). Most investigators have noted a marked reduction in the levels of GPX mRNA in the liver and kidney of Se(-) animals. Using

16228 Effect of Selenium Deficiency on Qpe I5”Deiodinase

nuclear run-on assays, transcriptional rates ofthis gene appear to be unchanged by selenium status, implying that selenium deficiency decreases the half-life of the GPX mRNA (23, 24). Selenoprotein P mRNA levels in the liver are also decreased by selenium deficiency (6).

Only limited data on the levels of 5”DI mRNA in selenium deficiency have been published to date. In a preliminary report, Grolj and co-workers (25) observed a decrease in 5’-DI mRNAin cultures of selenium-depleted LLC-PK1 renal cells, a finding consistent with our demonstration of decreased mRNAlevels in the kidney in Se(-) rats. Hill et al. (7) reported that selenium deficiency decreased liver 5”DI mRNA levels. In our studies, however, we did not obseme such a decrease. Our result was not secondary to a lesser degree of selenium depletion in the liver than in kidney, since 5”DI activity was actually lower in this tissue than in the kidney of Se depleted animals.

The difference in response of 5’-DI mRNA to selenium deple- tion in the liver and kidney was further highlighted by sele- nium repletion. Selenium administration resulted in a rapid 2-fold increase in kidney 5“DI mRNA levels. No significant change was noted in the 5”DI mRNA levels of the liver in this experiment.

I t is clear from our studies in hyperthyroid rats that the decreased levels of 5’-DI protein and activity in Se(-) rats do not result from decreased mRNA. Indeed, selenium deficiency had no effect on the induction of 5”DI mRNA by T, adminis- tration. Furthermore, injection of hepatic poly(A)+ RNA from T,-injected Se(-) rats into Xenopus laevis oocytes induced ex- pression of 5‘-DI activity,’ demonstrating that the 5“DI mRNA is functional. Thus, the decrease in 5”DI protein which occurs in selenium deficiency appears to be due to a block in the UGA-directed selenocysteine incorporation during translation.

Our selenium repletion experiment showed that 5’-DI activ- ity in Se(-) liver and kidney increased significantly within 24 h of selenium administration. After 72 h of repletion, the 5’-DI activity reached levels found in hyperthyroid Se(+) control ani- mals. The close correlation between the activity and immuno- reactivity of the 5’-DI in this experiment suggested that there is little or no significant post-translational modification of this protein. These results are similar to those reported by others for selenoprotein P and GPX (16).

We observed in Se(+) animals that hyperthyroidism was as- sociated with a small but significant decrease in serum GPX level. Similar findings have been noted in patients with hyper- thyroidism due to Graves’ disease as compared with euthyroid individuals (26). Beckett et al. (26) have suggested that these changes may be due to a shortened half-life of selenoproteins in this condition.

D. DePalo, unpublished data.

In conclusion, the predominant mechanism causing de- creased extrathyroidal 5”DI activity in Se(-) animals is im- paired synthesis of the enzyme secondary due to a translational defect. Although decreased 5’-DI mRNA levels can be demon- strated in the kidney of such animals, this appears to contrib- ute little to the decreased amount of 5”DI enzyme and activity.

Acknowledgments-We thank Dr. Valerie Anne Galton for critical reading of the manuscript and Drs. Marla Berry and P. R. Larsen for the G21 (5’-DI) cDNA clone. Dr. Chengquan Zhao from Qingdao Medical College (China) has been in training at the Hebrew University- Hadassah Medical School under the auspices of the China-Israel Scientific Exchange Program.

REFERENCES 1. Berry, M. J., Banu, L., and Larsen, P. R. (1991) Nature 349, 438440 2. Berry, M. J., Banu, L., Chen, Y., Mandel, S. J. Kieffer, J. D., Harney, J. W., and

3. Shen, Q., Chu, F. F., and Newburger, P. E. (1993) J. Biol. Chem. 268,11463-

4. Hill, C. E., Lloyd, R. S., and Burk, R. F. (1993) Proc. Natl. Acad. Sci. U. S. A.

5. Berry, M. J., Banu, L., Harney, J. W., and Larsen, P. R. (1993) EMBO J. 12,

6. Hill, K. E., Lyons, P. R., and Burk, R. E (1992) Biochem. Biophys. Res. Com-

7. Beckett, G. J., Beddows, S. E., Morrice, P. C., Nicol, E , and Arthur, J. R. (1987)

8. Behne, D., Kyriakopoulos, A,, Meinhold, H., and Kohrle, J. (1990) Biochem.

9. St. Germain, D. L., and Morganelli, C. M. (1989) J. Biol. Chem. 264, 3054-

10. Visser, T. J., Kaptein, E., Terpstra, 0. T., and Krenning, E. P. (1988) J. Clin.

11. Harlowe, E., and Lane, D. (1988) Antibodies: A Laboratory Manual, Cold

12. Laemmli, U. K. (1970) Nature 227,680-685 13. Towbin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A.

14. O’Mara, B. A,, Dittrich, W., Lauterio, T. J., and St. Germain, D. L. (1993)

15. St. Germain, D. L. (1988) J. Clin. Inuest. 81, 1476-1484 16. Lawrence, R. A., and Burk, R. F. (1976) Biochem. Biophys. Res. Commun. 71,

17. Godfrey, K. (1985) N. Engl. J. Med. 313, 1450-1456 18. Snedecor, G. W., and Cochran, W. G. (1980) Statistical Methods 7th Ed., The

19. Visser, T. J., Van Der Does-Tob6, I., Docter, R., and Hennemann, G. (1976)

20. St. Germain, D. L., Dittrich, W., Morganelli, C. M., and Cryns, V. (1990) J. Bid.

21. Zinoni, E , Heider, J., and Bock, A. (1990) Proc. Natl. Acad. Sci. U. S . A. 87,

22. Heider, J., Baron, C., and Back, A. (1992) EMBO J. 11,3759-3766 23. Christensen, M. J., and Burgener, K. W. (1992) J. Nutr: 122, 1620-1626 24. Chang, M., and Reddy, C. C. (1991) Biochem. Biophys. Res. Commun. 181,

25. Grofl, M., Oertel, M., Brechlin, A. M., Rokos, H., and Kohrle, J. (1992) Acta 1431-1436

26. Beckett, G. J., Peterson, F. E., Choudhury, K., Rae, P. W. H., Nicol, F., Wu, P. Endocrinol. 126, 175

S.-C., Toft, A. D., Smith, A. F., and Arthur, J. R. (1991) J. Dace Elem. Electrolytes Health Dis. 5, 265-267

Larsen, F? R. (1991) Nature 353,273-276

11469

90,537-541

3315-3322

mun. 185,260-263

Biochem. J. 248,443-447

Biophys. Res. Commun. 173, 1143-1149

3056

Endocrinol. Metab. 67, 17-24

Spring Harbor Laboratory, Cold Spring Harbor, NY

16,43504354

Endocrinology 133, 1715-1723

952-958

Iowa State University Press, Ames, L4

Biochem. J. 157, 479482

Chem. 265,20087-20090

4660-4664