The jasmonate-induced expression of the Nicotiana tabacum leaf lectin

The Jasmonate-Induced Expression of the Nicotiana tabacum Leaf Lectin

Nausicaa Lannoo1, Gianni Vandenborre

1, 2, Otto Miersch

3, Guy Smagghe

2, Claus Wasternack

3,

Willy J. Peumans 1 and Els J. M. Van Damme 1, �

1 Laboratory of Biochemistry and Glycobiology, Department of Molecular Biotechnology, Ghent University, Coupure Links 653, B-9000Gent, Belgium2 Laboratory of Agrozoology, Department of Crop Protection, Ghent University, Coupure Links 653, B-9000 Gent, Belgium3 Department of Natural Product Biotechnology, Leibniz Institute of Plant Biochemistry, Weinberg 3, D-06120 Halle/Saale, Germany

Previous experiments with tobacco (Nicotiana

tabacum L. cv Samsun NN) plants revealed that jasmonic

acid methyl ester (JAME) induces the expression of a

cytoplasmic/nuclear lectin in leaf cells and provided the first

evidence that jasmonates affect the expression of carbohy-

drate-binding proteins in plant cells. To corroborate the

induced accumulation of relatively large amounts of a

cytoplasmic/nuclear lectin, a detailed study was performed

on the induction of the lectin in both intact tobacco plants and

excised leaves. Experiments with different stress factors

demonstrated that the lectin is exclusively induced by

exogeneously applied jasmonic acid and JAME, and to a

lesser extent by insect herbivory. The lectin concentration

depends on leaf age and the position of the tissue in the leaf.

JAME acts systemically in intact plants but very locally in

excised leaves. Kinetic analyses indicated that the lectin is

synthesized within 12 h exposure time to JAME, reaching a

maximum after 60 h. After removal of JAME, the lectin

progressively disappears from the leaf tissue. The JAME-

induced accumulation of an abundant nuclear/cytoplasmic

lectin is discussed in view of the possible role of this lectin in

the plant.

Keywords: Inducible protein — Jasmonate — Lectin —

Nicotiana tabacum — Spodoptera littoralis — Tobacco.

Abbreviations: AOC, allene oxide cyclase; BA, 6-benzylami-nopurine; DMSO, dimethylsulfoxide; GA3, gibberellic acid; JA,jasmonic acid; JAME, jasmonic acid methyl ester; 12-OH-JA,tuberonic acid; Nictaba, Nicotiana tabacum agglutinin; OPDA, 12-oxo-phytodienoic acid; RT–PCR, reverse transcription–PCR; SA,salicylic acid.

Introduction

Many plants including important food crops such as

wheat, potato, tomato and bean contain carbohydrate-

binding proteins commonly referred to as ‘lectins’, ‘agglu-

tinins’ or ‘hemagglutinins’ (Van Damme et al. 1998, Van

Damme et al. 2007). Plant lectins represent a very diverse

and heterogeneous group of plant proteins that contain

at least one non-catalytic domain that binds reversibly to

specific mono- or oligosaccharides. The characterization of

an extensive number of different plant lectins revealed,

however, the existence of only a limited number of

carbohydrate-binding motifs (Peumans et al. 2000). Most

lectins exhibit a sugar specificity directed against complex

N- and O-glycans that are absent from plant cells, but

present on the surface of microorganisms or on the

epithelial cells along the intestinal tract of phytophagous

invertebrates and/or herbivorous animals. Together with

the high expression levels (generally 0.1–10% of the total

protein) and preferential accumulation in storage tissues, it

is believed that these so-called ‘classical’ plant lectins do not

fulfill an endogenous role in the plant, but preferably

function as storage proteins and, whenever appropriate, can

also act as defense proteins (Van Damme et al. 2007).

It has already been shown that some plant lectins

possess cytotoxic, fungitoxic, anti-insect and anti-nematode

properties in vitro or in vivo, and some lectins are toxic

to higher animals (Van Damme et al. 1998, Van Damme

et al. 2007).

The role of lectins in plant defense against foreign

attack is in marked contrast to the function of animal

lectins because most of these lectins are believed to

recognize and bind ‘endogenous’ receptors and, accord-

ingly, are involved in recognition mechanisms within the

organism itself (Kilpatrick 2002, Sharon and Lis 2004).

However, the recent finding of several stress-inducible plant

lectins opens up new perspectives for an endogenous role

for a new class of plant lectins (Van Damme et al. 2004a,

Van Damme et al. 2004b). Most of these ‘inducible’ lectins

are expressed at very low levels only after exposure of the

plant to specific biotic/abiotic stimuli, such as salt stress,

drought, light, heat or cold shock, wounding or treatment

with ABA, jasmonic acid (JA) and gibberellins

(Van Damme et al. 2007). Unlike the classical lectins

which are present in vacuoles, this new class of plant lectins

is located exclusively in the cytoplasm and the nucleus.

Based on these observations, the concept was developed

that lectin-mediated protein–carbohydrate interactions in

the cytoplasm and the nucleus play an important role in

�Corresponding author: E-mail, [email protected]; Fax, þ32-92646219.

Plant Cell Physiol. 48(8): 1207–1218 (2007)doi:10.1093/pcp/pcm090, available online at www.pcp.oxfordjournals.org� The Author 2007. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.All rights reserved. For permissions, please email: [email protected]

1207

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

the stress physiology of the plant cell (Van Damme et al.

2004a, Van Damme et al. 2004b).

Although it is widely known that plant tissues treated

with jasmonates or exposed to chemicals that induce

jasmonate accumulation in planta synthesize high levels of

so-called jasmonate-induced proteins (Wasternack and

Hause 2002, Wasternack 2006), the first jasmonate-induced

lectin was only reported in 2002, when Chen et al. first

described the accumulation of a chitin-binding lectin in

tobacco (Nicotiana tabacum L. cv Samsun NN) leaves, also

called Nicotiana tabacum agglutinin or Nictaba. Lectin

activity cannot be detected in untreated tobacco leaves but

accumulates in leaves treated with jasmonic acid methyl

ester (JAME). No lectin expression was detected in vascular

tissues, stems, flowers and roots (Chen et al. 2002). The leaf

lectin was purified and characterized as a dimeric protein

composed of 19 kDa subunits that are not glycosylated.

Recently it was shown that Nictaba not only recognizes

GlcNAc oligomers but also strongly interacts with high-

mannose and more complex N-glycans (Lannoo et al.

2006b). Using immunocytochemistry with an antibody

specifically directed against the lectin, the location of

Nictaba in the nucleus and to a lesser extent in the

cytoplasm was shown in JAME-treated leaves (Chen et al.

2002). Meanwhile these results were confirmed by confocal

microscopy of the expression of an enhanced green

fluorescent protein (EGFP)–Nictaba fusion construct in

tobacco cells. These microscopic analyses further revealed

an accumulation of the lectin at the nuclear rim (Lannoo

et al. 2006b).

Although the carbohydrate-binding activity and speci-

ficity of Nictaba are well understood, the question remains

why tobacco leaves accumulate relatively large amounts of a

cytoplasmic/nuclear lectin in response to jasmonates.

To obtain first insights into the physiological role of

Nictaba, a detailed study was made of the induction of

this new type of lectin in both intact tobacco plants and

excised leaves. The different factors that can induce lectin

activity as well as the timing of lectin accumulation in plant

tissues are discussed.

Results

Jasmonic acid and its methyl ester are the key chemical

inducers of the tobacco lectin

To identify possible inducing agents other than

jasmonates, excised leaves of tobacco (N. tabacum cv

Samsun NN) plants were subjected to a series of treatments

with chemicals or abiotic factors and checked for the

induction of lectin activity using agglutination assays. Of

all plant hormones and hormone-releasing compounds

tested [JA, 12-OH-JA, JAME, gibberellic acid (GA3),

salicylic acid (SA), IAA, ABA, 6-benzylaminopurine (BA)

and ethephon), only JAME and JA induced the synthesis of

lectin in detached leaves of tobacco plants, the optimal

concentrations being 50–100 mM for JAME and

100–150 mM for JA (Fig. 1) (data not shown for most

plant hormones). Lectin accumulation could be induced by

floating leaves on a solution containing JA or JAME, as

well as by treatment of plants with JAME through the gas

phase. Combinatorial treatment of the leaves with different

plant hormones either followed or preceded by a JAME

treatment did not reveal any noticeable synergistic or

inhibitory effect between JAME and other plant hormones.

Repeated mechanical wounding by different techniques

failed to induce any detectable lectin activity. The same

holds true for salt stress, heat and cold shock, and

irradiation with UV light (data not shown).

Though induction of lectin activity was observed with

detached leaves of plants grown in vitro as well as

greenhouse-grown plants, excised leaves cut from plants

grown in vitro accumulated less lectin compared with

those cut from greenhouse-grown plants of identical

age (250mg g�1 FW and 3mg g�1 FW, respectively).

Estimations of the lectin content of all individual leaves

of a JAME-treated plant revealed that the rapidly

expanding leaves accumulate more lectin (up to 500mglectin g�1 FW) than both older and younger leaves

(expressing 100 and 200 mg lectin g�1 FW, respectively),

indicating that the responsiveness of the leaves changes as a

function of age. Therefore, leaves of a comparable age and

developmental stage were used for all comparative analyses.

Kinetics of the JAME-induced Nictaba accumulation in

excised tobacco leaves

To follow the kinetics of lectin accumulation

in detached leaves, leaves cut from 12-week-old

4

3

2

1

0

Lec

tin

co

nte

nt

(mg

/g F

W)

0 25 50

Concentration (mM)100 150 200

Fig. 1 Dose–response curve of the induction of Nictaba in16-week-old tobacco leaves of greenhouse-grown tobacco plantsfloated on different concentrations of JA and JAME for 60 h. Resultsare expressed as mg lectin g–1 leaf tissue (FW). Gray and white barsrepresent the data for JAME and JA, respectively (mean value� SDof four independent replicate leaves).

1208 Jasmonate-induced expression of tobacco lectin

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

greenhouse-grown plants were floated on a 50 mM JAME

solution for different time periods and subsequently

transferred onto water until the end of the experiment

(72 h). Then, the leaves were extracted and their lectin

content determined. As shown in Fig. 2, treatment with

JAME for at least 12 h is required to induce a detectable

level of Nictaba. However, exposure to JAME for 48–60 h

is required to reach the maximum level of JAME-induced

Nictaba.

Though indicative for the requirement of a relatively

long exposure time, the results do not prove or disprove the

need for a continuous exposure to JAME. To address this

question, a similar set of leaves was subjected to a daily

induction regime where they were floated on a 50 mMJAME solution for a given time followed by incubation on

water for the rest of the day. This regime was followed for

three consecutive days, after which the leaves were extracted

and the lectin content determined (inset in Fig. 2). A short

JAME treatment of 2 h for three consecutive days already

resulted in the induction of an amount of lectin comparable

with that observed after a continuous exposure to JAME

for 24 h. A daily JAME treatment for 6 h interrupted by

18 h flotation on water for three consecutive days yielded a

final lectin concentration equal to that of leaves that were

continuously exposed to JAME for approximately 40 h.

These findings indicate that the induction of Nictaba by

exogenous JAME does not require a continuous exposure

but can also be achieved by intermittent daily JAME

applications.

In detached leaves Nictaba expression is restricted to the site

of JAME application

To check whether Nictaba accumulates uniformly over

the whole leaf area, leaves were cut from 16-week-old

greenhouse-grown plants and transferred onto a 50mMJAME solution. After incubation for 3 d the leaves were

divided (along the longitudinal axis) in 1 cm slices.

Extraction and subsequent determination of the lectin

content revealed that the lectin amount was highest in

the slices originating from the middle part of the leaf

(reaching levels up to 30mg g�1 FW) and decreased

towards both the proximal and distal end (Fig. 3A).

At the very tip, the lectin amount was approximately

10-fold lower than in the middle of the leaf. At the proximal

end, the slice consisted almost exclusively of the petiole

or mid rib, and lectin activity was barely detectable.

Similar results were obtained with leaves from whole

plants treated with JAME through the gas phase for 4 d,

indicating that the responsiveness of the parenchyma cells is

for a great part determined by their position in the leaf.

Experiments in which only part of a detached leaf

(top, middle or bottom part) was floated on JAME

(and the remainder of the leaf floated on water) revealed

that lectin accumulation was detectable only in that part of

the leaf that was in direct contact with the JAME solution

(Fig. 3B–D). The tissues that were immersed in water did

not accumulate detectable amounts of lectin, suggesting

that in detached leaves JAME acts exclusively at the site

of application.

Nictaba expression is systemically induced in tobacco plants

To address whether JAME acts systemically or locally

in a plant, a single leaf of a 4-week-old greenhouse-grown

tobacco plant, still attached to the plant, was placed in a

closed Petri dish filled with a 50 mM JAME solution. After

incubation for 3 d, extracts were made of all individual

leaves and assayed for lectin activity. As could be expected,

the treated leaf accumulated a high level of Nictaba. Lectin

activity was also detected in all other leaves, suggesting

transport of a signal from the treated leaf to the rest of

the plant. However, the lectin content depends on the

position of the leaf relative to that of the leaf treated with

the JAME solution (Fig. 4). The basal leaves contained

lectin, but the level of activity was very low. In the apical

leaves, the lectin content was much higher, except in the

leaf just above the treated leaf. The lectin content of the

second and third apical leaf was almost as high as that of

the treated leaf. Towards the top, the amount of Nictaba

progressively decreased. Though a minimal response is

observed in the basal direction, the predominant response

appeared in the apical direction. The low response of

the first apical leaf might be due to its position opposite to

the treated leaf. Apical transport of an inducer starting

Lec

tin

co

nte

nt

(mg

/g F

W)

Lec

tin

co

nte

nt

(mg

/g F

W)

30

25

20

15

10

5

00

0 2 4 6 10

3 6 9 12 15 18 24 32 36 44 48 60 72

Incubation time (h)

Incubation time (h)

20

15

10

5

0

Fig. 2 Accumulation of Nictaba in detached tobacco leaves aftercontinuous exposure to 50mM JAME. After JAME treatment, leaveswere further incubated on water until the end of the experiment(72 h), extracted and their lectin content determined. Inset:accumulation of Nictaba in detached tobacco leaves afterintermittent exposure to 50 mM JAME. After JAME treatment,leaves were further incubated on water until the next day. Then,the treatment with JAME was repeated on two consecutive days. Atthe end of the experiment, leaves were extracted and their lectincontent determined.

Jasmonate-induced expression of tobacco lectin 1209

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

from the base of the treated leaf is at the height of the first

apical leaf mainly confined to the vascular bundles at the

opposite site so that only a very weak signal can be

transmitted in this first upper leaf.

Fate of JAME-induced accumulation of Nictaba

The availability of an in planta system consisting of

whole plants induced through the gas phase and a system of

excised leaves floating on a JAME solution offered the

opportunity to compare the amount of lectin after removal

of its inducer in leaves that remain fully functional on the

plant and in leaves that are irreversibly directed towards

aging and functional disintegration after being detached

from the plant. To follow the fate of Nictaba, 14-week-old

plants with large-sized leaves (approximately 40 cm) were

treated with JAME in the gas phase whereas detached

leaves were floated on a solution of JAME. Samples were

taken regularly from the central part of single leaves of

comparable age and position on the tobacco plants

(to minimize the variability of the lectin content due to

the position of the leaf on the plant and the position of the

40

30

20

10

0Lec

tin

co

nte

nt

(mg

/g F

W)

10

8

6

4

2

0Lec

tin

co

nte

nt

(mg

/g F

W) 5

4

3

2

1

0Lec

tin

co

nte

nt

(mg

/g F

W)

40

30

20

10

0Lec

tin

co

nte

nt

(mg

/g F

W)

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

16 17 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 1718 19

Slice number Slice number

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

Slice numberSlice number

1 19... 1 17...

1 17...1 15...

A B

C D

Fig. 3 Distribution of Nictaba in detached tobacco leaves treated with 50 mM JAME for 4 d. (A–D) Application of JAME to the whole leaf(A), the middle part (B), the tip (C) and the basal part (D) of the leaf, respectively. The leaf area treated with the JAME solution is shadedgray. After incubation, leaves were cut in 1 cm slices and individually extracted and assayed for lectin activity. Slices are numbered fromthe base to the top of the leaf.

−7 −6 −5 −4 −3 −2 −1 0 1 2 3 4 5 6 7 8

Slice number

753

1−1−3

86420

−2−4

150

100

50

0

Lec

tin

co

nte

nt

(mg

/g F

W)

Fig. 4 Systemic induction of Nictaba in different leaves of a4-week-old greenhouse-grown tobacco plant after floating ofa single fully expanded leaf (while still attached to the plant)on 50 mM JAME for 3 d. At the end of the induction period,all leaves were individually extracted and their lectinamount determined. The leaf treated with JAME is numbered0 and shaded gray. Apical leaves are numbered 1–8 (from leaf0 to the top); distal leaves are numbered –1 to –7 (from leaf 0 tothe base).

1210 Jasmonate-induced expression of tobacco lectin

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

tissue within the leaf). Since mechanical wounding does not

induce Nictaba it is unlikely that the repeated sampling

from the same leaf interferes with the fate of the lectin in the

rest of the leaf. Analyses of detached leaves that were

floated on a JAME solution for 3 d, extensively washed with

water and subsequently incubated on daily refreshed water

for up to 3 weeks demonstrated that the amount of lectin

decreased rapidly with a half-life of approximately 5 d.

After 20 d, lectin levels were barely detectable, but at that

time the leaves already started to decay (Fig. 5A). Using the

in planta system, in which plants were treated with JAME in

the gas phase for four consecutive days and samples were

taken regularly over a period of 50 d after treatment,

quantitative analyses showed that the induced Nictaba

amount remained unaffected during the first 10 d after

JAME removal, but then decreased progressively. After

20 d, the lectin content was diminished to 25% of the initial

amount, and fell below the level of detection after

approximately 6 weeks (Fig. 5B). In conclusion, the

decrease in the amount of lectin in whole plants after

removal of the inducer occurs much more slowly with a

half-life of approximately 10 d compared with the experi-

ment with detached leaves.

Insect damage induces lectin expression

To test the effect of insect herbivory, 16-week-old

greenhouse-grown tobacco plants were infested with larvae

of the cotton leafworm (Spodoptera littoralis) whereby a

single larva was allowed to feed on one leaf for 12 h. After

feeding, larvae were removed and lectin contents were

measured immediately in both the infested leaf and two

non-infested upper leaves and one non-infested lower leaf

(¼ systemic leaves). Agglutination assays with leaf extracts

from the plant subjected to insect herbivory did not show

lectin activity in the wounded leaf or in the systemic leaves.

However, transcription of the Nictaba gene(s) could be

demonstrated in all treated tobacco leaves after insect

damage using reverse transcription–PCR (RT–PCR) for

amplification of RNA for Nictaba (Fig. 6A, 608 bp band).

In control leaves and leaves positioned near the treated

leaves, no RNA for Nictaba could be detected in the

first round of PCR. When a nested PCR was performed,

all non-treated tobacco leaves also showed a faint signal

for Nictaba expression (Fig. 6A, 498 bp band), suggesting

the presence of low RNA levels for Nictaba in these leaves.

Using this nested PCR, Nictaba RNA was also detected

in the control leaves, suggesting the presence of a basal

transcription activity of the Nictaba gene(s) which,

however, does not result in detectable expression of

the protein when assayed by agglutination assays or

Western blot.

Insect herbivory on tobacco leaves also clearly induced

expression of a gene encoding allene oxide cyclase (AOC),

an important enzyme in the biosynthesis pathway of

jasmonates. RT–PCR revealed the presence of RNA

encoding NtAOC in the treated leaves as well as in the

first leaf above the treated one (Fig. 6A, 776 bp band),

implicating the systemic induction of this enzyme as

reported previously (Stenzel et al. 2003b). Using a nested

PCR, NtAOC RNA was also detected in the second leaf

above the treated leaf (Fig. 6A, 384 bp band).

Quantification of JA levels in the leaf samples indicated

that insect damage enhanced the endogenous levels of the

JA precursor 12-oxo-phytodienoic acid (OPDA), JA and

the JA metabolite 12-OH-JA (also known as tuberonic acid)

in treated leaves but not in systemic leaves (Table 1).

500

400

300

200

100

00 5 7 11 15 20

Days post treatment

A B

Days post treatment

Lec

tin

co

nte

nt

(mg

/g F

W)

Lec

tin

co

nte

nt

(mg

/g F

W) 3

2

1

04 7 9 11 14 16 18 21 23 25 29 32 37 44

Fig. 5 Fate of JAME-induced Nictaba in tobacco plants and detached leaves after removal of JAME. (A) Two leaves cut from an8-week-old tobacco plant were floated on a 50mM JAME solution for 4 d and subsequently transferred to water for further incubation.Small samples of leaf tissue were taken at regular intervals over a period of 20 d, extracted and the lectin content determined. (B) Two14-week-old tobacco plants were treated with JAME through the gas phase for 3 d. After induction, plants were further grown in theabsence of the inducer. Small samples of tissue of one leaf per plant were taken at regular intervals over a period of 50 d, extracted andthe lectin content determined. White and black bars represent the leaves of two different plants.

Jasmonate-induced expression of tobacco lectin 1211

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

Similar observations were made when a single leaf was

floated on 50 mM JAME, while still attached to the plant.

Remarkably, the amount of 12-OH-JA was far more

elevated by insect damage than the amounts of OPDA

and JA, and was dramatically increased upon JAME

treatment.

In a second experiment, a single leaf of a tobacco plant

was infested with larvae of the cotton leafworm for different

time periods ranging from 3h up to 24 h. Lectin activity was

quantified 48 h after the start of the experiment, allowing

time for protein synthesis. As shown in Fig. 6B, insect

herbivory clearly induced lectin activity in the wounded

leaves. Maximal levels of lectin (300 mg Nictaba g�1 FW)

were reached when caterpillars were allowed to eat for

approximately 15 h. Longer feeding times did not further

increase the lectin levels induced in the infested leaves.

Table 1 Determination of the concentrations of oxo-phytodienoic acid (OPDA), JA and 12-OH-JA in N. tabacum cv

Samsun NN leaves after S. littoralis herbivory and JAME treatment

Insect herbivorya JAME treatmentb

[OPDA]

(pmol g�1)

[JA]

(pmol g�1)

[12-OH-JA]

(pmol g�1)

[OPDA]

(pmol g�1)

[JA]

(pmol g�1)

[12-OH-JA]

(pmol g�1)

Control leaf 103.7� 15.1 215.0� 4.2 109.0� 17.1 84.7� 23.0 225.3� 110.0 95.3� 19.1

Leaf 1– 80.7� 12.9 166.5� 0.7 86.0� 15.7 94.0� 5.6 162.0� 25.2 99.0� 12.0

Treated leaf 113.7� 2.5 309.5� 77.1 535.7� 203.5 102.0� 3.6 4755.7� 1147.9 3560.3� 1296.7

Leaf 1þ 85.0� 3.6 133.5� 9.2 105.7� 29.1 62.3� 36.7 178.7� 52.0 98.3� 9.9

Leaf 2þ 80.7� 31.8 321.5� 259.5 97.0� 19.1 86.7� 10.7 150.7� 17.2 82.0� 26.5

Samples were taken from the treated leaf as well as the first leaf below the treated leaf (leaf 1–) and the two leaves above the treated leaf(leaf 1þ, leaf 2þ respectively). A leaf taken before the treatment served as a control. Each value is the mean of three independentexperiments.a A single L4 larva of S. littoralis was allowed to feed on one leaf of a tobacco plant for 12 h. Afterwards all leaves were collected andanalyzed immediately.b One leaf of a tobacco plant was floated on 50mM JAME in a closed container while still attached to the plant. After 12 h all leaves of theplant were collected and analyzed immediately.

Nictaba

AOC

Internalcontrol

608 bp

498 bp

776 bp

384 bp

287 bp

0 1 2 3 4

400

300

200

100

00 3 6 9 12 15 18 21 24

Nic

tab

a ac

cum

ula

tio

n(m

g/g

FW

)

Hours of caterpillar herbivory

BA

Fig. 6 Quantitative analysis of Nictaba expression using RT–PCR (A) and agglutination assays (B). (A) RT–PCR showing accumulation ofRNA corresponding to Nictaba and AOC in tobacco leaves before and after insect herbivory. Leaves of 16-week-old greenhouse-growntobacco plants were infested with one fourth instar larva of S. littoralis for 12 h. Immediately after this feeding period, the insects wereremoved and treated leaves (sample 2), untreated leaves positioned just below the treated leaf (sample 1) and the first (sample 3) andsecond (sample 4) leaf above the treated leaf were powdered in liquid nitrogen before purification of total RNA. Sample 0 contains RNAfrom a non-treated leaf taken from the tobacco plants before stress application. The 608 bp band corresponding to Nictaba represents theamplification product of PCR (25 cycles) with primers evd 42–evd 43, the 498 bp band represents the end product of a nested PCR (12–15cycles) on the 608 bp fragment using primers L35–L36. The 776 bp band corresponding to AOC represents the amplification product of aPCR (35 cycles) with primers evd 231–evd 232, whereas the 384 bp band results from a nested PCR (12 cycles) on this 384 bp fragmentwith primers evd 246–evd 247. The internal control shows RT–PCR (25 cycles) performed with primers evd 282 and evd 283 to amplify thegene encoding the ribosomal protein L25. (B) One leaf of a tobacco plant (while still attached to the plant) was infested with one larva ofS. littoralis for different time intervals. At 48 h after the start of the experiment lectin, activity was quantified in the treated leaf. Results areexpressed as mg lectin g–1 leaf tissue (FW) (mean values� SD of three independent replicate leaves).

1212 Jasmonate-induced expression of tobacco lectin

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

Discussion

Jasmonates are important signaling molecules that

function in (i) developmental processes; (ii) regulation of the

plant’s metabolism; and (iii) defense responses against

pathogens and insects/herbivores by altering the expression

of defense proteins, enzymes of amino acid and secondary

metabolism, and vegetative storage proteins (for reviews,

see Creelman and Mullet 1997, Kessler and Baldwin 2002,

Howe 2004, Devoto and Turner 2005, Wasternack 2006).

Earlier reports have shown that jasmonates do not provoke

the same or a similar set of responses in all plants (reviewed

in Wasternack et al. 1996). Previous studies analyzing

jasmonate responses in tobacco reported the up-regulation

of enzymes directly involved in the oxylipin pathway

(i.e. the synthesis pathway for jasmonates) such as hydro-

peroxide lyase and lipoxygenase, the up-regulation of acid

phosphatase, the production of several volatile C6 com-

pounds, and a reduction of the overall protein content after

application of signaling compounds, JA or JAME

(Avdiushko et al. 1995, Kenton et al. 1999b).

Here we report the accumulation of a carbohydrate-

binding protein from N. tabacum as a response to

exogenous application of different stresses. From all plant

hormones and chemical compounds tested, only JA and

JAME induced Nictaba accumulation in tobacco leaves.

Treatment with other plant hormones such as SA or

ethylene did not visibly change the jasmonate-induced

lectin content. An antagonistic effect of SA on JA/ethylene

signaling in plant defense has been reported on several

occasions (Pena-Cortes et al. 1993, Doares et al. 1995, Niki

et al. 1998, Takahashi et al. 2004), whereas only some

examples of a synergistic effect have been published

(Campbell et al. 2003, Mur et al. 2006). Mur et al. (2006)

claim that the outcome of SA/JA signaling in plant defense

pathways is highly dependent on the relative concentrations

of each hormone. The absence of any antagonistic or

synergistic action of other plant hormones on the level of

Nictaba induction could be explained by the fact that lectin

induction by JA is a very late response (after several hours

or even days, see Fig. 2). In tomato it was shown that

transcripts of so-called late response genes, encoding

proteinase inhibitors and other defense-related proteins,

start to accumulate locally and systemically about 2 h after

wounding and reach maximum levels 8–12 h after wounding

(Howe 2004). Genes exhibiting more rapid and transient

expression (i.e. within minutes after stress application)

comprise early wound response genes. This last group of

genes encodes components of the JA-mediated wound

response pathway including (pro)systemin and the JA

biosynthetic genes such as LOX, AOS, AOC and OPR3

(Ryan 2000, Wasternack and Hause 2002, Howe 2004,

Schilmiller and Howe 2005). All previously reported

examples of JA- and wound-induced gene expression in

tobacco are clearly late responses (appearing within a few

hours) and correspond to the wound-induced transient

increase in JA content within 1 h (Wasternack et al. 1996).

According to Fig. 2, the JA-induced accumulation of

Nictaba, however, appears very late, with maximal lectin

levels after 2 d. Apparently, the inductor needs to be present

at sufficiently high concentrations for a certain time period

in order for the lectin expression to be switched on. This

may explain why no treatment other than JA or JAME

results in Nictaba accumulation. Some of the treatments

tested, such as mechanical wounding, are known to provoke

a transient rise of jasmonates within 1 h of treatment to

levels in the nanomolar range per gram FW (Kenton et al.

1999a, Mur et al. 2006). Obviously, this level of JA is

insufficient for Nictaba accumulation.

The highest lectin levels as a response to JA and JAME

treatment were found in the expanding tobacco leaves,

suggesting a developmental and/or defense-related lectin

induction. Consistent with this hypothesis is our observa-

tion that Nictaba is not only induced by jasmonates but also

after caterpillar attack of larvae of the (polyphagous) cotton

leafworm S. littoralis. Though the amount of lectin induced

in damaged leaves after insect feeding is lower than in

tobacco leaves treated with JAME, insect herbivory

definitely induces the synthesis of Nictaba. It was shown

that exposure of tobacco leaves to insect herbivory for 3 h

resulted in detectable levels of lectin activity, whereas

approximately 15 h herbivory was needed to achieve

maximal expression levels. It should be noted that insect

feeding generates a lower internal JA concentration in the

treated leaf compared with floating of a leaf on a JA/JAME

solution. This lower JA concentration could be responsible

for the lower expression levels of Nictaba.

The JA pathway is known to play a central role in the

plant’s response to insect herbivory. Chewing insects such

as caterpillars cause extensive cellular disruption, which

plays an important role in plant perception of these

herbivores. In the last decade it was shown that insect

herbivory has an additional effect on the plant’s response

compared with mechanical wounding of the plant tissue

(Reymond et al. 2000, Walling 2000). Importantly, insect

feeding causes a larger increase in JA than wounding alone.

In addition, insect oral secretions modulate plant

transcript profiles and induce expression of a distinct set

of genes as well as synthesis and release of different volatiles

(Korth and Dixon 1997, Kessler and Baldwin 2002, Ferry

et al. 2004, Lawrence and Novak 2004). Possibly some

compounds in the insect saliva are also required for the

induction of lectin synthesis.

Another possible explanation is that—as is suggested

by the experiments shown in Figs. 2 and 6—the exposure

time to JAME must surpass a threshold value before lectin

Jasmonate-induced expression of tobacco lectin 1213

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

synthesis is turned on. Consistent with this are the

reports that herbivory feeding or herbivore regurgitant

often cause larger increases in JA and in wound-response

gene mRNAs than wounding alone (Walling 2000), and

that time and intensity of insect feeding are important,

independent of the chemicals present in the insect saliva

(Mithofer et al. 2005). Similar to Nictaba, the expression of

the hevein-like protein of Arabidopsis was also shown to be

induced by insect feeding but not by mechanical wounding

(Reymond et al. 2000).

Jasmonate-dependent signaling may also be influenced

by metabolic transformation of jasmonates. As shown in

Table 1, a remarkable portion of JAME is cleaved,

presumably by an esterase (Stuhlfelder et al. 2004), whereas

JAME might be formed upon JA treatment due to the

presence of a JA-specific methyltransferase (Seo et al. 2001).

We found an equilibrium of 80% JA and 20% JAME in

plants such as tobacco and tomato (O.M., unpublished

results). The need for a threshold level of JAME for Nictaba

induction is supported by the fact that in detached leaves

the lectin accumulates exclusively at the site of JAME

application (Fig. 3). In contrast, a systemic induction of

Nictaba was observed in whole plants (Fig. 4). In recent

years, several reports have shown evidence that jasmonates

are transported in the plant (Baldwin et al. 1997, Zhang and

Baldwin 1997, Schilmiller and Howe 2005, Thorpe et al.

2007). Recent experiments have clearly shown that labeled

JAME is taken up in N. tabacum leaves and moves in both

phloem and xylem pathways (Thorpe et al. 2007). The lower

lectin content in the first leaf above the treated leaf can

result from the lack of vascular connectivity between leaves

in opposite orthostichies (Orians et al. 2000, Orians, 2005).

However, Thorpe et al. (2007) have shown that the volatile

JAME can also move between non-orthostichous vascular

pathways. They could rule out the possibility that the

JAME observed in the systemic leaves is the result of

volatile release by other parts of the plant. Taking all these

results together, it seems more likely that systemic induction

of Nictaba in tobacco leaves is mediated by a signal

traveling within the plant rather than the volatile JAME

acting through the atmosphere.

Unlike JA and JAME, the JA derivative 12-OH-JA

fails to induce Nictaba. This is in agreement with previous

observations that not all activities associated with JA

are shared by its metabolites. For example, both JA and

12-OH-JA induce tuber formation in potato (Koda et al.

1991), but only JA and its amino acid conjugates and not

12-OH-JA induce the expression of jasmonate-induced

proteins JIP-23 and JIP-6 (Miersch et al. 1999). We have

shown that although the levels of both JA and 12-OH-JA

accumulate 3- to 5-fold within the leaf attacked by

S. littoralis (Table 1), only JA induced expression of

Nictaba. As expected, JAME treatment led to a high

JA content presumably by the activity of an esterase

(Stuhlfelder et al. 2004). The dramatic increase in

12-OH-JA levels following JAME treatment, but lack of

lectin accumulation following 12-OH-JA treatment (Fig. 1),

is consistent with some data recently obtained with tomato.

In tomato, a JA-dependent 12-OH-JA formation was

observed, which blocked JA-induced gene expression

(O. Miersch et al., in preparation). Obviously, the forma-

tion of 12-OH-JA is a mechanism to halt JA signaling.

Nictaba is not the first lectin induced by jasmonates.

Other jasmonate-inducible lectins have been reported

such as the myrosinase-binding proteins from Arabidopsis

and Brassica species (Geshi and Brandt, 1998), the

mannose-specific lectin from Helianthus tuberosus callus

(Nakagawa et al. 2003) and some jacalin-related lectins in

Poaceae species (Van Damme et al. 2004c). However,

the jasmonate-induced accumulation of Nictaba clearly

differs from that of the jacalin-related lectins. The presumed

jasmonate-induced Brassica napus myrosinase-binding

proteins are also formed (albeit at a lower level) in the

absence of jasmonate (Geshi and Brandt 1998), whereas

mannose-binding jacalins in cereals such as wheat, barley,

rice and maize are not exclusively induced by jasmonates

but also by other stress factors (e.g. salt stress, intense light,

ABA) (Van Damme et al. 2004c).

At present we can only speculate about the physiolog-

ical role of the tobacco lectin in the plant. In view of the

localization pattern showing an accumulation of Nictaba at

the nuclear rim, it has been hypothesized that Nictaba

might play a role in transport of molecules in and out of the

nucleus. It can be envisaged that Nictaba is able to interact

with, for example, glycosylated nucleoporins located in the

nuclear envelope. Evidence for the interaction of Nictaba

with nuclear tobacco proteins was recently obtained

from Far Western blots which clearly demonstrated that

Nictaba reacts in a GlcNAc oligomer-inhibitable manner

with numerous proteins present in a crude extract from

purified nuclei (Lannoo et al. 2006b). This, taken together

with the nucleocytoplasmic location and the induction by

jasmonate, strongly argues for a specific role for Nictaba in

jasmonate-inducible or jasmonate-dependent physiological

processes (Chen et al. 2002, Van Damme et al. 2004a).

In order to obtain better insight into the physiological

role of these lectins, future experiments should aim at

the characterization of the interactors for these lectins

in the plant. In view of the induced lectin accumulation

after insect attack, the insecticidal properties of the lectin

as well as the lectin receptors in the insect body will

also be investigated in more detail. In this respect it is

interesting to note that several herbivore- and JA-

inducible proteins occur in the midgut of herbivores

and can act in a synergistic manner (Chen et al. 2005,

Chen et al. 2007).

1214 Jasmonate-induced expression of tobacco lectin

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

Materials and Methods

Plant material and growth conditions

Tobacco (N. tabacum L. cv Samsun NN) seeds werepurchased from Lehle Seeds (Round Rock, TX, USA). Prior touse, seeds were surface sterilized with 70% (v/v) ethanol for 2min,7% (v/v) NaOCl for 10min, and extensively washed with sterilewater. To establish an in vitro culture, seeds were germinated onsolid Murashige and Skoog (MS) medium containing 4.3 g l–1 MSmicro- and macronutrients containing vitamins (Duchefa,Haarlem, The Netherlands), 30 g l–1 sucrose, pH 5.7 (adjustedwith 0.5M NaOH) and 8 g l–1 plant agar (Duchefa). Aftergermination, plants were transferred to MS medium containing2.15 g l–1 micro- and macronutrients containing vitamins. Plantswere kept in a growth chamber at 258C, 70% relative humidityand a 16 h photoperiod, and propagated through cuttings every6–7 weeks. For the production of in vivo grown plants, seeds weregerminated in Petri dishes filled with pot soil. After the appearanceof the cotyledons and first leaves, plantlets were transferred tobigger pots filled with pot soil and kept in the greenhouse untilflowering.

Plant hormones, hormone-releasing and abiotic compounds

JA, GA3, SA, IAA (all from Duchefa), JAME (Sigma,St Louis, MO, USA), 12-OH-JA (a gift of T. Yoshihara, Sapporo,Japan) and ABA (Acros Organics, Geel, Belgium) were firstdissolved in a small volume of absolute ethanol and subsequentlydiluted with water to the desired concentrations. BA (AcrosOrganics) was dissolved in 100% dimethylsulfoxide (DMSO) andafterwards diluted with water. Ethephon (from Acros Organics)was directly dissolved in water. Concentrations that weretested were as follows: 25–250 mM JAME; 25–250 mM JA;25–150 mM 12-OH-JA; 100–1,000 mM SA; 10–100 mM GA3, IAA,ABA or BA, and 0.0025% (v/w) ethephon. Standard [2H5]OPDAwas prepared from [17-2H2,18-2H3]linolenic acid according toZimmerman and Feng (1978) and 12-(D3)OAc-JA from 12-OH-JAby esterification by a mixture of pyridine/deuterated acetic acidanhydride (2 : 1).

For wounding experiments, leaves were either rubbed withcarborundum powder, cut in pieces or clipped. Alternatively,small punctures were made with a needle. Salt stress was applied byfloating leaves on 0.1 and 0.5M NaCl solutions. For heat and coldshock, plants were incubated for 1 h at 37 or 48C, respectively.The effect of UV light was tested by treating plants for 1 h with UV(at 258C). For all stress treatments, leaf extracts were prepared 3 dafter the experiment.

Induction experiments with excised leaves

Unless stated otherwise, leaves were cut from 6- to 8-week-oldtobacco plants (grown in vitro or in the greenhouse) andtransferred to Petri dishes (90mm diameter) filled with 15ml of asolution of the test compounds or an appropriate control solution(water or diluted DMSO). Incubation was performed at 258Cunder constant light for different time periods. After incubation,leaves were extensively washed with distilled water and blotted dry.Leaves were either used immediately for total RNA and proteinpurification or frozen at �808C until use.

Treatment of plants with JAME through the gas phase

Plants destined for in planta induction experiments weregrown in a greenhouse for 4–16 weeks. For induction, plants weretransferred into a bag (with a volume of 50 l) of transparent plastic

containing a piece of filter paper on which 100 ml of a 10% solutionof JAME in ethanol was spotted (Chen et al. 2002).JAME treatment was repeated every 24 h for three or fourconsecutive days.

Insect bioassay

Cotton leafworms (S. littoralis Boisduval) were selected froma continuous laboratory culture (Laboratory of Agrozoology,Ghent University, Belgium). Larvae were reared on an artificialdiet under standard conditions of 258C, 65% relative humidity anda 16 h photoperiod as described (Smagghe and Degheele 1994,Smagghe et al. 2005). One insect of the fourth instar was placed onone leaf of a 16-week-old greenhouse-grown tobacco plant. Eachassay was performed in triplicate. After feeding for 12 h, the insectswere removed. Wounded and systemic (untreated) leaves weretested immediately after insect removal for agglutination. The leafmaterial was powdered in liquid nitrogen using a pestle and mortarand stored at �808C for later use. Different samples were analyzedfor Nictaba expression at the RNA level using RT–PCR as well asat the protein level using agglutination assays and Western blots.

Alternatively, one leaf of a tobacco plant was subjected toinsect herbivory for different time periods (3–24 h). The leafmaterial was collected 48 h after the start of the experiment andanalyzed for lectin activity as described above.

Quantification of endogenous jasmonate concentration

Fresh plant material (500mg) was homogenized with 10ml ofmethanol and 100 ng each of [2H6]JA (Miersch 1991), [2H5]OPDAand 12-[2H3]OAc-JA as internal standards. The homogenate wasfiltered under vacuum on a column containing cellulose. The eluentwas evaporated and acetylated with 200 ml of pyridine and 100 mlof acetic acid anhydride at 208C overnight, evaporated, dissolvedin 10ml of methanol and further pre-purified as described byStenzel et al. (2003a). For HPLC separation, fractions at retentiontime (Rt) 9.75–10.75min (12-OAc-JA), 13–14.5min (JA) and21.75–22.5min (OPDA) were combined, and derivatized penta-fluorobenzyl esters were eluted from SiOH cartridges withn-hexane : ether (1 : 1, v/v) and measured by gas chromatog-raphy–mass spectrometry (GC-MS) using the following conditions:100 eV, negative chemical ionization, ionization gas NH3, ionsource temperature 1408C, column Rtx-5w/Integra Guard (Restek,Germany), 5m inert pre-column connected with a 15m� 0.25mmcolumn, 0.25 mm film thickness, cross-bond 5% diphenyl–95%dimethyl polysiloxane, injection temperature 2208C, interfacetemperature 2508C, helium 1mlmin�1, splitless injection and acolumn temperature program of 1min 608C, 258Cmin�1 to 1808C,58Cmin�1 to 2708C, 108Cmin�1 to 3008C. The Rt of pentafluor-obenzyl esters were: [2H6]JA, 11.80min; [2H6]7-iso-JA, 12.24min;JA, 11.86min; 7-iso-JA, 12.32min; 12-[2H3]OAc-JA, 17.16min;12-[2H3]OAc-7-iso-JA, 17.63min; 12-OAc-JA, 17.20min; 12-OAc-7-iso-JA, 17.66min; trans-[2H5]OPDA, 21.29min; cis-[2H5]OPDA,21.93min; trans-OPDA, 21.35min; cis-OPDA, 21.98min.Fragments m/z 209, 215 (standard), m/z 267, 270 (standard)and m/z 291, 296 (standard) were used for the quantification of JA,12-OH-JA and OPDA, respectively.

Isolation of total RNA and cDNA synthesis

Total RNA was extracted from 150mg of powdered leaftissue using the Trizol method (Invitrogen, Carlsbad, CA, USA).Residual DNA was removed using 2U of DNase I (FermentasGMBH, St. Leon-Rot, Germany) in a reaction for 30min at 378C.The RNA concentration was determined using a NanoDrop�

ND-1000 spectrophotometer. Single-stranded cDNA was

Jasmonate-induced expression of tobacco lectin 1215

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

synthesized from 1mg of total RNA using MMLV reversetranscriptase (Invitrogen).

RT–PCR

RT–PCR was performed on single-stranded cDNA using anested PCR with different sets of primers according to Sambrooket al. (1989). Amplification of the Nictaba sequence (Genbankaccession No. AF389848) was achieved using primers evd 42 andevd 43 in a first reaction, and L35 and L36 in a second reaction, asdescribed by Lannoo et al. (2006a). To amplify the tobacco AOCsequence (Genbank accession No. AJ308487), a nested PCR wasperformed using primers evd 231 (50ATGGCCACTGCCTCCTCAGCC30) and evd 232 (50TCAATTAGTGAAATTTTTCAGAGTGGC30) in a first reaction followed by a second PCR using primersevd 246 (50CCCAATCTCTTAAACTCGGC30) and evd247(50CAAGATAAGTGTCCTCGTAAGTC30). As a control forthe RT–PCR, the ribosomal protein L25 (GenBank accessionNo. L18908) was used and amplified using primers evd 282(50TGCAATGAAGAAGATTGAGGACAACA30) and evd 283(50CCATTCAAGTGTATCTAGTAACTCAAATCCAAG30) asdescribed by Volkov et al. (2003). RT–PCR was performed in anAmplitronIIR Thermolyne apparatus (Dubuque, IA, USA) usingTaq polymerase (Invitrogen) according to the manufacturer’sinstructions. For all RT–PCRs, the following program was used:2min at 948C followed by 12–15 cycles of 15 s at 948C, 30 s at 508Cand 60 s at 728C, and a final incubation for 5min at 728C.

Preparation of crude extracts

Leaves were homogenized in 20mM 1,3-propane diamine(5ml buffer per gram FW leaf material) with a mortar and pestle.The homogenates were transferred to centrifuge tubes andcentrifuged at 3,000 g. The supernatants were collected and keptat 48C until use.

Agglutination assay

To check the lectin activity in crude extracts, agglutinationassays with trypsin-treated rabbit erythrocytes were performed inglass tubes by mixing 10 ml of crude extract with 10 ml of 1Mammonium sulfate and 30ml of a 2% solution of rabbiterythrocytes (made up in phosphate-buffered saline containing137mM NaCl, 8mM Na2HPO4�2H2O, 3mM KCl, 1.5mMKH2PO4). Agglutination was assessed visually after 10min atroom temperature. To estimate the lectin content semi-quantita-tively, extracts were serially diluted in 1M ammonium sulfate with2-fold increments. Aliquots of 10ml of the diluted extracts weretransferred into polystyrene 96 U-welled microtiter plates andsupplemented with 40ml of a 2% suspension of trypsin-treatedrabbit erythrocytes. The agglutination reaction was assessedafter incubation for 1 h at room temperature. In each experiment,a dilution series of a Nictaba solution with knownconcentration was included to calculate the absolute lectin contentof the extracts. This semi-quantitative method allowed detectionof lectin concentrations as low as 0.6 mgml�1 with an errorrange512.5%.

Analytical techniques

Crude extracts from leaves were analyzed by SDS–PAGE in15% acrylamide gels as described by Laemmli (1970). Proteinswere visualized by staining with Coomassie brilliant blue orblotted onto polyvinylidene fluoride (0.45 mm) transfer membranes(BiotraceTM PVDF, PALL, Gelman Laboratory, USA). Westernblot analysis was performed using a specific primary antibody

against Nictaba (Chen et al. 2002) and a horseradishperoxidase-coupled goat anti-rabbit IgG (Dako A/S, Denmark)as the secondary antibody. Immunodetection was achievedby a colorimetric assay essentially as described by Wang et al.(2003).

Acknowledgments

This research was supported by project 3G016306 ofthe Fund of Scientific Research (FWO-Vlaanderen,Brussels, Belgium), the Research Council of Ghent University,the IWT-Flanders (SB/51099/Vandenborre) and theDeutsche Forschungsgemeinschaft within the framework ofthe SFB 648 project C2 (C.W. and O.M.). We thankDr. T. Yoshihara (Sapporo, Japan) for the gift of 12-OH-JAmethyl ester.

References

Avdiushko, S., Croft, K.P.C., Brown, C.C., Jackson, D.M., Hamilton-Kemp, T.R. and Hildebrand, D. (1995) Effect of volatile methyljasmonate on the oxylipin pathway in tobacco, cucumber, andArabidopsis. Plant Physiol. 109: 1227–1230.

Baldwin, I.T., Zhang, Z.P., Diab, N., Ohnmeiss, T.E., McCloud, E.S.,Lynds, G.Y. and Schmelz, E.A. (1997) Quantification, correlations andmanipulations of wound-induced changes in jasmonic acid and nicotinein Nicotiana sylvestris. Planta 201: 397–404.

Campbell, E.J., Schenk, P.M., Kazan, K., Penninckx, I.A.M.A.,Anderson, J.P., Maclean, D.J., Cammue, B.P.A., Ebert, P.R. andManners, J.M. (2003) Pathogen-responsive expression of a putativeATP-binding cassette transporter gene conferring resistance to thediterpenoid sclareol is regulated by multiple defense signaling pathwaysin Arabidopsis. Plant Physiol. 133: 1272–1284.

Chen, H., Gonzales-Vigil, E., Wilkerson, C.G. and Howe, G.A. (2007)Stability of plant defense proteins in the gut of insect herbivores.Plant Physiol. 143: 1954–1967.

Chen, H., Wilkerson, C.G., Kuchar, J.A., Phinney, B.S. and Howe, G.A.(2005) Jasmonate-inducible plant enzymes degrade essential aminoacids in the herbivore midgut. Proc. Natl. Acad. Sci. USA 102:19237–19242.

Chen, Y., Peumans, W.J., Hause, B., Bras, J., Kumar, M., Proost, P.,Barre, A., Rouge, P. and Van Damme, E.J.M. (2002) Jasmonicacid methyl ester induces the synthesis of a cytoplasmic/nuclear chitooligosaccharide-binding lectin in tobacco leaves. FASEB J.16: 905–907.

Creelman, R.A. and Mullet, J.E. (1997) Biosynthesis and actionof jasmonates in plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 48:355–381.

Devoto, A. and Turner, L.G. (2005) Jasmonate-regulated Arabidopsis stresssignalling network. Physiol. Plant. 123: 161–172.

Doares, S.H., Narvaez-Vasquez, J., Conconi, A. and Ryan, C.A. (1995)Salicylic acid inhibits synthesis of proteinase inhibitors in tomatoleaves induced by systemin and jasmonic acid. Plant Physiol. 108:1741–1746.

Ferry, N., Edwards, M.G., Gatehouse, J.A. and Gatehouse, A.M.R. (2004)Plant–insect interactions: molecular approaches to insect resistance.Curr. Opin. Biotechnol. 15: 1–7.

Geshi, N. and Brandt, A. (1998) Two jasmonate-inducible myrosinase-binding proteins from Brassica napus L. seedlings with homology tojacalin. Planta 204: 295–304.

Howe, G.A. (2004) Jasmonates as signals in the wound response. J. PlantGrowth Regul. 23: 223–237.

Kenton, P., Mur, L.A.J., Atzorn, R., Wasternack, C. and Draper, J. (1999a)(–)-Jasmonic acid accumulation in tobacco hypersensitive responselesions. Mol. Plant-Microbe Interact. 12: 74–78.

1216 Jasmonate-induced expression of tobacco lectin

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

Kenton, P., Mur, L.A.J. and Draper, J. (1999b) A requirement forcalcium and protein phosphatase in the jasmonate-induced increase intobacco leaf acid phosphatase specific activity. J. Exp. Bot. 50:1331–1341.

Kessler, A. and Baldwin, I.T. (2002) Plant responses to insectherbivory: the emerging molecular analysis. Annu. Rev. Plant Biol. 53:299–328.

Kilpatrick, D.C. (2002) Animal lectins: a historical introduction andoverview. Biochim. Biophys. Acta 1572: 187–197.

Koda, Y., Kikuta, Y., Tazaki, H., Tsujino, Y., Sakamura, S. andYoshihara, T. (1991) Potato tuber-inducing activities of jasmonic acidand related compounds. Phytochemistry 30: 1435–1438.

Korth, K.L. and Dixon, R.A. (1997) Evidence for chewing insect-specificmolecular events distinct from a general wound response in leaves.Plant Physiol. 115: 1299–1305.

Laemmli, U.K. (1970) Cleavage of structural proteins during the assemblyof the head of bacteriophage T4. Nature 227: 680–685.

Lannoo, N., Peumans, W.J. and Van Damme, E.J.M. (2006a) The presenceof jasmonate-inducible lectin genes in some but not all Nicotiana speciesexplains a marked intragenus difference in plant responses to hormonetreatment. J. Exp. Bot. 57: 3145–3155.

Lannoo, N., Peumans, W.J., Van Pamel, E., Alvarez, R., Xiong, T.-C.,Hause, G., Mazars, C. and Van Damme, E.J.M. (2006b) Localizationand in vitro binding studies suggest that the cytoplasmic/nuclear tobaccolectin can interact in situ with high-mannose and complex N-glycans.FEBS Lett. 580: 6329–6337.

Lawrence, S.D. and Novak, N.G. (2004) Maize genes induced by herbivoryand volicitin. J. Chem. Ecol. 30: 2543–2557.

Miersch, O. (1991) Synthesis of (þ/–)-(10-2H,11-2H2,12-2H3)jasmonic acid.

Z. Naturforschung 46b: 1724–1729.Miersch, O., Kramell, R., Parthier, B. and Wasternack, C. (1999) Structure–

activity relations of substituted, deleted or stereospecifically alteredjasmonic acid in gene expression of barley leaves. Phytochemistry 50:353–361.

Mithofer, A., Wanner, G. and Boland, W. (2005) Effects offeeding Spodoptera littoralis on lima bean leaves. II. Continuousmechanical wounding resembling insect feeding is sufficient to elicitherbivory-related volatile emission. Plant Physiol. 137: 1160–1168.

Mur, L.A.J., Kenton, P., Atzorn, R., Miersch, O. and Wasternack, C.(2006) The outcomes of concentration-specific interactions betweensalicylate and jasmonate signaling include synergy, antagonism, andoxidative stress leading to cell death. Plant Physiol. 140: 249–262.

Nakagawa, R., Okumura, Y., Kawakami, M., Yasokawa, D. andNagashima, K. (2003) Stimulated accumulation of lectin mRNAand stress response in Helianthus tuberosus callus by methyl jasmonate.Biosci. Biotechnol. Biochem. 67: 1822–1824.

Niki, T., Mitsuhara, I., Seo, S., Ohtsubo, N. and Ohashi, Y. (1998)Antagonistic effect of salicylic acid and jasmonic acid on the expressionof pathogenesis-related (PR) protein genes in wounded mature tobaccoleaves. Plant Cell Physiol. 39: 500–507.

Orians, C.M. (2005) Herbivores, vascular pathways and systemic induction:facts and artifacts. J. Chem. Ecol. 31: 2231–2242.

Orians, C.M., Pomerleau, J. and Ricco, R. (2000) Vascular architecturegenerates fine scale variation in systemic induction of proteinaseinhibitors in tomato. J. Chem. Ecol. 26: 471–485.

Pena-Cortes, H., Albrecht, T., Prat, S., Weiler, E.W. and Willmitzer, L.(1993) Aspirin prevents wound-induced gene expression intomato leaves by blocking jasmonic acid biosynthesis. Planta 191:123–128.

Peumans, W.J., Barre, A., Hao, Q., Rouge, P. and Van Damme, E.J.M.(2000) Higher plants developed structurally different motifs to recognizeforeign glycans. Trends Glycosci. Glycotechnol. 12: 83–101.

Reymond, P., Weber, H., Damond, M. and Farmer, E.E. (2000)Differential gene expression in response to mechanical wounding andinsect feeding in Arabidopsis. Plant Cell 12: 707–719.

Ryan, C.A. (2000) The systemin signaling pathway: differentialactivation of plant defense genes. Biochim. Biophys. Acta 1477: 112–121.

Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) In Molecular Cloning:A Laboratory Manual, 2nd edn. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, NY.

Schilmiller, A.L. and Howe, G.A. (2005) Systemic signaling in the woundresponse. Curr. Opin. Plant Biol. 8: 369–377.

Seo, H.S., Song, J.T., Cheong, J.-J., Lee, Y.-H., Lee, Y.-W., Hwang, I.,Lee, J.S. and Choi, Y.D. (2001) Jasmonic acid carboxyl methyltransfer-ase: a key enzyme for jasmonate-regulated plant responses. Proc. Natl.

Acad. Sci. USA 98: 4788–4793.Sharon, N. and Lis, H. (2004) History of lectins: from hemagglutinins

to biological recognition molecules. Glycobiology 14: 53R–62R.Smagghe, G. and Degheele, D. (1994) Action of a novel nonsteroidal

ecdysteroid mimic, tebufenozide (RH-5992), on insects of differentorders. Pestic. Sci. 42: 85–92.

Smagghe, G., Vanhassel, W., Moeremans, C., De Wilde, D., Goto, S.,Loeb, M.J., Blackburn, M.B. and Hakim, R.S. (2005) Stimulationof midgut stem cell proliferation and differentiation by insect hormonesand peptides. Ann. NY Acad. Sci. 1040: 472–475.

Stenzel, I., Hause, B., Maucher, H., Pitzschke, A., Miersch, O., Ziegler, J.,Ryan, C. and Wasternack, C. (2003a) Allene oxide cyclase dependenceof the wound response and vascular bundle specific generation ofjasmonates in tomato—amplification in wound-signalling. Plant J. 33:577–589.

Stenzel, I., Hause, B., Miersch, O., Kurz, T., Maucher, H., Weichert, H.,Ziegler, J., Feussner, I. and Wasternack, C. (2003b) Jasmonatebiosynthesis and the allene oxide cyclase family of Arabidopsis thaliana.Plant Mol. Biol. 51: 895–911.

Stuhlfelder, C., Muller, M.J. and Warzecha, H. (2004) Cloning andexpression of a tomato cDNA encoding a methyl jasmonate cleavingesterase. Eur. J. Biochem. 271: 2976–2983.

Takahashi, H., Kanayama, Y., Zheng, M.S., Kusano, T., Hase, S.,Ikegami, M. and Shah, J. (2004) Antagonistic interactions between theSA and JA signaling pathways in Arabidopsis modulate expression ofdefense genes and gene-for-gene resistance to cucumber mosaic virus.Plant Cell Physiol. 45: 803–809.

Thorpe, M.R., Ferrieri, A.P., Herth, M.M. and Ferrieri, R.A. (2007)11C-imaging: methyl jasmonate moves in both phloem and xylem,promotes transport of jasmonate, and of photoassimilate even afterproton transport is decoupled. Planta 226: 541–551.

Van Damme, E.J.M., Barre, A., Rouge, P. and Peumans, W.J. (2004a)Cytoplasmic/nuclear plant lectins: a new story. Trends Plant Sci. 9:484–489.

Van Damme, E.J.M., Lannoo, N., Fouquaert, E. and Peumans, W.J.(2004b) The identification of inducible cytoplasmic/nuclear carbohy-drate-binding proteins urges to develop novel concepts about the role ofplant lectins. Glycoconjugate J. 20: 449–460.

Van Damme, E.J.M., Peumans, W.J., Barre, A. and Rouge, P. (1998) Plantlectins: a composite of several distinct families of structurally andevolutionary related proteins with diverse biological roles. Crit. Rev.Plant Sci. 17: 575–692.

Van Damme, E.J.M., Rouge, P. and Peumans, W.J. (2007) Carbohydrate–protein interactions: plant lectins. In Comprehensive Glycoscience—From Chemistry to Systems Biology. Edited by Kamerling, J.P., Boons,G.J.. Lee, Y.C., Suzuki, A., Taniguchi, N., and Voragen, A.G.J. Elsevier,New York, in press.

Van Damme, E.J.M., Zhang, W. and Peumans, W.J. (2004c) Induction ofcytoplasmic mannose-binding jacalin-related lectins is a commonphenomenon in cereals treated with jasmonate methyl ester. Commun.

Agric. Appl. Biol. Sci. 69: 23–31.Volkov, R.A., Panchuk, I.I. and Schoffl, F. (2003) Heat-stress-dependency

and developmental modulation of gene expression: the potential ofhouse-keeping genes as internal standards in mRNA expression profilingusing real-time RT–PCR. J. Exp. Bot. 54: 2343–2349.

Walling, L.L. (2000) The myriad plant responses to herbivores. J. PlantGrowth Regul. 19: 195–216.

Wang, W., Hause, B., Peumans, W.J., Smagghe, G., Mackie, A., Fraser, R.and Van Damme, E.J.M. (2003) The Tn-antigen specific lectinfrom ground ivy is an insecticidal protein with an unusual physiology.Plant Physiol. 132: 1322–1334.

Wasternack, C. (2006) Oxylipins: biosynthesis, signal transductionand action. In Plant Hormone Signaling, Annual Plant ReviewsEdited by Hedden, P. and Thomas, SG pp. 185–228. BlackwellPublishing Ltd, Oxford, UK.

Jasmonate-induced expression of tobacco lectin 1217

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from

Wasternack, C., Atzorn, R., Pena-Cortes, H. and Parthier, B. (1996)Alteration of gene expression by jasmonate and ABA in tobacco andtomato. J. Plant Physiol. 147: 503–510.

Wasternack, C. and Hause, B. (2002) Jasmonates and octadecanoids:signals in plant stress responses and development. Prog. Nucleic Acid Res.72: 165–221.

Zhang, A.-P. and Baldwin, I.T. (1997) Transport of [2-14C]jasmonicacid from leaves to roots mimics wound-induced changes in endogenousjasmonic acid pools in Nicotiana sylvestris. Planta 203: 436–441.

Zimmerman, D.C. and Feng, P. (1978) Characterization of a prostaglandin-like metabolite linolenic acid produced by a flaxseed extract. Lipids 13:313–316.

(Received June 2, 2007; Accepted July 7, 2007)

1218 Jasmonate-induced expression of tobacco lectin

at Ghent U

niversity on August 31, 2012

http://pcp.oxfordjournals.org/D

ownloaded from