The involvement of the TNF-alpha system in skeletal muscle in …umu.diva-portal.org/smash/get/diva2:1157408/FULLTEXT01.pdf · 2017. 11. 15. · Professor Rob Swatski. Fig 2 is based

The involvement of the TNF-alpha

system in skeletal muscle in response to marked overuse

Lina Renström

Department of Integrative Medical Biology, Anatomy

Department of Community Medicine and Rehabilitation, Sports Medicine

Umeå 2017

Copyright © 2017 Lina Renström Responsible publisher under Swedish law: The Dean of the Faculty of Medicine This work is protected by Swedish Copyright Legislation (Act 1960:729) New Series Number 1932 ISSN 0346-6612 ISBN: 978-91-7601-802-6 Electronic version available at http://umu.diva-portal.org Printed by: Print and Media, Umeå University Umeå, Sweden, November, 2017 The original articles were reproduced with permission from the publishers Figures 1 and 2 are illustrated by Ida Renström. Fig 1 is based on illustration by assoc. Professor Rob Swatski. Fig 2 is based on a picture in the article by dos Santos and collaborators (Dos Santos et al., 2009) Figure 3 is reprinted from Doctoral Thesis by Yafeng Song “Cross transfer effects after unilateral muscle overuse”, Umeå University 2013. Illustration by Gustav Andersson Figure 4 is reprinted from Doctoral Thesis by Ludvig Backman “Neuropeptide and catecholamine effects on tenocytes in tendinosis development”, Umeå University 2013. Illustration by Gustav Andersson Figures 5 and 7-10 are originally printed for a student essay published in DiVA, “Comparisons between cytokine (TNF-alpha) and neuropeptide (NPY) receptors in overused and inflamed skeletal muscle”, by Lina Renström, never published outside Umeå University Figure 13 and 14 are adapted from the study IV (Spang et al, J Musculoskelet Neuronal Interact, 2017 17(3)226-236). They are reprinted with kind permission of the publisher

All we have to decide is what to do with

the time that has been given to us

- Gandalf the Grey

To Jocke, my parents and my sisters

i

Table of Contents

Abstract ............................................................................................ iii

Abbreviations ................................................................................... iv

List of original papers ....................................................................... v

Populärvetenskaplig sammanfattning ............................................. vi

Introduction ....................................................................................... 1 Muscle and tendon ........................................................................................................... 1

Muscle tissue ............................................................................................................... 1 Muscle tissue plasticity ............................................................................................. 4 The triceps surae muscle in humans ........................................................................ 4 The plantaris muscle in humans .............................................................................. 4 Tendon tissue .............................................................................................................. 5 The Achilles tendon in humans .................................................................................. 5 The plantaris tendon in humans .............................................................................. 6 Extensor origin of the wrist ....................................................................................... 7 Connective tissue in relation to tendons/muscle origins; Peritendinous tissue .... 8

Rabbit muscle and tendon ............................................................................................... 8 Rabbit triceps surae muscle ...................................................................................... 8 Rabbit Achilles tendon ............................................................................................. 10

Myopathies and tendinopathies ..................................................................................... 10 Skeletal muscle injury .............................................................................................. 10 Muscle inflammation (myositis) ............................................................................. 11 Models for studying muscle damage/myositis ...................................................... 11 Idiopathic inflammatory myopathy ....................................................................... 12

Tendinopathy and tendinosis ......................................................................................... 13 Achilles tendinosis .................................................................................................... 14 Lateral epicondylitis/Tennis elbow ........................................................................ 14 Peritendinous tissue in tendinopathy ..................................................................... 15

TNF-alpha system ........................................................................................................... 15 TNF-alpha ................................................................................................................. 15 TNF receptors ........................................................................................................... 16 The actions of TNF-alpha via TNFR1 and TNFR2 ................................................. 16 TNF-alpha and muscle and tendon tissue .............................................................. 17 TNF-alpha in relation to nerve tissue ..................................................................... 18

Rheumatoid Arthritis and TNF-alpha ........................................................................... 18 Other signal substances in parallel to TNF-alpha ......................................................... 19 Why study the TNF-alpha system .................................................................................. 19

Aim .................................................................................................. 21

Materials and Methods ................................................................... 22 Obtaining of rabbit muscle tissue ................................................................................. 22

Animals .................................................................................................................... 22 Experimental design ............................................................................................... 23

ii

Obtaining of human tissue ............................................................................................ 24 Patients .................................................................................................................... 24 Surgery for Achilles/plantaris tendinopathy ........................................................ 24 Surgery for tennis elbow ........................................................................................ 25 Reference tissue from RA synovium ...................................................................... 25

Fixation and sectioning ................................................................................................. 25 Rabbit muscle tissue ................................................................................................ 25 Human tissue ........................................................................................................... 25

Staining for morphology ................................................................................................ 26 In situ hybridization ...................................................................................................... 26 Immunohistochemistry .................................................................................................. 27

Control stainings ..................................................................................................... 29 Double staining ....................................................................................................... 29 Identification of neuromuscular junctions and cell nuclei ................................... 30

Visualizing of the results ............................................................................................... 30 Quantification ................................................................................................................ 30 Ethics for rabbit studies ................................................................................................. 31 Ethics for human studies ................................................................................................ 31

Results ............................................................................................ 32 Rabbit muscle tissue (I-III) ........................................................................................... 32

Morphology ............................................................................................................. 32 Bilateral involvement as seen morphologically .................................................... 33 In situ hybridization (ISH) ..................................................................................... 33 Immunohistochemistry (IHC) ................................................................................ 34

Human tissue samples (IV) ........................................................................................... 38 Dispersed cells ......................................................................................................... 38 Nerve fascicles ......................................................................................................... 39 Blood vessel walls .................................................................................................... 40

Discussion ........................................................................................ 41 Major findings ................................................................................................................. 41 Strengths, limitations and methodological considerations ......................................... 42 TNF-alpha in relation to the inflammatory process..................................................... 43 TNF-alpha in relation to damage and reparation of muscle fibers ............................. 43 TNF-alpha in relation to nerve influences .................................................................... 44 TNF-alpha in relation to substance P ........................................................................... 45 TNFR2 at neuromuscular junctions ............................................................................. 45 Findings of nerve influences concerning the TNF-alpha system bilaterally ............... 45 TNF-alpha in relation to the blood vessels ................................................................... 46 What about anti-TNF treatment? Should instead substances be given with TNF-alpha

agonistic effects? ............................................................................................................ 46 Concluding remarks ...................................................................................................... 48

Acknowledgements ......................................................................... 49

Funding ............................................................................................ 51

References ...................................................................................... 52

iii

Abstract

Painful conditions having the origin within the musculoskeletal system is a common cause

for people to seek medical care. Between 20-40% of all visits to the primal care in Sweden

are coupled to pain from the musculoskeletal system. Muscle pain and impaired muscle

function can be caused by muscles being repetitively overused and/or via heavy load.

Skeletal muscle is a dynamic tissue which can undergo changes in order to fulfill what is

best for optimal function. However, if the load is too heavy, morphological changes

including necrosis, as well as pain can occur. The extension of the skeletal muscle is the

tendon. Tendinopathy refers to illness and pain of the tendon. The peritendinous tissue is

of importance in the features related to tendon pain. Common tendons/origins being

afflicted by tendinopathy/pain are the Achilles tendon and the extensor origin at the elbow

region.

Tumor necrosis factor alpha (TNF-alpha) is a cytokine that is involved in several

biological processes. It is well-known for its involvement in the immune system and is an

important target for inflammatory disorders such as rheumatoid arthritis. It is not known

to what extent the TNF-alpha system is involved in the process of muscle inflammation

and damage due to overuse.

Studies were conducted on rabbit and human tissue, tissues that either had undergone

an excessive loading activity or tissue that was removed with surgery due to painful

conditions. The tissues were evaluated via staining for morphology, in situ hybridization

and immunofluorescence.

Unilateral experimental overuse of rabbit muscle (soleus muscle) led to morphological

changes in the soleus muscle tissue bilaterally. The longer the experiment extended, the

more was the tissue affected. This included infiltration of white blood cells in the tissue

(myositis) and abnormal muscle fiber appearances. TNF-alpha mRNA was seen in white

blood cells, in muscle fibers interpreted to be in a reparative stage and in white blood cells

that had infiltrated into necrotic muscle fibers. There was an upregulation in expressions

of TNF receptor type 1 (TNFR1) and TNF receptor type 2 (TNFR2) in muscles that were

markedly overused, with expressions in white blood cells, fibroblasts, blood vessel walls

and muscle fibers. Immunoreactions for the receptors were seen in nerve fascicles of

markedly overused muscles but only occasionally in normal muscles. The upregulations

were seen for both experimental and contralateral sides. Overall the two receptors showed

somewhat different expression patterns. Tendinopathy is associated with an increase in

blood flow and infiltration of white blood cells in the tissue adjacent to the tendon. It is

called the peritendinous tissue and is also richly innervated. The white blood cells and the

blood vessels walls in this tissue were showing immunoreaction for TNFR1 and TNFR2.

Two types of nerve fascicles were found in this tissue, one normally appearing when

staining for nerve markers and one type with signs of axonal loss. The latter had clearly

strong immunoreactions for TNFR1 and TNFR2.

The findings suggest that the TNF-alpha system is involved in both myopathies occurring

due to overuse and in features in the peritendinous tissue in the tendinopathy situation.

TNF-alpha and its receptors seem to be involved in degeneration but also in regeneration

and healing of the tissue. The findings also suggest that TNF-alpha has effects on nerves

showing axonal loss. The changes in the TNF-alpha system were seen both on the

experimental side and contralaterally.

iv

Abbreviations

ACE Angiotensin converting enzyme ACh Acetylcholine βIII-tubulin Beta-III-tubulin β-actin Beta-actin BSA Bovine serum albumin Cap Captopril CK Creatine kinase DIG Digoxigenin DM Dermatomyositis DMD Duchenne muscular dystrophy ECRB Extensor carpi radialis brevis FITC Fluorescein isothiocyanate H&E Haematoxylin & Eosin IBM Inclusion-body myositis IHC Immunohistochemistry IIM Idiopathic inflammatory myopathies IL-1 Interleukin 1 IL-6 Interleukin 6 IR Immunoreaction ISH In situ hybridization KMnO4 Potassium permanganate LT Lymphotoxin MAPK Mitogen-activated protein kinase

NaCl Sodium chloride NF-κB Nuclear Factor kappa-light-chain-enhancer of activated B cells NK-1R Neurokinin 1 receptor (Tachykinin/Substance P receptor) NMJ Neuromuscular junction OCT Optimal cutting temperature Pax-7 Paired box protein Pax-7 PBS Phosphate-buffered saline PM Polymyositis RA Rheumatoid arthritis RRX Rhodamine Red X S-100β S100 calcium binding protein β SP Substance P Th DL-Thiorphan TNF-alpha Tumour Necrosis Factor alpha TNFR1 Tumour Necrosis Factor Receptor type 1 TNFR2 Tumour Necrosis Factor Receptor type 2 TRITC Tetramethylrhodamine US Ultrasound

v

List of original papers

1. TNF-alpha in the Locomotor System beyond Joints: High Degree of Involvement in Myositis in a Rabbit model. Forsgren S, Renström L, Purdam C, Gaida, J.E. International Journal of Rheumatology. 2012: Article ID 637452, doi:10.1155/2012/637452

2. TNF-alpha in an Overuse Muscle Model – Relationship to Muscle Fiber Necrosis/Regeneration, the NK-1 Receptor and an Occurrence of Bilateral Involvement Renström L, Song Y, Stål P.S, Forsgren S Journal of Clinical and Cellular Immunology 2013: 4(2): doi.org/10.4172/2155-9899.1000138

3. Bilateral muscle fiber and nerve influences by TNF-alpha in response to unilateral muscle overuse – Studies on TNF receptor expressions Renström L, Song Y, Stål P.S, Forsgren S BMC Musculoskeletal Disorders 2017: Accepted

4. Marked expression of TNF receptors in human peritendinous tissues including in nerve fascicles with axonal damage – Studies on tendinopathy and tennis elbow Spang C, Renström L, Alfredson H, Forsgren S Journal of Musculoskeletal and Neuronal Interactions 2017: 17(3): 226-236

vi

Populärvetenskaplig sammanfattning

Smärta och funktionsbortfall från rörelseapparaten är vanligt förekommande.

Mellan 20-40% av alla besök i primärvården är kopplade till smärta från

rörelseapparaten. Det är också en vanlig orsak till sjukfrånvaro.

Överansträngning inklusive repetitivt enformigt muskelarbete kan leda till

muskelsmärta och bristande muskelfunktion (ex nedsatt styrka och uthållighet,

inskränkt rörlighet). Muskelvävnad är en dynamisk vävnad som kan ändras

utefter vilka påfrestningar den utsätts för och därigenom vilka behov den ställs

inför. Men om belastningen blir för hård, alternativt återhämtningen blir för kort,

kan negativa förändringar i vävnadsstrukturen uppstå, inklusive celldöd och

vävnadsskada.

Förlängningen av muskeln är senan. Senan är den vävnad som förbinder muskeln

med skelettet. Tendinopati innefattar smärtsamma sjukdomstillstånd i senan.

När sjukdom i en sena uppstår, exempelvis en smärtande hälsena, har man sett

att den lösa bindväven som omger senan är av betydelse. Den genomgår

morfologiska förändringar och man tror att det är den som är med och bidrar till

smärtan vid tillståndet. Akillessenan och ”tennis-armbåge” är vanliga ställen för

tendinopati. Akillessenan förbinder den trehövdade vadmuskeln med hälbenet.

Tennis-armbåge omfattar ett område för flera musklers ursprung vid armbågen.

Dessa muskler ansvarar framför allt för att sträcka i handleden.

TNF-alfa är en signalsubstans som är involverad i flertalet biologiska processer.

Den är känd för sin del i immunförsvaret och den är ett viktigt mål för behandling

av autoimmuna sjukdomar som exempelvis reumatoid artrit. Det är inte känt om

TNF-alfa är inblandad i processen som uppstår vid muskel-

inflammation/muskelskada efter kraftig överansträngning. TNF-alfa har flera

receptorer, i det här arbetet har utbredning av TNFR1 och TNFR2 analyserats.

Studier har utförts på djur (kaniner) och människa. Kaniner har genomgått ett

träningsexperiment, där de utsatts för repetitiva muskelkontraktioner som lett

till överansträngningsskador och muskelinflammation. Den muskel som

studerats är soleus-muskeln, en del i den trehövdade vadmuskeln.

Vävnadsprover har tagits från patienter med smärta i Akillessenan eller tennis-

armbåge. Vävnadsproverna från kanin och människa har analyserats med

färgningar för morfologi, immunohistokemi för detektering av TNF-alfa och dess

receptorer samt för in situ hybridisering för detektion av mRNA i TNF-alfa

systemet. Parallellt med färgningar för faktorerna i TNF-alfa systemet har uttryck

för andra faktorer studerats.

vii

Ensidig överbelastning hos kaniner ledde till samma morfologiska förändringar

på båda sidor, det vill säga även i muskeln i det ben som inte hade genomgått

träningsexperimentet. Ju längre experimentet pågick, desto större blev de

morfologiska förändringarna. TNF-alfa sågs i vita blodkroppar, TNF-alfa mRNA

sågs även i förändrade muskelfibrer. Resultatet av parallella dubbelfärgningar

tolkades som att dessa muskelfibrer antingen var i en regenererande process eller

i en destruktiv process. TNFR1 och TNFR2 uttrycktes i större utsträckning ju

längre experimentet pågick och ju mer muskelvävnaden var påverkad av

inflammation. TNF receptorer sågs i vita blodkroppar, fibroblaster, muskelfibrer

och nervstrukturer hos experimentdjuren. Det såg lika ut på båda sidor, inklusive

det ben som inte ingått i experimentet. De två receptorerna skilde sig åt i uttryck.

Vävnad från patienter med smärtande senor/smärta vid muskelursprungs-region

genomgick också färgningar för faktorer i TNF-alfa systemet. Man kunde se att

den lösa bindväven runt senan (den peritendinösa vävnaden) innehöll mycket

blodkärl och nerver. De nerver som sågs i denna vävnad var av två typer, en som

såg normal ut och en typ som uppvisade tecken på förlust av axoner. Den senare

varianten hade en tydlig uppreglering av båda TNF receptorerna.

Dessa resultat tyder på att TNF-alfa systemet är involverat i muskelsjukdomar

som rör muskelinflammation till följd av kraftig överansträngning och i

processerna i bindväven vid smärtande senor. TNF-alfa och dess receptorer

verkar vara inblandade i både nedbrytning och uppbyggnad av muskelvävnad,

samt påverka nerver som visar tecken på förlust av axoner. Förändringarna i

TNF-alfa systemet sågs både på experimentsidan och kontralateralt.

1

Introduction

Muscle and tendon

Muscle tissue

Skeletal muscle has its name because it most often moves bones. Skeletal muscle

tissue is striated, containing repetitive functional units of sarcomeres. It is

controlled by neurons from the somatic part of the nervous system.

Muscle tissue consists of lots of muscle fibers. A muscle fiber has several nuclei

and many organelles such as mitochondria and myofibrils. The myofibrils within

the muscle fiber are the force generator. Within the myofibrils there are several

sarcomeres which are responsible for the contraction of the muscle. The

sarcomere is built of filaments, mainly myosin, actin, troponin and tropomyosin.

The muscle fiber is surrounded by a thin layer of connective tissue, the

sarcolemma. Outside the sarcolemma is the endomysium. A group of muscle

fibers is surrounded by the perimysium and creates a muscle fascicle. Between

the muscle fibers, there are satellite cells and capillaries. Several muscle fascicles

create the skeletal muscle. The muscle is, usually togheter with other muscles,

surrounded by connective tissue, called the fascia.

Skeletal muscle fibers are formed by fusion of several myoblasts (Capers, 1960,

Mauro, 1961), each with one cell nucleus. That is why a myocyte (muscle fiber)

contains multiple nuclei, known as myonuclei. This is one thing that distinguishes

a skeletal muscle fiber from cardiac and smooth muscle fibers, the two latter

having only one cell nucleus. Skeletal muscle fibers can have over hundred nuclei

(Bruusgaard et al., 2003). Myoblasts that do not fuse into myocytes form satellite

cells and remain quiescent until the need of muscle repair and regeneration

occurs (Schultz et al., 1978). With activation, the satellite cells can re-enter the

cell cycle to proliferate and differentiate into myoblasts (Moss and Leblond,

1970). Therefore, satellite cells are to be considered as monopotent myogenic

stem cells (Collins et al., 2005). Almost all of the muscle cell nuclei are placed in

the outer part of the muscle fiber, beneath the sarcolemma (Cadot et al., 2015).

In mature normal muscle tissue, only a few percent of the nuclei are located

internally; internal nuclei. What is interesting is that in muscle regeneration and

several muscle disorders the nuclei become placed centrally, and the number of

internal nuclei becomes increased (Cadot et al., 2015).

2

Figure 1. Organization of skeletal muscle. A transection of a fascicle visualize the

perimysium, endomysium, muscle fiber with somatic motor neuron, capillaries and

myonuclei.

3

The nerve supply to skeletal muscles is from myelinated motor nerves,

myelinated and non-myelinated sensory nerves and non-myelinated efferent

autonomic nerves. An axon of a motor fiber divides into small branches after

entering the muscle and reaches several muscle fibers. The sensory nerves are

responsible for sending information about body position and refine the control of

muscle in normal situations, but can also signal for pain. The efferent autonomic

nerves have effects on constriction and dilatation of vessels. The connection

between the motor neuron and the muscle fiber is the neuromuscular junction

(NMJ). The NMJ is composed of several cell types; Schwann cells, endings of

motor neurons and the associated part of the muscle fiber. Between the motor

neuron and the muscle fiber is the synaptic cleft, and that is where the transmitter

acetylcholine (ACh) is released. ACh binds to receptors which leads to

depolarization of the membrane and at the end a contraction of the muscle. The

Schwann cells are important for the maintenance of the NMJ and play a role in

regeneration and remodeling of impaired NMJ. NMJ-dysfunction seems to play

a role in age-related muscle impairment (Gonzalez-Freire et al., 2014).

Blood vessels are responsible for transport of oxygen, carbon dioxide, nutrients

and waste products between tissues. Arteries run primarily outside the muscle

and branches into arterioles which enter the muscle through the epimysium.

Arterioles finally branch into a network of capillaries that are embedded in the

endomysium (Korthuis, 2011). Arterioles are the smallest vessels that have a

smooth muscle layer, capillaries consist only of one layer of endothelium. The

capillaries lie around the muscle fibers and vary in number between fibers. It has

been showed that the bigger a muscle fiber is, the more capillaries is it surrounded

by (Ingjer and Brodal, 1978).

There is a strong correlation between muscle strength and cross-sectional area of

the muscle (Maughan et al., 1983). However, in untrained subjects who start to

exercise, the first weeks of improvement in strength are not related to muscle

growth. In untrained individuals, the neuromuscular adaption is instead the first

event when starting the strength training (Gabriel et al., 2006, Schoenfeld, 2010).

However, if the exercise continues the muscle mass will increase. That occurs

after a couple of weeks to months. The fibers of mature skeletal muscle do not

have the ability to undergo cell division. Muscle growth is thus hypertrophy,

which is enlargement of present muscle fibers, rather than hyperplasia. The

hypertrophy includes an increase in the synthesis of the myofibrillar proteins and

an increased oxidative capacity.

Skeletal muscle fibers are divided into slow fibers called type 1 fibers, and fast

fibers, type II fibers (Brooke and Kaiser, 1970). Type II fibers are subdivided into

several undergroups. What differs them is the contraction speed, the ability to

develop force and the endurance capacity.

4

Muscle tissue plasticity

Skeletal muscle tissue is adaptive to stimuli and has a pronounced capability of

plasticity. Adaptive structural events do not only occur in the muscle fibers but

also in the surroundings such as in capillaries and motor neurons. The skeletal

muscles have the potential to change the composition of muscle fiber phenotypes

and fiber size in response to activity and changed demands (Pette and Staron,

1997, Scott et al., 2001). Thus, physical training has an effect on fiber types in

muscle (Kadi and Thornell, 1999) . Changes of the neural impulse pattern to a

muscle also contributes to changes in muscle fiber phenotype. Muscle plasticity

refers to the fact that a muscle fiber can change its type and/or its quantity of

protein production. This will benefit the muscle concerning its physiological

demands. To some extent, there is a loss of skeletal muscle with aging (Lexell,

1995). Muscle tissue is, in some degree, replaced by connective tissue and fat, due

to less physical activity. To prevent this tissue transformation, from muscle to

connective tissue or fat, resistant exercise is effective (Peterson et al., 2011).

Resistant training for elderly women is not only decreasing the muscle loss but

does also increase maximal strength and explosive capacity (Edholm et al., 2017).

Skeletal muscle undergoes changes that can be degenerative due to massive

overuse. After passing through a degenerative stage, the muscle enters into a

regenerative state in the healing process (Carlson, 1973).

The triceps surae muscle in humans

The gastrocnemius and soleus muscles form the triceps surae muscle. It is the

most prominent muscle of the calf. The gastrocnemius muscle lies most

superficially and has two muscle heads, one lateral and one medial. It originates

from the distal part of the femur. The soleus muscle is a broad, flattened muscle

and lies beneath the gastrocnemius. It has its origin at the superior/posterior

parts of tibia and fibula and the intervening connective tissue. The two muscles

converge into the Achilles tendon with insertion into the calcaneus bone. The

main function of the muscle is plantar flexion of the foot, and it is activated during

running and jumping. It is involved in the supination of the foot as well. Because

the gastrocnemius muscle passes the knee joint it can also participate in flexion

of the knee.

The plantaris muscle in humans

The plantaris muscle is a small, rudimentary and variable muscle with the origin

at the lateral condyle of femur. The muscle is 5-10 cm long before it turns into a

long thin tendon which continues between m. gastrocnemius and m. soleus down

5

on the medial side of the lower leg. The plantaris muscle contributes to flexion in

the knee and the foot.

Tendon tissue

The extension of the muscle is the tendon and the force that muscles produces is

transmitted by the tendon. Tendons are composed of dense connective tissue and

connect the muscle to the bone. Most muscles passes along at least one joint,

involved in the movement of that joint.

Tendon mainly consists of collagen and elastin that are embedded in a proteo-

glycan-water matrix, where the collagen comprises most of the dry weight (Hess

et al., 1989, Jozsa et al., 1989). These extracellular components are produced by

tenocytes and their premature version, the tenoblasts. Tenocytes are considered

to be a subpopulation of fibroblasts (Riley, 2008) and are located between the

collagen fibers (Hess et al., 1989). Proteoglycans are major components of the

extracellular matrix and occur between collagen fibers. They have a high water

binding ability – water stands for 70% of the tendons weight –and play an

important role in structural and biochemical adaption to changes in load

(Kannus, 2000, Yoon and Halper, 2005). The three-dimensional structure of the

tendon is mediated by a hierarchical network of collagen fibers (Kannus, 2000)

A fine sheet of connective tissue called the endotenon encircles groups of collagen

fibers and form a primary fiber bundle (subfascicle). A group of subfascicles form

a secondary fiber bundle, several secondary fiber bundles create a tertiary bundle.

A couple of tertiary bundles are surrounded by the epitenon, which is a sheet of

connective tissue, and form the tendon. The number of subfascicles can vary

between tendons. Superficially to the epitenon is the paratenon that allows free

movement towards the surrounding structures (Hoffmann and Gross, 2007,

Elliott, 1965). The endotenon network carries blood vessels, nerves and lymphatic

vessels to the inner portion of the tendon (Hess et al., 1989). Outside the

paratenon there is a partly loose connective tissue called peritendinous tissue.

This will be commented on below.

The Achilles tendon in humans

Achilles was the son of king Peleus and the immortal goddess Thetis in the ancient

Greek mythology. Thetis wanted her son to be invulnerable and for this purpose

she dipped him in the river Styx. She was holding him in the right foot and

because of that the right heel never touched the water. Therefore that part of him

was still vulnerable. Later on in the Trojan War, Achilles was killed by a wound

caused by an arrow to the right heel. The expression “Achilles heel” refers to these

6

legends and means the weak point of a person. Despite this, the Achilles tendon

is the thickest and strongest tendon in the human body (Doral et al., 2010). As

described above, it is the common tendon of the gastrocnemius and soleus

muscles, thus the triceps surae muscle. The Achilles tendon inserts into the

calcaneus bone and is therefore also known as the calcaneal tendon. In the distal

course of the tendon the fibers make a lateral rotation. Medial fibers rotate

posteriorly, fibers found posteriorly are twisted laterally etc. (Cummins et al.,

1946). The rotation of Achilles tendon fibers is thought to increase tensile

strength and contribute to the supination of the foot (Morimoto and Ogata, 1968).

The Achilles paratenon is thick on the medial, dorsal and lateral portions but thin

at the ventral side. Medially and ventrally outside the paratenon there is the loose

peritendinous connective tissue.

The blood supply is principally divided into three portions, that of the musculo-

tendinous junction, that of the tendon-bone junction and that occurring along the

tendon (Ahmed et al., 1998). The last mentioned is the major portion. The main

blood supply is thus from the peritendinous network of blood vessels which

originates from the anterior and posterior tibial and peroneal arteries (Ahmed et

al., 1998, Schmidt-Rohlfing et al., 1992, Chen et al., 2009). Arteries run

longitudinally along the tendon and then penetrate the connective tissue sheets.

Blood supply is also to some extent provided from vessels in the perimysium of

the triceps surae muscle. The mid portion of the Achilles tendon is the least

vascularized (Carr and Norris, 1989) and that is also the part where most of the

Achilles tendon ruptures occur (Gulati et al., 2015).

The nerve supply for the Achilles tendon is primarily from nerves that innervate

the triceps surae muscle and cutaneous branches of the sural nerve (Stilwell,

1957). In an animal study it was shown that most of the nerve fibers terminate in

sensory nerve endings in the connective tissue around the tendon (Ackermann et

al., 2003). In studies on humans it has been found that there are frequent nerve

fibers in the peritendinous tissue located ventrally to the Achilles tendon in

tendinopathy patients (Andersson et al., 2007). Only a few nerves pass into the

tendon tissue proper, following the vascular channels in the endotenon. Different

types of nerve endings are found in association with human tendons, responsible

for signaling pressure and stretching which help to keep the balance in

movements.

The plantaris tendon in humans

As described above, the plantaris muscle is a thin muscle belly which originates

at the lateral condyle of femur and which turns into a long thin tendon in the

posterior/superior compartment of the calf. Some claim that the plantaris is a

7

part of the triceps surae muscle, but most often it is described as an individual

muscle. There are several anatomical variations for the plantaris muscle and its

tendon (Spina, 2007, Spang et al., 2016). It can vary in size and insertion sites.

Simpson and colleagues even showed that the plantaris tendon is absent in up to

20% of lower limbs (Simpson et al., 1991). Several insertion sites have been

described (Nayak et al., 2010). The most common insertion variant is into the

calcaneus, anteriorly to the Achilles tendon. It can also be inserted at the medial

side of the calcaneus bone. A small number of plantaris tendons fuses with the

distal portion of the Achilles tendon (Spang et al., 2016).

Extensor origin of the wrist

The common origin for the wrist extensors is the lateral epicondyle of humerus.

It is a common origin for four muscles that dorsiflex the wrist and fingers. The

lateral epicondyle is the origin for m. extensor carpi radialis brevis (ECRB), m.

extensor carpi radialis longus, m. extensor digitorum, and m. extensor carpi

ulnaris. They insert into different bones in the hand and are innervated by n.

radialis.

Figure 2. Schematic illustration of the insertion of the Achilles tendon at the

calcaneus bone in relation to the plantaris tendon which runs ventromedially to it. In

the space between these two tendons, loose connective tissue (peritendinous tissue)

is located (indicated by the yellow color).

8

Connective tissue in relation to tendons/muscle origins;

Peritendinous tissue

The connective tissue present in relation to tendons and in regions of muscle

origins such as that of elbow region/lateral epicondyle of humerus is of

importance. It is the subject of studies in the present Thesis.

The Achilles tendon is especially on the dorsal side, and to a small extent, laterally

and medially, surrounded by the paratenon. Ventrally to the Achilles tendon there

is a fatty areolar tissue that is richly vascularized and innervated (Shaw et al.,

2007). The tissue outside the tendon is often referred to as loose “peritendinous

connective tissue”. The blood flow and oxygen exchange increases not only in

muscles during exercise but also in the peritendinous connective tissue (Boushel

et al., 2000). Of relevance for the present Thesis is the fact that the peritendinous

tissue has been considered to be important when explaining the pain in

tendinopathy.

Also for chronic pain conditions at regions of the muscle origins, such as tennis

elbow region, it is supposed that the connective tissue is involved in the pathology

(Spang and Alfredson, 2017). For matter of simplicity, the connective tissue at

these regions is referred as peritendinous tissue in the present Thesis.

Rabbit muscle and tendon

Three of the papers in Thesis (I-III) are based on animal (rabbit) studies and

therefore it is of importance to explain similarities and differences when

compared to the human situation.

Rabbit triceps surae muscle

As in man, the triceps surae muscle in rabbits is composed of two muscles, the

gastrocnemius located superficially and the soleus muscle located beneath the

gastrocnemius. In rabbits, the gastrocnemius has two heads, one lateral and one

medial, which originate from the condyles of femur as in humans. It is attached

to the calcaneus bone by the Achilles tendon. The soleus muscle in rabbits

originates from the superior posterior part of tibia and inserts into the Achilles

tendon. As in humans, the triceps surae muscle is responsible for plantar flexion

of the foot, and the gastrocnemius muscle is also able to flex in the knee.

9

There is a thin muscle, the flexor digitorium superficialis muscle, which is located

parallel to the gastrocnemius and soleus muscles. The muscle continues to pass

the calcaneus bone and inserts underneath the foot. The flexor digitorium

superficialis muscle is not present in humans.

Although the anatomical features, for the triceps surae muscle appears in

principal to be similar in humans and rabbits, there is a difference in proportion

of muscle fiber phenotypes between humans and rabbits. The human soleus

muscle contains approximately 80% slow type 1 muscle fibers and in

gastrocnemius muscle approximately half of the fibers are slow type 1 fibers

(Gollnick et al., 1974). The soleus muscle of rabbits is reported to have 96% slow

type 1 muscle fibers (Peter et al., 1972) and gastrocnemius to approximately have

22% slow type 1 muscle fibers (Kost and Kost, 1982).

There seems to be a controversy concerning the existence of a rabbit plantaris

muscle in the literature. The majority of publications do not mention the plantaris

muscle, but rather the medially coursing flexor digitorum superficialis muscle

mentioned in earlier text (Doherty et al., 2006, Huisman et al., 2014). There are,

however, publications describing a plantaris muscle (Siebert et al., 2015) roughly

in the position of the flexor digitorum superficialis muscle.

Figure 3. Rabbit triceps surae muscle from a lateral view. The triceps surae muscle

consists of two heads of the gastrocnemius muscle and the soleus muscle. Flexor

digitorium superficialis is located between the gastrocnemius and soleus muscles.

10

Rabbit Achilles tendon

The Achilles tendon in rabbits is as in humans the tendon of the triceps surae

muscle. There is a similar lateral rotation of the Achilles tendon as in humans

(Doherty et al., 2006). There is however a difference concerning the tendon. The

tendon fibers originating from the two heads of the gastrocnemius muscle fuse

together into one tendon in the end of the first quarter of their course in humans.

In the rabbits they do not fuse until after reaching 93% of their course, i.e. very

close to the distal end and the insertion into the calcaneus bone (Doherty et al.,

2006).

The Achilles tendons relationship to other tendon structures is another aspect

that differs between man and rabbit. In humans, the plantaris tendon runs along

the Achilles tendon and most often does not become a part of the Achilles tendon,

but has an own insertion. On the other hand, a coalescence between the tendons

does often occur. In rabbits there is, as described above, a muscle which does not

exists in humans; the flexor digitorium superficialis muscle. The tendon of this

muscle is located anteriorly and medially to the medial gastrocnemius tendon.

Along its course the tendon tracks medially and posteriorly, and inserts in the

middle phalanges II-IV of the foot (Stoll et al., 2011).

Myopathies and tendinopathies

Skeletal muscle injury

Muscle damage due to different types of overuse do frequently occur. Repetitive

muscle work is actually associated with pain and muscle injury. The extrinsic

factors of importance for the work-related muscle injuries are not least the load

and the overactivity duration. The intrinsic factors are the muscle fibers and the

tissue surrounding the muscle. The capacity and response to a certain load is an

interaction between extrinsic and intrinsic factors (Ashton-Miller, 1999).

Eccentric exercise was found to cause the greatest muscle damage in an animal

(rat) study (Armstrong et al., 1983).

Injury of skeletal muscle due to overuse is characterized by changes in the muscle

fiber morphology, fiber degeneration, necrosis and inflammation and an

increased amount of connective tissue (Hikida et al., 1983, Friden et al., 1989).

The repair process is principally similar regardless of what caused the muscle

damage. Muscle fiber degeneration with infiltration of white blood cells in the

damaged area is the first event. Phagocytic inflammatory cells take care of

11

necrotic tissue and then the regeneration takes place. To avoid muscle fiber death,

there is a need of obtaining extra nuclei. These are delivered by the satellite cells.

At the site of the injury, growth factors are produced, several of them activating

the satellite cells (Grefte et al., 2007). The satellite cells fuse with the injured

fibers and contribute to the repair and regeneration process including in the

protein synthesis (Hill et al., 2003). If this does not occur the muscle fiber will

go through cell death. If the basal lamina of the muscle fibers is damaged, fibrin

and fibronectin will form a fibrous scar. If the load is excessive and the stress

continues to the muscle, proliferation of fibroblasts can occur. A dense fibrous

tissue (a large scar) may be created which will interfere with the repair process

and obstruct the recovery (Stauber, 2004).

Muscle inflammation (myositis)

Muscle inflammation (myositis) can occur due to several reasons. These can be

infection, toxic events or injury. There are also idiopathic inflammatory muscle

diseases leading to myositis. These diseases will be further explored below.

Marked exercise overuse of untrained muscle can also lead to muscle damage

with infiltration of inflammatory cells. Various studies that show the features in

this process, including infiltration of white blood cells, in human muscle have

been published (Dennett and Fry, 1988, Barbe and Barr, 2006). Nevertheless, a

marked myositis of the type seen in idiopathic inflammatory muscle diseases

were not demonstrated in these studies.

Models for studying muscle damage/myositis

Various types of myopathies, including those leading to myositis, have been

studied experimentally. That includes myositis induced by intraperitoneal

injections with lipopolysaccharide (Vitadello et al., 2010) and immunization with

various muscle components (Rosenberg, 1993). Furthermore, studies have been

performed whereby the development of myositis is achieved via alphavirus

injections in mice (Lidbury et al., 2008) and a further model for studying

myopathies including myositis is a model where hamsters are infected with

leishmanial infantum (Paciello et al., 2010). These models have mainly been used

in order to further help the understanding of inflammatory myopathies in man.

One model which is frequently used in studies on muscle tissue is the dystrophic

(mdx) mouse model, which is a model for Duchenne´s muscular dystrophy

(Radley et al., 2008). Previously, no model evaluating the myopathy/myositis

features experimentally that occur after marked overuse, the aspect of muscle

affection that became the goal for the present Thesis, has been presented.

However, in the present laboratory a model using rabbits, which were subjected

12

to marked overuse experimentally, came into use. Several studies have been

performed by use of this model, including a Thesis on the importance of the

substance P system in the development of the muscle damage/the myositis

process (Song, 2013). This model was used in the present Thesis. The

morphologic features of the overuse in this model do to a large extent resemble

those seen in idiopathic inflammatory diseases. Therefore, features for these

diseases are described below.

Muscle damage due to exercise has also been observed (Armstrong et al., 1991,

Friden and Lieber, 1992). Damaged myofibers that were in structural disorder

were observed by biopsies in man after heavy eccentric exercises (Friden et al.,

1983). Loss of desmin and cytoskeleton rupture were induced very short, 15 min,

after eccentric exercise (Lieber et al., 1996). One model for studying repetitive

contractions is by using electrical stimulation. Electrically induced eccentric

contraction have been shown to induce even greater damage than voluntary

contractions in humans (Crameri et al., 2007).

Idiopathic inflammatory myopathy

The cause of idiopathic inflammatory myopathies (IIM) are, as the name tells, not

known. However, there are auto-antibodies present in these groups of patients

and therefore the diseases are classified as autoimmune inflammatory

myopathies (myositis) (Love et al., 1991).

Concerning autoimmune diseases, the immune system turns against its own

tissue, in these cases the muscles. The reason is unknown but it is believed to be

triggered by some kind of stress, virus infections or vaccination. Autoimmune

myositis is not a genetic disease. However, there might be genetic factors which

will makes it more or less likely that the disorder will develop.

IIM is a myopathy characterized by muscle weakness, tenderness and sometimes

pain, caused by autoimmune-mediated muscle injury and inflammation. There

are three major idiopathic autoimmune myopathies; Dermatomyositis,

Inclusion-body myositis and polymyositis.

Dermatomyositis (DM) affects the skin with distinct rash but does also cause

muscle weakness. The inflammation in DM is primary in the perimysium.

Inclusion body myositis (IBM) is characterized by muscle weakness and inclusion

bodies (vacuoles with deposit of abnormal proteins and filaments) in the muscle

fibers. The symptoms often progress gradually and strike both proximal and

distal muscles. Polymyositis (PM) is characterized by weakness and muscle

13

atrophy in foremost the proximal muscles. The inflammation is primary localized

to the endomysium.

Extra-muscle manifestations occur in these groups of patients, the respiratory

organ being the most commonly affected in the form of interstitial lung disease.

Other extra-muscular manifestations are diseases in the cardiovascular, bone,

endocrine, dermatological and hematological systems (Ng et al., 2009).

When introducing the IIM in Introduction of this Thesis it is relevant to

somewhat discuss treatment options. It is namely a challenge to create optimal

treatment regimens for these diseases because of the low incidence, the variety of

complex phenotypes and the few randomized controlled trials (Gordon et al.,

2012). The purpose of treatment for inflammatory myopathies is to improve

muscle strength and function, to obtain remission or at least to prevent progress

of the disease and prevent other organ damage (Malik et al., 2016). IBM is

distinguished to PM and DM because it is resistant to standard

immunomodulatory and immunosuppressive therapy (Needham and Mastaglia,

2016). The treatment response is measured by actual muscle strength and levels

of circulation creatine kinase (CK), an enzyme released from damaged muscle

fibers (Gazeley and Cronin, 2011). First line treatment is corticosteroids (Albayda

and Christopher-Stine, 2012, Malik et al., 2016) but most patient also get a

complementary immunosuppressive treatment with methotrexate, azathioprine

or mycophenolate (Carstens and Schmidt, 2014, Malik et al., 2016).

Biological drugs have been a worthwhile addition in the treatment of other

autoimmune diseases such as rheumatoid arthritis (RA) and morbus Crohn. In

common for the biological drugs are that they are antibodies or other proteins

directly targeting a specific pro-inflammatory mechanism in the disease process.

One of the biologic drugs are those blocking Tumor Necrosis Factor alpha (TNF-

alpha). TNF-alpha is a cytokine in the inflammatory process and there are several

anti-TNF drugs on the market. As TNF-alpha is highly discussed for IIM and as

the types of injury/myositis that are seen morphologically in our currently model

resemble the situation for IIM, TNF-alpha is focused on in this Thesis. See further

below.

Tendinopathy and tendinosis

Tendinopathy includes the disorders of the tendon that lead to pain. A situation

with tendinopathy can be termed tendinosis when the painful condition is shown

to occur together with swelling and structural changes of the tendon (Khan et al.,

14

1999, Ohberg and Alfredson, 2002). The structural changes in tendon tissue in

tendinosis are disorder of collagen fibers, hypercellularity and increased

vascularization (Khan et al., 1999, Bjur, 2009).

Achilles tendinosis

Achilles tendinopathy with structural changes (tendinosis) is common among

athletes, both professionals and non-professionals (Alfredson and Lorentzon,

2000). The condition is often seen in individuals between 30-60 years age (Kvist,

1991). The etiology of Achilles tendinopathy is not clear, but an interaction

between intrinsic and extrinsic factors is suggested to occur (Maffulli et al.,

2004). Intrinsic factors can be muscle weakness, age, gender and weight.

Anatomical variations of the lower limb has also been suggested to predispose for

Achilles tendinosis (Kaufman et al., 1999, Maffulli et al., 2004, Kvist, 1994).

Extrinsic factors can be poor technique, poor equipment and some drugs such as

corticosteroids, fluoroquinolone (antibiotics) and anabolic steroids (Jarvinen et

al., 2005). These factors can predispose to Achilles tendinosis, but it remains

unclear to what degree. The common opinion is that most cases with Achilles

tendinosis are caused by a combination of overuse and eventually some of the

intrinsic/extrinsic factors (Jarvinen et al., 2005).

Repetitive overuse of the tendon causes microtraumas. If the healing of these

microtraumas is incomplete pain, oedema and tenderness will occur. The

symptoms will gradually progress (Alfredson and Lorentzon, 2000). In the initial

stages, there can be morning stiffness or pain of the tendon which disappears

during warming up. In later stages, there is pain during exercise or even at rest.

It has been shown that there often is a very narrow coalescence between the

Achilles and the plantaris tendons in Achilles tendinosis (Alfredson, 2011).

Releasing and operative extirpation of the plantaris tendon coupled with a

scraping technique has shown good results concerning treatment of Achilles

tendinosis (Alfredson, 2011).

Lateral epicondylitis/Tennis elbow

Lateral epicondylitis and tennis elbow are the most common terms for diagnosis

concerning pain over the lateral epicondyle of humerus, the common origin for

wrist extensors. Repetitive movements of wrist extensors is the main cause of

tennis elbow (Shiri et al., 2006). The term lateral epicondylitis is questioned; the

suffix “-it” explains it as an inflammatory condition. Actually no inflammation is

seen histologically in the tendon (Potter et al., 1995). Biopsies of the area show,

as in Achilles tendinosis, a hypercellularity, neovascularization and unstructured

15

collagen. Furthermore, there is a pronounced innervation in the area (Ljung et

al., 1999).

Peritendinous tissue in tendinopathy

Concerning tendinopathy, the surrounding tissue, i.e. the peritendinous tissue

has been regarded to be of interest lately. This tissue has thus been found to be of

importance in order to help to explain the pain that occurs in tendinosis. In

situations with tendon injury due to overload, there is an increase in blood flow

and local inflammation in the peritendinous tissue (Kjaer et al., 2013). In Achilles

tendinosis patients, biopsies of the peritendinous tissue located ventrally showed

presence of nerve fascicles and blood vessels (Andersson et al., 2007). There is an

increase in blow flow which can been seen with Ultrasound (US) and Doppler

(Alfredson, 2005, Ohberg et al., 2001). This is not the situation in the

peritendinous tissue in situations for the healthy Achilles tendon. The

peritendinous tissue has been shown to be richly innervated in situations with

Achilles tendinosis when the plantaris tendon is tightly located in relation to the

Achilles tendon (Spang et al., 2015). There are mainly sensory, but also some

sympathic nerves in the tissue (Spang et al., 2015).

TNF-alpha system

TNF-alpha

In the late 1960´s several researchers were investigating the possibility of an anti-

tumoral agent in vivo. In 1968, a cytotoxic agent produced by lymphocytes was

found and was named lymphotoxin (LT) (Kolb and Granger, 1968). In 1975,

another cytotoxic agent was found, produced by macrophages (Carswell et al.,

1975). It was named Tumor Necrosis Factor (TNF) because of the capacity to

inhibit mice fibrosarcoma, an ability which was also shown for LT. In the 1980´s

the DNA of LT and TNF were cloned and were seen to be quite similar (Pennica

et al., 1984). Later on, TNF was renamed to TNF-alpha and LT was renamed to

TNF-beta. Despite the name, TNF has not been successful in treating cancer, it

has rather been the opposite. Via activating Nuclear Factor kappa-light-chain-

enhancer of activated B cells (NF-κB), which is a pro-inflammatory transcription

factor, up-regulation of carcinogenic genes as well as increased proliferation,

survival and angiogenesis in tumor cells can occur (Balkwill, 2009).

16

TNF-alpha is a cytokine that is involved in inflammation. TNF-alpha is mainly

synthesized by macrophages (Baer et al., 1998) but can also be produced by other

white blood cells including mast cells and lymphocytes, as well by fibroblasts,

endothelial cells, adipose tissue cells and neurons (Wajant et al., 2003).

Stimulation of monocytes by TNF-alpha leads to cytotoxicity to target cells, and

blocking of TNF-alpha inhibits the cytotoxicity (Philip and Epstein, 1986).

TNF-alpha is primary produced as a transmembrane protein (Kriegler et al.,

1988). From the transmembrane stage, TNF-alpha can be cleaved to a soluble

form, sTNF-alpha (Black et al., 1997).

TNF receptors

In 1990, two receptors were found to bind TNF-alpha (Brockhaus et al., 1990).

Their sizes were approximately 55kD and 75kD, and therefore they are sometimes

referred to as TNFp55 and TNFp75. The most commonly used names today

however are TNF Receptor type 1 (TNFR1) for p55 and TNF Receptor type 2

(TNFR2) for p75. TNFR1 is found to be expressed in all kinds of cell types,

whereas TNFR2 mainly has been found in haematopoietic cells and other cells of

the immune system (Van Herreweghe et al., 2010).

The actions of TNF-alpha via TNFR1 and TNFR2

TNF-alpha can bind to TNFR1 and thereafter via pathways activate NF-κB. The

transcription factor NF-κB mediates transcription of several proteins involved in

cell survival and proliferation, inflammatory responses and protection against

apoptosis. This includes other cytokines such as interleukin-1 (IL-1) and

interleukin-6 (IL-6), growth factors, adhesive molecules and other proteins

contributing to synthesis of prostaglandins, leukotrienes and nitrogen oxide.

TNF-alpha can thus induce apoptosis and necrosis as well as anti-apoptotic

effects by signalling via NF-κB through TNFR1 (Van Herreweghe et al., 2010).

Binding of TNF-alpha to TNFR1 can also activate the mitogen-activated protein

kinase (MAPK) pathway which also leads to activation of transcription factors,

involved in cell differentiation, proliferation but which also lead to pro-apoptotic

effects. Beyond TNFR1 and TNFR2, TNF-alpha can bind to several other

receptors. There is a group of in total 27 receptors in this group and they are

together named the TNF Receptor Superfamily. Some of them, one being TNFR1,

have a death domain (Wilson et al., 2009).

The role of TNFR2 is much more unclear than that of TNFR1. Unlike TNFR1,

TNFR2 has no intracellular death domain, but is still able to contribute to

apoptosis (Declercq et al., 1998, Wang and Al-Lamki, 2013). TNF-alpha signaling

17

via TNFR2 can activate NF-κB, and it seems that this signaling is more

longstanding (Rothe et al., 1995) than the signaling via TNFR1. TNFR2 is

reported to play a major role in the lymphoid system (Wajant et al., 2003).

TNFR1 binds to both membrane bound and soluble TNF-alpha. TNFR2 is mainly

activated via membrane bound TNF-alpha. Not only can the two receptors have

independent signaling but they can also influence each other via crosstalks. A

crosstalk between TNFR1 and TNFR2 occurs at several levels (Naude et al., 2011).

These crosstalks can have both agonistic and antagonistic effects. An example is

that stimulation of TNFR2 can enhance TNFR1-induced apoptosis by inhibiting

NF-κB anti-apoptotic signaling (Fotin-Mleczek et al., 2002).

TNF-alpha can be of importance for blood regulation via having effects on

angiogenesis (Fajardo et al., 1992) and via being a mediator driving blood vessel

remodeling in inflammation (Baluk et al., 2009) and TNF-alpha is on the whole

reported to have an effect on the proliferation of vascular smooth muscle cells (Qi

et al., 2015). The TNF-alpha system is furthermore reported to be upregulated in

response to ischemia (Gesslein et al., 2010). However, TNFR1 and TNFR2 appear

to play different roles in ischemia-mediated angiogenesis, as well as

arteriogenesis, (Luo et al., 2006). Thus, they have opposite effects on the

endothelial cells, as seen in a study on a femoral artery ligation model in mice.

Thus, endothelial cell survival and migration occurred in response to activation

of TNFR2 but not TNFR1 (Luo et al., 2006).

TNF-alpha and muscle and tendon tissue

Expressions for TNF-alpha and TNF receptors have been noted for skeletal

muscle fibers of patients suffering from idiopathic inflammatory myopathies and

Duchenne muscular dystrophy (DMD) (Kuru et al., 2003, De Bleecker et al., 1999,

Fedczyna et al., 2001). The levels of TNF-alpha as seen biochemically were on the

whole increased in the muscle of these myopathies as well as in the muscle of mdx

mice compared to controls (Grounds et al., 2008). Changed TNF-alpha levels in

muscle tissue are reported in disease situations. Examination of muscle samples

(vastus lateralis) from patients who had suffered from stroke e.g. showed that

TNF-alpha mRNA levels were clearly higher in paretic as compared to control leg

muscle (Hafer-Macko et al., 2005). Cell culture studies showed that stimulation

of myoblasts increased cytokine (IL-6) production (Tseng et al., 2010). The

findings of various studies further imply that TNF-alpha has effects for muscle

tissue. Results of cell culture studies on muscle cells thus suggest that pro-

inflammatory cytokines such as TNF-alpha enhance Fas-mediated apoptosis of

these cells (Kondo et al., 2009). Such a proposal was also presented by Efthimiou

and collaborators (Efthimiou et al., 2006). Early studies on muscle cells in culture

18

furthermore led to a suggestion that TNF-alpha can play an important role in the

pathogenesis of the muscle destruction that occurs in myositis (Kalovidouris and

Plotkin, 1995). On the other hand, TNF-alpha may be important in myogenesis.

Myogenesis was decreased when blocking TNF-alpha was performed, and

stimulated after adding it (Chen et al., 2007) in injured muscle in mice.

Studies in our department have shown that the tenocytes of tendons, especially

these of tendinosis tendons, show marked expression of TNF-alpha and TNF

receptors (Gaida et al., 2012). The peritendinous tissue was not examined in these

studies.

TNF-alpha in relation to nerve tissue

It is since long known that TNF-alpha and TNF-alpha mRNA are upregulated in

non-neuronal cells early after nerve injury (Sommer and Schafers, 1998, La Fleur

et al., 1996). There is also an upregulation of TNF-alpha in neurons after ischemia

(Liu et al., 1994) and an upregulation of TNF-alpha mRNA in dorsal root ganglion

neurons after injury (Murphy et al., 1995). Injury of sciatic nerve leads to a

marked increase in the anterograde transport of TNF-alpha to the injury site

(Schafers et al., 2002) leading to the hypothesis that TNF-alpha is involved in

pain sensations after injury and/or degeneration and regeneration after injury.

Via performing fMRI, Hess and colleagues (Hess et al., 2011) found that RA

patients experienced quick pain relief in response to anti-TNF-alpha treatment.

The effect on the inflammation could not be that fast, suggesting that anti-TNF-

alpha treatment instead rapidly had an effect on the nervous system.

TNF-alpha and its receptors seem to play a role in neurodegenerative diseases.

Whilst signalling by TNFR1 leads to neuronal destruction, binding of TNF-alpha

to TNFR2 has a proliferative and neuronal protective function (Fontaine et al.,

2002). This means that TNF-alpha can participate in nerve degeneration as well

as nerve regeneration (Camara-Lemarroy et al., 2010).

Rheumatoid Arthritis and TNF-alpha

Rheumatoid arthritis (RA) is an autoimmune chronic symmetric polyarthritis.

There is an inflammation in the synovial membrane, the inner layer of connective

tissue in the capsule of joints. Granulation tissue is created (pannus). Pannus is

an abnormal tissue which invades and destroys joint structures. Pannus is a

vascularized tissue of fibroblasts and several types of white blood cells. The

synovial membrane is otherwise rather acellular.

19

Measuring of cytokines in the inflammatory cells of the synovial fluid showed

presence of IL-6, IL-1 and TNF-alpha (Firestein et al., 1990). Expressions of TNF-

alpha was then seen in the synovial membrane (Chu et al., 1991) and TNF-alpha

was also seen in the serum of RA patients (Tetta et al., 1990). There has been a

lot of studies on blocking cytokines since the early 1990s, TNF-alpha not being

the obvious target in the beginning. However, Fong and colleagues showed that

blocking of TNF-alpha decreased the expression of IL-6 and IL-1 in an animal

(baboon) study (Fong et al., 1989). The effect of blocking TNF-alpha was repeated

in rheumatoid synovial cultures in vitro, showing decreased expression of several

pro-inflammatory cytokines (Haworth et al., 1991, Brennan et al., 1989). RA

synovial tissue was in the present Thesis used as a reference tissue concerning

visualization of TNF-alpha expressions.

Use of TNF-alpha inhibitors is today a well-established complementary

treatment to those RA patients who not respond to other disease modifying drugs

such as methotrexate.

Other signal substances in parallel to TNF-alpha

TNF-alpha is known to have inter-relationships with other signal substances.

That includes neurotrophins and neuropeptides. In a previous Thesis presented

in our Department it was shown that the substance P (SP)/neurokinin 1 receptor

(NK-1R) system was upregulated in the myositis process for rabbits (Song, 2013).

Of particular interest for the present Thesis is the known fact that there are

interactions between TNF-alpha and SP. Therefore a possibility of relationship

between TNF-alpha and the SP/NK-1R system was evaluated. There are also

numerous other cytokines and further signal substances than TNF-alpha that can

have effects in relation to injury/inflammation but which are not in focus in the

present Thesis. It is since long known that there are marked interactions between

cytokines, neuropeptides, classical nerve transmitters, hormones and other

factors in various situations (Hokfelt et al., 1992, Kawamura et al., 1998, Ekblad

et al., 2000).

Why study the TNF-alpha system

It is obvious that the features in myositis developing in response to marked

overuse as well as in tendinopathy, especially the peritendinous tissue, are not

20

fully understood. The details in the expressions of the TNF-alpha system for these

situations is unclear. As TNF-alpha has such marked effects in various

pathological situations and as targeting TNF-alpha is much discussed concerning

IIM in man, which shows morphological changes which appear similar to those

in our myositis model, further information on the system for these conditions is

welcome.

21

Aim

The aim of the study was to examine the importance of the TNF-alpha system in

relation to the myositis that occurs due to marked muscle overuse and in the

situation of tendinopathy/tendinosis.

More precisely it was evaluated to what extent the TNF-alpha system is involved

in:

1. The evolving inflammatory process

2. The affection of the muscular system (the muscle fibers)

3. The affection of the nerves innervating the myositis and tendinopathy

areas

An animal model was used, enabling to evaluate whether muscle overuse

ipsilaterally also leads to influences on the TNF-alpha system in the contralateral

muscle. Evaluations of human tissue from painful areas in situations with

tendinopathy were made with particular focus on the innervation.

22

Materials and Methods

Obtaining of rabbit muscle tissue

Animals

46 female rabbits were used in the studies. They were 6-9 months old and had an

average weight of 4 kg. The animals were divided into eight groups, see table 1.

40 of the animals underwent an exercise experiment leading to marked muscle

overuse. The right leg of the animal was exposed to the experiment for two hours

every second day for 1, 3 or 6 weeks. Six of the animals were not included in the

exercise protocol.

22 of the animals were in the exercise experiment for 1 week and were also given

injections. For 17 of these, the purpose of the injections was to achieve muscle

inflammation. The injections were given shortly after each experiment session in

the loose connective tissue around the Achilles tendon (on the experimental side)

of the animals. Substances injected were Sodium Chloride (NaCl), Substance P

(SP) (S6883, Sigma), DL-Thiorphan (Th) (T6031, Sigma) and Captopril (Cap)

(C4042, Sigma) in different combinations (see table 1). NaCl is a salt solution

(given as a control substance), SP is a neuropeptide/ neurotransmitter, Th is a

neutral endopeptidase inhibitor and Cap is an angiotensin-converting enzyme

inhibitor.

Table 1. Group Exercise Injection No. of

animals Papers

1 - - 6 I II III 2 1 week - 6 II III 3 1 week NaCl 5 I III 4a 1 week SP+Th+ Cap 5 I III 4b 1 week Cap + Th 6 I III 4c 1 week Cap 6 I III 5 3 weeks - 6 II III 6 6 weeks - 6 II III

Table 1. Groups of animals; experiment period and given injections, having pro-

inflammatory effects, or not.

23

Between experiment sessions the animals were kept in cages allowing movement.

Experimental design

Animals were anaesthetized during the exercise experiment. Intramuscular

injections of fentanyl-fluanisone (0,095mg/kg fentanyl citrate and 3mg/kg

fluanisone) and diazepam (1mg/kg) were given at the start. Further fentanyl-

fluanisone (0,03mg/kg fentanyl citrate and 1 mg/kg fluanisone) injections were

given every 30-45 min to sustain anaesthesia.

Backman and collaborators (Backman et al., 1990) originally developed a kicking

machine. This was used in the study. The right foot was attached to a pedal

leading to passive moving of the foot by a pneumatic piston. The size of the

movement was set to 9.5 cm, allowing a movement in the range of motion in the

ankle of 55-65° with 35-40° plantarflexion and 20-25° dorsiflexion (extension).

The flexion-extension movements over the ankle were held at a speed of 150

movements per minute. Simultaneously during the plantar flexion, an active

contraction of the m. triceps surae was induced through electrical stimulation.

Two surface electrodes (Pediatric electrodes 40 426A, Hewlett Packard, Andover,

MA, USA) were placed 2 cm apart from each other over the m. triceps surae. The

electrical stimulation of m. triceps surae was synchronized with the plantar

flexion movement of the pneumatic piston by a microswitch, which triggered the

stimulator unit (Disa stimulator Type 14E, Disa Elektronik A/S, Herlev,

Denmark). 85 ms after the initiation of the plantar flexion an impulse with the

Figure 4. Rabbit in the kicking machine during the overuse experiments.

24

duration of 0,2 ms was delivered at an amplitude of 35-50V. The left foot/left leg

were not attached to the kicking machine. The pelvis was strapped down with

band to restrict movements to the right foot.

After every training session, the rabbits were given buprenorphine (0.01-0.05

mg/kg) for analgesia.

The day after the last exercise experiment session, the animals were euthanized

with an excessive amount of sodium pentobarbital. The triceps surae muscle with

tendon was excised from both sides. After the excision of the m. triceps surae from

both experimental and non-experimental sides the soleus parts were dissected

and cut into pieces.

Obtaining of human tissue

Patients

Human tissue samples were taken from patients suffering from plantaris-

associated Achilles tendinopathy or tennis elbow (pain in the area of the common

extensor origin at the elbow region) for at least 3 months. 34 plantaris tissue

samples including peritendinous tissue were obtained from 30 patients; four

patients had bilateral symptoms (23 men, 7 women, mean age 47 years). Tissue

samples from the tennis elbow area were obtained from 4 patients (2 men, 2

women, mean age 46 years). Clinical examinations and tissue collecting were all

done by the well-experienced surgeon Håkan Alfredson.

Surgery for Achilles/plantaris tendinopathy

The patients with plantaris-associated Achilles tendinopathy/tendinosis were

diagnosed by anamnesis of pain and stiffness in combination with signs of

midportion Achilles tendinopathy with involvement of the plantaris tendon as

seen by UC with Color Doppler. As a treatment for this condition, the plantaris

tendon and peritendinous tissue between the Achilles and plantaris tendons were

removed (Alfredson, 2011, Masci et al., 2015) .

The surgical removing was assessed by a short longitudinal incision at the medial

side of the Achilles tendon midportion. The plantaris tendon was then visible and

removed together with the fatty richly vascularized loose connective tissue

located inbetween the Achilles and plantaris tendons.

25

Surgery for tennis elbow

Pain at palpation of the common extensor origin, pain from the elbow when doing

wrist extension to resistance and positive 3rd test gave the diagnosis tennis elbow.

The Ultrasound with Color Doppler evaluation showed a high blood flow in the

area and structural changes. Skin markers were placed where the Ultrasound with

Color Doppler detected high blood flow outside the extensor origin. Local

anaesthesia was given by 3-4 ml of Xylocaine-adrenaline (10mg Xylocaine and

5mg adrenaline per ml) and the connective tissue from the region with thickened

fibrous tissue was removed via minimal invasive procedure.

Reference tissue from RA synovium

In paper I, RA synovial tissue was used as a reference tissue in the studies on

animal tissue. Synovial tissue was collected during surgery for knee prosthesis.

The tissue was fixed and stained in the same way as was the Achilles/plantaris

and animal tissue, see below.

Fixation and sectioning

Rabbit muscle tissue

Pieces of soleus muscle of an approximate size of 5-8x10mm were taken care of

in two different ways. They were either directly mounted in an optimal cutting

temperature (OCT) compound (Tissue Mek, Miles Laboratory, Naperville, IL,

USA) on a cardboard and frozen in propane chilled with liquid nitrogen in -80°C

or fixed by immersion overnight in 4°C in 4% formaldehyde in 0.1 M phosphate

buffer pH7.0. The latter were then washed in Tyrode´s solution (10% sucrose) at

4°C overnight and then mounted and frozen as described above.

The samples were cut by a cryostat (Leica Microsystem CM 300, Heidelberg,

Germany) into 5-8µm thick sections and mounted on glass precoated with

chrome-alum gelatin.

Human tissue

Directly after surgery, the tissues samples were put in a fixative solution (4%

formaldehyde in 0.1 M phosphate buffer, pH 7.0) at 4°C overnight. Then the

tissue was washed three times in Tyrode´s solution (10% sucrose), the first

26

washing step being performed at 4°C overnight. The tissue samples were cut into

smaller pieces and were then mounted on a thin cardboard hooped by OCT

embedding medium (Tissue Mek, Miles Laboratory, Naperville, IL, USA). The

last step involved freezing which was performed as described above.

The tissue samples were cut by into 7 µm thick sections by a cryostat (Leica

Microsystem CM 300, Heidelberg, Germany) and then mounted on superfrost

plus slides (Thermo Scientific, Braunschweig, Germany).

Staining for morphology

One section of all of animal and human tissue samples was stained with

Hematoxylin & Eosin (H&E) for demonstration and investigation of morphology.

The sections were put onto slides and put in Harris hematoxylin for 2 min. They

were then rinsed in distilled water and then dipped in acetic acid for 15 seconds.

A new rinsing in 37°C tap water followed before the sections were stained in 1%

eosin for 1 min. Then the sections were dehydrated in ethanol 2 min three times.

Finally, the cover glass was placed on top of the sections.

In situ hybridization

In situ hybridization (ISH) was used for detection of TNF-alpha and TNFR1

mRNA in animal tissue (I-III). Representive specimens from experimental and

control animals were selected, in total 25. Both experimental and non-

experimental sides were included. The tissue specimens were cut into 10 µm

thick sections with a cryostat and mounted onto Super Frost Plus slides

(nr.041200, Menzel Gläser, Braunschweig, Germany). Digoxigenin (DIG)-

hyperlabeled oligonucleotide probes (ssDNA) were used to evaluate the mRNA.

The antisense probe sequences are described below (table 2).

The procedures were carried out according to an established protocol

(Panoskaltsis-Mortari and Bucy, 1995). The dilution was 50 ng in 15µl

hybridization solution and an alkaline phosphatase (AP)-labelled anti-D16

antibody (Roche Germany, 11 093 274 910) was used for detection.

Corresponding sense DIG-hyperlabeled ssDNA probes were used as negative

controls and a β-actin antisense probe was used as a positive control.

27

Sections were then mounted in Pertex mounting medium. For further details, see

paper I and III.

Immunohistochemistry

Immunohistochemical procedures were performed to detect TNF-alpha, TNFR1

and TNFR2. Antibodies were goat polyclonal IgG antibodies. Mainly fixed but to

some degree unfixed tissue were investigated. Some of the sections were dipped

in potassium permanganate for 2 min with the purpose to enhance the

immunofluorescence reactions. Most sections did not undergo this step. Firstly,

the sections were defrosted and dried before being rinsed in 0.01 M phosphate

buffer saline (PBS), pH 7.2 with sodium azide, three times for 5 min. The sections

were then put in PBS with 1 % Triton X-100 for 20 min (Kebo lab, Stockholm)

and rinsed in PBS 3x5 min. An incubation in 5% normal donkey serum (code no:

017-000-121, Jackson Immune Research Lab. Inc) diluted in PBS for 15 min

followed. Then the sections were incubated with the primary antibody diluted in

PBS for 60 min in 37°C. The sections were washed in PBS 3x5 min and then

another incubation in normal donkey serum followed. After this, the sections

were incubated with the secondary antibody diluted in PBS. For labelling with

goat antibodies FITC-conjugated donkey-antigoat (I-IV) or Alexa FluorO 488

donkey-antigoat (I, II) (secondary antibody) were used. Finally the sections were

rinsed in PBS 3x5 min and mounted with Vectashield Mounting Medium (H-

1000, Vector Laboratories, Burlinggame, CA, USA) (I, II, IV) or Vectashield

Antifade Mounting Medium (III). In some sections Vectashield Antifade

Mounting Medium with DAPI (H-1500, Vector Laboratories, Burlingame, USA)

was used for marking of cell nuclei (III).

Table 2. Probe Code Source Sequence TNF-alpha

GD1001-DS Gene Detect, New Zealand

CGGCGAAGCGGCTGACAGTGTGAGTGAGGAGCACGTAGGAGCGGCAGC

TNFR1 GD1001-DS Gene Detect, New Zealand

TCCTCGATGTCCTCCAGGCAGCCCAGCAGGTCCATGTCGCGGAGCACG

Table 2. Sequences for antisense probes for detection of TNF-alpha mRNA and TNFR1

mRNA.

28

Also other substances were stained for. The primary antibodies used were mouse

monoclonal antibodies (antibodies against CD68, neutrophils/T-cells, mast cells,

fibroblasts, eiosinophil peroxidase, βIII-tubulin, neurofilament and Schwann

cells). In this case no incubation with potassium permanganate was performed.

Rabbit normal serum was used (code no: X0902, DakoCytomation, Glostrup,

Denmark) and dilutions were diluted in PBS with bovine serum albumin (BSA).

The staining procedures were otherwise as described above.

Double staining related to stainings using various combinations were also

performed (see below). That included stainings for CD68, T-cell/neutrophil

marker, NK-1R, desmin, Pax7, CD 31, Schwann cells and S-100β. A list of all used

antibodies is shown in table 3.

Table 3. Antigen Code Company Raised

in Tissue Study

TNF-alpha AF-210-NA

R&D Systems Goat Fixed I, II

TNF-alpha Sc-1350 Santa Cruz Goat Fixed IV TNFR1 Sc-1070 Santa Cruz Goat Fixed/

unfixed III, IV

TNFR2 Sc-1074 Santa Cruz Goat Fixed/ unfixed

III, IV

CD68 M0814 DakoCytomation Mouse Fixed I, IV T-cell/Neutrophil marker

MCA805G

AbD Serotec Mouse Fixed I, IV

NK-1R Sc-5220 Santa Cruz Goat Fixed II, III Desmin Ab D33 DakoCytomation Mouse Fixed/

unfixed II, III

Pax7 a.a.352-523

Development Studies Hybridoma Bank

Mouse Unfixed III

CD31 M0823 DakoCytomation Mouse Unfixed III S-100β S2532 Sigma Mouse Unfixed III, IV βIII-tubulin T8660 Sigma Mouse Unfixed/F

ixed III, IV

Neurofilament F180171Z

Invitrogen Mouse Fixed IV

Eosinophil peroxidase

MAB1087

Chemicon Mouse Fixed IV

Mastcells Ab2378 Abcam Mouse Fixed IV Fibroblasts M0877 DakoCytomation Mouse Fixed IV

Table 3. List of primary antibodies.

29

Control stainings

Control stainings with preabsorbed antibody was made in parallel with ordinary

stainings for the elements in the TNF-alpha system. Peptides used for the

preabsorbation were thus TNFR1, and TNFR2 antigens (peptides provided by

Santa Cruz Biotechnology, Dallas, TX, USA) (III). Furthermore, the TNF-alpha

antibody used in I and II was preabsorbed with TNF-alpha antigen T6674

(Sigma). The antibodies were incubated with the peptides 4°C overnight, and

then the same staining procedure as above followed. Controls also included

stainings when the primary antibody was eliminated. All the antibodies used have

been previously utilized and tested in the laboratory.

Double staining

For interpreting of the structures expressing TNF-alpha, TNFR1 and TNFR2

immunoreactions double stainings were made (I, III, IV). These stainings were

performed on fixed and unfixed tissue with different combinations of the

antibodies. The sections were incubated with the primary antibody (polyclonal

antibody against TNF-alpha, TNFR1 or TNFR2) in 4°C overnight and then

incubated with FITC-conjugated donkey antigoat secondary antibody for 30 min

in 37°C. Then followed a new incubation with another primary antibody

(monoclonal antibody), use of normal donkey serum and wash in PBS 3x5 before

incubation with a different secondary antibody (TRITC-conjugated, Red-X-

conjugated or Alexa-fluor conjugated antibody).

In order to help analyzing the cell stage (regeneration/degeneration) in abnormal

muscle fibers expressing TNF-alpha and/or TNFR1 mRNA double stainings with

NK-1R and desmin were performed (II, III). Parallel sections to sections

processed with in situ hybridization for TNF-alpha and TNFR1 mRNA were thus

processed with immunohistochemistry. These parallel sections were double

stained with NK-1R (sc-5220, Santa Cruz Biotechnology, Dallas, TX, USA) and

desmin (M0760, Dako Cytomation, Glostrup, Denmark). Firstly the sections were

immunohisto-chemically processed with the NK-1R antibody, in the same way as

described above including use of the same normal serum and secondary antibody.

Staining for desmin followed. Rabbit normal serum was then utilized and the

secondary antibody used was an anti-mouse immunoglobulin/TRITC (R0276,

Dako, Denmark)

For further descriptions of the procedurs for single and double stainings, see I-

IV. List of all secondary antibodies used is shown below (table 4).

30

Table 4. Secondary ab Code Source Paper FITC-conjugated Affini Pure Donkey Antigoat

705-095-147 Jackson ImmunoResearch I-IV

Alexa FluorO 488 Donkey Antigoat

A-11055 Invitrogen I

TRITC-conjugated Rabbit Antimouse

R0276 DakoCytomation I

Alexa FluorO 568 Donkey Antigoat

A-11057 Invitrogen II

TRITC Rabbit Antimouse R0276 DakoCytomation II, IV Rhodamine Red-X-conjugated

713-295-003 Jackson ImmunoResearch III

Alexa Fluor 647-conjugated antiserum

S21374 Invitrogen III

Identification of neuromuscular junctions and cell nuclei

Some of the sections were labelled with α-bungarotoxin for demarcation of

neuromuscular junctions (NMJ). Some sections processed for double staining

were mounted in Vectashield Antifade Mounting Medium with DAPI (H-1500,

Vector Laboratories, Burlingame, USA) for marking of cell nuclei.

Visualizing of the results

The single stainings were evaluated in a Zeiss Axioscope 2 plus microscope

equipped with epifluorescence technique and an Olympus DP70 digital camera.

The results of double stainings were examined by a Leica DM600B fluorescence

microscope (Leica Microsystems CMS GmbH, Wetzlar, Germany). Photos were

then taken by a color CCD camera (Leica DFC 490) and a digital high-speed

fluorescence CCD camera (Leica DFC360 FX).

Quantification

It was found relevant to quantitatively evaluate data in paper III. For this

purpose, animals were divided into two groups; animals that had a normal

Table 4. List of secondary antibodies.

31

morphology and those that had developed a clear myositis (irrespective of

group/treatment). Then the degrees of immunoreactions for TNFR1 and TNF2

were evaluated semi-quantitively for the most relevant structures.

Ethics for rabbit studies

The study protocol was approved by the local ethical committee at Umeå

University (A 34/07, A95/07). The approval was obtained before the start of the

study. A licensed breeder had bred all animals for the sole purpose of being used

in animal experiments. All efforts were made to minimize animal suffering.

Ethics for human studies

The study on tendinopathy/tennis elbow materials was approved by the Regional

Ethical Board in Umeå (dnr 04-157M; 2011-83-32M). The use of control synovial

material is in accordance with previous approval (dnr 2011-318-32M; 05-016M)

(for RA). The experiments were performed according to the principles expressed

in the Declaration of Helsinki. All patients included had given an informed

consent.

32

Results

Rabbit muscle tissue (I-III)

Morphology

The animals which did not participate in the muscle overuse experiment showed

a normal morphology. There was a diminutive variation in muscle fiber size, the

fibers were tightly packed and there was no visible muscle fiber necrosis. The 1-

week group given no injection treatment or injections with NaCl showed a

comparable morphology with the exception of occasional abnormal muscle fiber

appearances. Morphological changes were on the other hand seen in the 1-week

group given injections having pro-inflammatory effects, and in the 3, and 6, week

groups (I-III)

(Fig. 5). The

changes were

most obvious for

the animals in

the 6-week group

(group 6). There

was an increase

in loose conn-

ective tissue,

variations in

muscle fiber

sizes and an

increase in

number of

internal nuclei

within muscle

fibers. Areas of

myositis (areas

with marked

invasion of white

blood cells

coupled to

muscle fiber

changes) were

also regularly

seen. There was

Figure 5. Normal muscle morphology in (a) (control animal),

myositis areas in (b) and (c) (experimental, 6 week group) in

rabbit muscle tissue. White arrows at abnormal muscle fibers

with an increase in internal nuclei. Black arrows at muscle

fibers totally invaded by white blood cells.

33

thus a distinct infiltration of white blood cells in the loose connective tissue and

in muscle fibers showing features of necrosis. Abnormal muscle fibers which were

not undergoing necrosis could also been seen in the areas of myositis.

Bilateral involvement as seen morphologically

Morphological changes were seen for both experimental and non-experimental

sides (II, III). The morphological features described above could thus be seen in

both sides. They occurred to a similar extent on both sides. The 1-week groups

not given injection or being injected with NaCl had only occasional abnormal

muscle fibers bilaterally and all other experimental groups showed the above

described changes, including myositis, bilaterally.

In situ hybridization (ISH)

Sections of specimens were investigated for detection of TNF-alpha and TNFR1

mRNA (I-III). Both sides of experimental animals and specimens of

nonexperimental animals were evaluated. There was no mRNA for TNF-alpha

and TNFR1 in the control group (group 1). The abnormal muscle fibers

occasionally seen in the 1 week group were found to express both TNF-alpha and

TNFR1 mRNA (the TNFR1 mRNA reactions for necrotic fibers were localized for

infiltrating white blood cells). In the 1-week group given injections of pro-

inflammatory character (group 4a-c) and in 3- and 6 week groups (groups 5, 6)

TNF-alpha and TNFR1

mRNA were seen to a

large extent. That

included reactions in the

white blood cells of

inflammatory infiltrates

(Fig. 6) and in the white

blood cells invading

necrotic muscle fibers.

The abnormal muscle

fibers in the myositis

areas that were not

necrotic had a patchy

and widespread reaction

for TNF-alpha and

TNFR1 mRNA. TNF-

alpha mRNA was also

seen in some of the

vessels and fibroblasts of

Figure 6. Dispersed cells in rabbit muscle tissue

(experimental group with pro-inflammatory injection,

group 4a). Staining for demonstration of TNF-alpha

mRNA. Cells in the loose connective tissue show

reactions (arrowheads).

34

the myositis animals. TNFR1 mRNA reactions were seen in some of the

fibroblasts in the myositis group but never in the control animals.

The abnormal non-necrotic muscle fibers showing TNF-alpha mRNA (II) and

TNFR1 mRNA (III) were compared concerning immunoreactions (IR) for desmin

and NK-1R via stainings of parallel sections. The stainings showed that these

muscle fibers had a strong and generalized desmin IR and a point-like NK-1R IR.

The interpretation was that the fibers are in a regenerative/reparative state (II,

III). Muscle fibers with normal morphology expressed a striated desmin IR

pattern and no NK-1R IR.

The same ISH results were seen for both experimental and non-experimental

sides.

Immunohistochemistry (IHC)

Fibroblasts

In the 1 week groups given injections with pro-inflammatory effect (group 4a-c),

and the 3 and 6 week groups (groups 5, 6) fibroblasts in the connective tissue

areas were seen to express TNFR2 immunoreactions (IR), most clearly so in the

6 week group (III). A similar pattern was seen bilaterally. Fibroblasts in the

Figure 7. Muscle fibers in parallel sections. (a) is H&E, (b) is antisense staining for

TNFR1 mRNA and (c) is sense as a control. The muscle fiber in the middle (asterisk)

shows reaction for TNFR1 mRNA. Sample from 1 week group (group 2).

35

control group or 1 week group without injections did not show TNFR2 IR. TNF-

alpha and TNFR1 IR were only seen in some fibroblasts in the 6 week group.

White blood cells

Myositis areas with infiltration of white blood cells were especially seen in the 6

week group but were also seen in the 1 week groups with injections and 3 week

group. IR for TNF-alpha and TNF receptors were seen in white blood cells on both

sides. TNFR2 IR was seen in most white blood cells, TNF-alpha and TNFR1 IR

were seen to a lesser extent.

Muscle fibers

There was no IR for TNF-alpha

in muscle fibers. In

comparison, TNF-alpha mRNA

could be seen in muscle fibers

(see above). However, IR for

both receptors were seen in

muscle fibers. TNFR1 and

TNFR2 showed different

expression patterns. TNFR2 IR

was seen in small rounded

structures in the outer part of

the muscle fibers for all groups

bilaterally including in control

animals (Fig. 8). Double

stainings verified that these

rounded small structures

corresponded to myonuclei of

the muscle fibers. TNFR2 IR

was also seen in invading white

blood cells in muscle fibers

showing a necrotic appearance.

TNFR1 IR was never seen in

muscle fibers in control animals.

TNFR1 IR was on the other hand

found to be spread diffusely in

the cytoplasm, especially seen

close to the cell membrane (Fig.

9), in certain muscle fibers of the myositis animals (corresponding to fibers

classified as abnormal non-necrotic muscle fibers). This expression pattern was

Figure 8. Sample from control group. Small

rounded structures in the outer parts of the

muscle fibers are showing TNFR2 IR in (a). Fig

(b) is a control staining with antibody being

preabsorbed with antigen. Parallel stainings

showed that these small structures correspond

to myonuclei.

36

seen on both experimental and contralateral sides and was most obvious for the

6 week group. These fibers were not invaded by white blood cells.

Blood vessel walls

TNFR2 IR was seen in some of the blood vessel walls in all groups (III), but more

often and exhibiting a stronger IR in animals in the 6-week group than other

groups. The TNFR2 IR was localized to the smooth muscle layer of the vessels.

There was no TNFR2 IR in capillaries.

TNFR1 IR was occasionally seen in blood vessel walls of the myositis animals. The

immunoreactivity was located to the nuclei of the cells in the smooth muscle

layer.

TNF-alpha IR was not seen in blood vessel walls.

Nerve fascicles

There was no clear TNF-alpha IR in nerve structures. However, reactions for both

receptors were seen in nerve fascicles (III). TNFR IR was however only very

occasionally seen in nerve fascicles in the control group and 1 week group with no

pro-inflammatory injections. In animals with longer experiment periods (3 and

especially 6 weeks) or with pro-inflammatory injections for 1 week animals

Figure 9. Sample from 6 week group. White small dots in the outer parts of muscle

fibers are showing TNFR1 IR in (a) (asterisks). Fig (b) is a control staining with

preabsorbed antibody.

37

TNFR1 and TNFR2 IR were more clearly seen. Double stainings showed that

TNFR1 IR was localized in Schwann cells and axons, whilst TNFR2 was only seen

in Schwann cells.

Neuromuscular

junctions

TNFR2 IR was seen in

neuromuscular junctions

(NMJ) for all tissue samples

including those of non-

experimental animals. In

order to localize NMJ in

sections labelling with α-

bungarotoxin for

demarcation of NMJ was

made. TNF-alpha and TNFR1

IR was never seen for NMJ.

Figure 11. Stainings for TNFR2 (a) and staining

with α-bungarotoxin in a parallel section (b).

Arrows at neuromuscular junction, where

TNFR2 is observed. Arrowheads at small vessels

with IR for TNFR2. Control animal.

Figure 10. Nerve fascicles showing IR for TNFR1 in myositis animal. Parts of large

nerve fascicle (N) in (a) and small nerve fascicles in (b, c). Immunoreactions occur in

the form of whitish reactions. Asterisks at perineurium. Samples from 3 and 6 week.

38

For summary of the TNF receptors expression patterns, see study (III).

Human tissue samples (IV)

Nerve fascicles and fine nerve fibers were seen in the peritendinous tissue (loose

connective tissue) of both tennis elbow and Achilles/plantaris specimens. Close

to the nerve fascicles small vessels were frequently observed. Arterioles and

venules were also seen. There were numerous dispersed cells in the peritendinous

tissue as well.

Dispersed cells

The dispersed cells in the peritendinous tissue represented white blood cells and

fibroblasts. Most of the white blood cells were macrophages. TNF-alpha IR and

TNFR1 IR were frequently seen in fibroblasts whilst TNFR2 IR was usually not

seen in these cells. Macrophages frequently exhibited TNFR1 IR and to some

extent TNFR2 IR. TNF-alpha IR was never seen in macrophages. The mast cells

showed TNF-alpha IR, and to some extent TNFR1 and TNFR2 IR.

Figure 12. Dispersed cells in the peritendinous tissue, immunoreaction for TNFR1.

Achilles/plantaris peritendinous tissue.

39

Nerve fascicles

The nerve structures were visualized via staining for neurofilament and βIII-

tubulin. There was a difference in the pattern of neurofilament/βIII-tubulin IR

between different nerve fascicles. Some of them were homogenously stained for

neurofilament/βIII-tubulin whilst others were not. These homogenously stained

(for neurofilament/βIII-tubulin) did not express TNF-alpha IR at all, showed

only very limited reaction for TNFR1 IR and TNFR2 IR to some degree. Nerve

fascicles with non-homogenous IR for neurofilament/βIII-tubulin had in

comparison a distinct increase in magnitude of TNFR1 and TNFR2 IR compared

to the homogenously stained nerves fascicles (figure 13 and 14).

Figure 13. Parallel sections of a nerve fascicle in the connective tissue from a tennis

elbow patient. Asterisks indicate corresponding parts of perineurium. The nerve

fascicle is homogenously stained for neurofilament (a) and βIII-tubulin (b). There is

no TNF-alpha IR (c), limited TNFR1 IR (d) and to some extent TNFR2 IR (e).

Arrowheads at immunoreactions.

Figure 14. Parallel sections of a nerve fascicle in the connective tissue of an elbow

patient. Asterisks at corresponding parts of perineurium. The nerve fascicle is not

homogenously stained for neurofilament (b) and βIII-tubulin (b) indicating loss of

axons. Arrowheads indicate occurrence of some TNF-alpha IR in (c), strong TNFR1

IR in (d) and a particularly distinct TNFR2 IR in (e).

40

Blood vessel walls

Reactions for TNFR2 were seen for the blood vessel walls in the peritendinous

tissue (arterioles, venules and capillaries). The TNFR2 IR was primary seen in the

smooth muscle layer of arterioles, but also larger blood vessels and capillaries did

to some extent exhibit TNFR2. TNFR1 IR were also seen in blood vessels walls

but to a lesser extent. There were also blood vessels walls with no

immunoreaction for either TNFR2 or TNFR1 in the peritendinous tissue. Weak

TNF-alpha IR were seen for some of the small blood vessel walls.

Table 6. Cell type TNF-alpha TNFR1 TNFR2 Fibroblasts ++ ++ - Macrophages - ++ + Normal nerve fascicles - -/+ + Nerve fascicles with axonal loss -/+ ++ ++

Table 6. Summary of results for the most frequently occurring cell types and the

nerve fascicles in the human peritendinous tissue. (-) is for no IR, (-/+) occasionally

seen/weak IR, (+) moderately seen IR (++) frequently seen IR.

41

Discussion

Major findings

A major finding in this Thesis is that the TNF-alpha system is found to be highly

expressed in the myositis process that occurs after experimental muscle overuse.

That includes occurrence of TNF receptor reactions in white blood cells,

fibroblasts and blood vessel walls and most interestingly also in abnormal muscle

fibers; TNFR1 reactions were seen in the interior of non-necrotic muscle fibers

and TNFR2 reactions were noted for the white blood cells that invaded the

necrotic muscle fibers. Furthermore, the changes that were noted concerning the

TNF-alpha system occurred not only on the experimental side but also

contralaterally. Thus, upregulations in expressions of TNF-alpha and the TNF

receptor reactions were noted bilaterally.

The studies on painful areas in humans, namely peritendinous tissue of patients

with Achilles tendinosis and tennis elbow, complemented the experimental

studies. TNF receptor reactions were also frequently noted for the cells in the

human peritendinous tissue, the cells mainly corresponding to fibroblasts and

macrophages. Reactions were also seen for blood vessel walls.

An especially important finding was related to the findings for the nerve

structures in both the areas of the myositis process in the experimental situation

and those of the painful areas of humans. Thus, there was a clear increase in TNF

receptor expressions in the experimental situation. With respect to

Achilles/plantaris tendinosis and tennis elbow it was noted that the nerve

fascicles that exhibited features of axonal loss showed clearly more distinct TNF

receptor reactions than the nerve fascicles that were normally appearing.

In total, it is apparent that the TNF-alpha system seems to be markedly involved

in the processes that occur in tissues of the locomotor system that is under

influence of marked overuse and that is affected by chronic pain. Via

examinations of the experimental model and the painful areas of humans, a

picture of the importance of the TNF-alpha system could thus be depicted for the

evolving inflammatory process, the muscle tissue (the muscle fibers) and the

nerve structures.

42

Strengths, limitations and methodological considerations

Via the use of a model in rabbits, the features of the TNF-alpha system could be

followed in response to development of myositis and muscle fiber and nerve

influences in a situation with overuse. One should have in mind that the use of a

special apparatus (the kicking machine), the use of electrical stimulation and the

injecting of substances having pro-inflammatory effects are things that to

different extents can contribute to the outcome of the experiment. Furthermore,

obligatory parts were the giving of anesthesia during the exercise and the

analgesic substance afterwards. Nevertheless, although the overuse experiment

with rabbits indeed is an experimental situation, valuable information can be

obtained via the model and which can not be directly obtained from studies on

human beings. The development of morphological features and the changes in

expressions for the elements in the TNF-alpha system could be followed via

evaluations at different time points. Furthermore, a main aspect is that

comparisons with the human situation could be obtained via evaluations of

painful areas (peritendinous tissue in association with painful tendons and tissue

from tennis elbow). It was therefore logic to combine both experimental studies

with studies on human tissue.

In future studies using the experimental model still other muscles should be

evaluated, including muscles from both sides. Furthermore, evaluations at the

level of the spinal cord/spinal ganglia would be worthwhile. In future studies it

would also be of interest to explore the muscle fiber changes in relation to fiber

type.

An aspect that could be looked upon as a limitation is that control tissue for

humans could not be analyzed. That is completely related to ethical

considerations. It would thus not be ethically correct to do the kind of operations

that were made on the tendinosis/tennis elbow patients on completely healthy

individuals. However, due to the fact that marked infiltrations of dispersed cells

(white blood cells and fibroblasts) are likely not to occur for healthy persons and

due to the fact that abnormal nerve fascicles could be compared with normal such

ones important information could be obtained.

Another limitation might be methodologically related to the staining procedures.

Thus, it is well-known that variable results can be obtained with various

antibodies, although these by the companies are reported to detect a certain

substance. Nevertheless, control stainings including preabsorption stainings for

IHC and stainings using positive and negative controls for IHS were made.

Furthermore, the results from IHC could be compared with those from ISH. It is

also a fact that two different TNF-alpha antibodies were used in the present

43

studies. Furthermore, in parallel with stainings using one of the currently used

TNF-alpha antibodies, still another TNF-alpha antibody from another source was

utilized in our previous studies on the TNF-alpha system for tendon tissue proper

(Gaida et al., 2012). These previous studies showed that the reaction patterns

were similar with both antibodies.

TNF-alpha in relation to the inflammatory process

It is well-known that the TNF-alpha system is involved in inflammation (Vassalli,

1992, Munro et al., 1989, Feldmann et al., 1996). Accordingly, it was observed

that TNF-alpha mRNA and TNF-alpha IR (I, II), TNFR1 mRNA (III), and

immunoreactions for both TNF receptors (III) were detected in the infiltrating

white blood cells. Double-stainings in (I) showed that a coexistence between

TNF-alpha and CD68 (macrophage marker) occurred. The situation was different

for the human peritendinous tissue where macrophages did not display TNF-

alpha IR. On the other hand, the macrophages in the latter tissue very frequently

displayed TNFR1 IR (IV). Overall it is apparent that the TNF-alpha system has a

relation to the infiltrating white blood cells in the tissues evaluated in the present

Thesis. That included a relationship to the white blood cell infiltration into the

muscle fibers that became necrotic.

TNF-alpha in relation to damage and reparation of muscle

fibers

It is well-known that TNF-alpha can have detrimental effects, including a role in

development of the injury that occurs in ischemia (Gesslein et al., 2010).

Concerning the situation in inflammatory myopathies, it has been suggested that

TNF-alpha can be of significance for the myositis development (Efthimiou et al.,

2006) and to be involved in the damage of the muscle fibers (Tews and Goebel,

1998). The results of the present Thesis showed that TNF-alpha mRNA was

detected in the white blood cells (I, II) and TNFR1 mRNA and TNFR2 IR in those

that had infiltrated into necrotic muscle fibers (III). Thus, TNF-alpha can be

considered to contribute to necrotic processes via acting on the infiltration of

white blood cells. Nevertheless, a degeneration/necrosis of the muscle fibers is

necessary in order to give place for the forthcoming reparation of the tissue.

44

TNF-alpha can also have reparative/regenerative functions (Inoue et al., 2000),

including for muscle tissue (Karalaki et al., 2009) and for tendons (Schulze-

Tanzil et al., 2011). The observations on desmin immunoreactions in the present

Thesis are hereby of interest. It is namely shown that overexpression of desmin

occurs during regenerative phases of skeletal muscle (Gallanti et al., 1992), a

feature that we noted for the abnormal non-necrotic muscle fibers displaying

TNF-alpha mRNA (II) and TNFR1 mRNA (III). In the immunohistochemical

analysis it was furthermore noted that such abnormal muscle fibers displayed

TNFR1 IR (III). It was also observed that TNFR2 IR was detected in internal

nuclei of muscle fibers in the experimental groups (III), a feature that also can

indicate a reparative capacity.

TNF-alpha in relation to nerve influences

It is known that TNF-alpha can be a mediator of pain (Boettger et al., 2008) and

that TNFR1 and TNFR2 can be found in nociceptors in pain situations (Schaible,

2010, Hess et al., 2011). TNF-alpha neutralization in animals in a rat model of

antigen-induced arthritis had a pronounced antinociceptive effect (Boettger et al.,

2008). The release of TNF-alpha from activated glia cells can cause pain by acting

on spinal cord dorsal horn neurons (Suter et al., 2007). Expressions for the

elements in the TNF-alpha system were extensively analyzed for in the nerve

structures in the present Thesis. Study III showed that immunoreactions for

TNFR1 and TNFR2 became clearly more evident in nerve fascicles with increasing

experimental time for the rabbits and study IV showed that the abnormal nerve

fascicles in human peritendinous tissue displayed clearly more evident receptor

reactions than normal nerve fascicles. Both findings suggest that the TNF-alpha

system is involved in damaging/painful situations. To what extent the findings

relate to nerve fiber degeneration or attempts for regeneration remains to be

answered. One possibility is that both types of functions occur. In any case, these

types of findings of TNF receptor reactions in nerve fascicles have not previously

been made for skeletal muscle nor tendons.

The results of a recent study suggest that TNF-alpha has a function in relation to

neurite outgrowth (Pozniak et al., 2016) and treatment with TNF-alpha inhibitor

in a rat model showed a protective effect for axons, but did not recover the

demyelination that occurred in the model used (Buyukakilli et al., 2014).

Furthermore, attenuation of TNFR expression has been shown to be associated

with recovery from nerve injury (Andrade et al., 2014). Nevertheless, TNF-alpha

is known to not only participate in nerve regeneration but also nerve degeneration

(Camara-Lemarroy et al., 2010).

45

TNF-alpha in relation to substance P

It is previously known for various tissues that there is an interrelationship

between the SP system and the TNF-alpha system (Brunelleschi et al., 1998,

Denadai-Souza et al., 2009). Neuropeptides can on the whole influence the

production of cytokines (Kawamura et al., 1998), SP for example enhancing the

secretion of TNF-alpha from neuroglial cells stimulated with lipopolysaccharide

(Luber-Narod et al., 1994). Furthermore, SP is shown to selectively activate TNF-

alpha gene expression in murine mast cells (Ansel et al., 1993). In the present

Thesis therefore comparisons between the systems were made, via stainings for

the NK-1R in the case of the SP system (II, III). It was found that the systems

occur in parallel for the muscle fibers undergoing necrosis as well as those

undergoing presumable reparation. One possibility is that NK-1 R activation via

SP is involved in the activation of the TNF-alpha system. Thus, both systems can

be related to the attempts for reparation of the muscular tissue. Presumably, also

other signal substance systems are co-operating.

TNFR2 at neuromuscular junctions

In the present Thesis, immunoreaction for TNFR2 but not TNFR1 was noted for

the NMJ (III). That was the case for all animal group. Such a diversity between

TNFR1 and TNFR2 has not previously been shown. The findings show that the

TNF-alpha effects that occur at the NMJ are related to TNFR2 effects. Very little

is described in the literature concerning the NMJ in relation to TNF-alpha. What

is known is that TNF-alpha transiently increases the frequency of miniature

endplate potentials in rats (Caratsch et al., 1994) and that deletion of TNFR2

impairs motor performance in mice (Probert, 2015).

Findings of nerve influences concerning the TNF-alpha system

bilaterally

Bilateral effects in muscle strength has been seen after unilateral exercise

experiments (Slater-Hammel, 1950, Komi et al., 1978). In our studies,

experimental unilateral muscle overuse led to morphological muscle changes

bilaterally. There was no difference in the expression of the TNF-alpha system

between experimental and non-experimental sides, including the expression

patterns in nerves. One possibility is that effects via the nervous system are

46

involved in the morphological and TNF-alpha related changes that occur

bilaterally. Effects via the circulatory system can not completely be ruled out.

Further studies are needed to solve the aspect concerning bilateral features.

Earlier research in our group showed the occurrence of the bilateral involvement

of the SP-system after unilateral muscle overuse using the presently used model

(Song et al., 2013). Bilateral upregulation of TNF-alpha and IL-10 in dorsal root

ganglia has been seen previously after unilateral sciatic nerve injury in rats

(Jancalek et al., 2010). Immune activation close to a peripheral nerve leads to

allodynia not only in the ipsilateral side but also contralaterally (Chacur et al.,

2001). It is also shown that TNF-alpha can trigger and maintain bilateral

inflammatory pain after unilateral treatment of TNF-alpha (Russell et al., 2009).

TNF-alpha in relation to the blood vessels

The TNF-alpha system can be involved in effects on the vasculature, e.g. having a

stimulation effect on angiogenesis (Gesslein et al., 2010). There is also evidence

which suggests that there is a vascular involvement in the pathogenesis of

idiopathic inflammatory myopathies, there being a role of vascular cell

dysfunction and hypoxia in this pathogenesis (Grundtman and Lundberg, 2009).

In the current Thesis, it was found that there was a marked expression of TNFR1

and especially TNFR2 in blood vessel walls in the human peritendinous tissue

(IV). In (III), it was noted that TNFR2 IR was frequently seen in the blood vessels

walls of experimental animals. The findings suggest that effects via the TNF-alpha

system can be of importance in remodeling processes in the painful peritendinous

tissue as well as in the myositis process. An importance in relation to remodeling

has also been suggested for TNF-alpha in inflammation processes in the airways

(Baluk et al., 2009).

What about anti-TNF treatment? Should instead substances be

given with TNF-alpha agonistic effects?

TNF inhibitors are indicated in the treatment of e.g. RA, morbus Crohn and

ulcerative colitis. The use of anti-TNF treatment has greatly improved the

situations for RA patients. It has also been shown that patients with RA that are

treated with TNF inhibitors have a significantly decreased risk of cardiovascular

events (Roubille et al., 2015)

47

The use of anti-TNF treatment (etanercept) has been noted to reduce the

breakdown of muscle tissue in dystrophic mdx mice, the model for Duchenne

Muscular Dystrophy (Hodgetts et al., 2006). Preliminary studies were also

previously presented which on the whole suggested that TNF-alpha may be a

target for myositis development (Chevrel et al., 2005, Baer, 2006). A few case

reports has shown improvement for the IIM patients (Hengstman et al., 2003,

Anandacoomarasamy et al., 2005). Efthimiou and colleagues showed an

improvement in muscle strength and small decrease in CK (Efthimiou et al.,

2006). Another study showed no improvement in muscle strength but a

corticosteroid-sparing efficiency (Amato, 2011). Nevertheless, researches also

early concluded that more research was needed in order to clarify if this type of

treatment is beneficial or not in this condition (Mastaglia, 2008).

It has also been argued that TNF-alpha may provide a target for treating

tendinopathy/tendinosis (Millar et al., 2009, Hosaka et al., 2005). It is actually a

fact that anti-TNF treatment has been tested concerning closely related

conditions such as ankylosing spondylitis (Henderson and Davis, 2006, Braun et

al., 2005). Concerning the most frequent pain-related condition for the Achilles

tendon (mid-portion Achilles tendinosis) the situation has all the time been

unclear.

There are some serious side effects to consider concerning TNF-alpha inhibitor

treatment. It is well-known that anti-TNF treatment can have adverse effects. A

systemic review and meta-analysis concluded that anti-TNF treatment increased

the risk for both serious infections and malignancies, with the number needed to

harm being 59 and 154 (Bongartz et al., 2006).

During the most recent years there are several reports showing that anti-TNF

treatment actually can induce inflammatory myopathies (Couderc et al., 2014,

Brunasso et al., 2014, Liu et al., 2013). This means that anti-TNF-alpha treatment

rather is contradictory than useful for muscle affection with myositis. In our study

(III) it was also concluded that TNF-alpha blocking might have negative effects

in the phase of reparation after the myositis. Thus, we noted TNF receptor

expressions in fibers that were interpreted to be in a regenerative stage.

Nevertheless, next-generation TNFR-selective TNF therapeutics are available.

These are considered to be an effective approach in treating certain diseases

(neurodegenerative diseases) (Dong et al., 2016). In the study by Dong et al, a

new type of treatment in a mouse model was given and which correspond to a

TNFR1-selective antagonistic antibody and an agonistic TNFR2-selective TNF. In

this way, the neuroprotection functions of TNFR2 came into account. It would be

interesting to explore how such a TNF therapy influences myositis processes and

reparative capacity for muscle tissue.

48

In total, it is apparent that TNF-alpha apparently is highly involved in reparative

features. The role of TNF can vary with the type, severity and stage of the injury

(Tidball, 2005).

Concluding remarks

It is apparent that myositis and the painful situations for humans investigated

(peritendinous tissue) can be added to the list of situations where the TNF-alpha

system is upregulated. Of particular interest from an original point of view are the

different findings for TNFR1 and TNFR2 for the muscle fibers and the

comparatively marked receptor reactivities for the nerve fascicles. The differences

in the expression patterns for the two TNF receptors in the animal experiment

favour a hypothesis that they have diverse actions in both healthy and damaged

muscle tissue. The findings for the receptors for the nerve fascicles, including on

the contralateral side, indeed show that the TNF-alpha system has effect on the

nervous system.

49

Acknowledgements

There are several people that I am grateful to. I want to thank you all for support

and patience, guidance and encouragement over the years. Without you this

Thesis would never have been completed. In particular warmly thanks to:

Sture Forsgren, my fantastic supervisor and friend. Thank you for the

tremendous work you have laid on me, for my development during the time as a

PhD student. You are funny, kind and caring and always have the time to help.

Thank you for your guidance and patience. I could never had a better supervisor

and for that I am forever grateful.

Per Stål, my co-supervisor. Thank you for all that you have taught me about

muscles. You have always been there to help and encourage me.

Håkan Alfredson, my co-supervisor. Thank you for your enthusiasm and

teaching. You are an inspiration.

Anna-Karin Olofsson and Ulla Hedlund, thank you for all the teaching and

help in the lab. You are great mentors and were always there to support me. You

have taught me everything I know about the lab. Also thank you for your inspiring

good mood and patience, even though I sometimes failed with what I was doing

in the lab.

Christoph Spang, my “extra” supervisor and friend, which I shared the smallest

office in the Anatomy Department with. Thank you for your encouragement and

a great collaboration. I would also like to thank you for the fun times we have had

outside the lab.

Yafeng Song, my co-worker and friend. Thank you for great collaboration in

article II, III and all the laughs we have had together.

Gustav Andersson, my co-worker and friend. Thank you for all that you have

learned me! You are inspiring in the way you are; hard working, successful and

always happy.

Ludvig Backman, my co-worker and friend. Even though we never had worked

together in a project, I know that you are very good at what you do and are a great

teacher. Thank you for the interesting discussions and laughs in the lab.

50

To Anita Dreyer-Perkiömäki, Anna-Lena Tallander and Selamit

Kefala for your administrative assistance. Thank you Göran Dahlgren who

allowed me to work with a PC when everyone else wanted a Macintosh. You

were always there to fix any kind of technical problems.

To Lotta Alfredson for the help with the biopsies.

To Jamie Gaida and Craig Purdam for collaboration in article I

To Ronny Lorentzon, Clas Backman, Adrian Lamaroux and Fellon

Robson-Long for the work with the experimental rabbit model. That includes

thanks to Ronny for the injection experiments.

And thank you to all others former or present co-workers at the Department of

Integrative Medical Biology. You all contribute to the pleasant atmosphere at the

department. Special thanks to; Mona Lidström, Paul Kingham, Peyman

Kelk, Farhan Shah, Patrik Danielson, Vahid Harandi, Sandrine

LeRoux, Johan Bagge, Anton Tjust, Gloria Fong, Gunnel Folkesson,

Jinxia Liu, Fatima Pedrosa-Domellöf, Lev Novikov, Ludmila Novikova

and Eva Carlsson. Paul also for borrowing of antibodies.

And finally but not the least, thank you to my loved ones. Thanks to my love,

Jocke Lindström who is always there for me. Thank you for all the times you

have picked me up after a late train back from Umeå, thank you for all the support

at home. Thanks to my parents, Bo Renström and Stina Renström. You are

my idols and I will always be inspired of you. Thank you to my beloved sisters and

best friends, Ida Renström and Hanna Renström. You have been a great

support.

Thank you Sabina Renström and Oskar Johansson, my dear friends. You

have the absolutely best hotel in town. Thank you for all the times I have slept on

your cozy cough, thank you for all the times you have cooked me dinner and thank

you for all the times you have picked me up at the train station. It would never

have been possible without you. Thanks also to Margaretha Fahlström for

letting me stay at your place in Berghem, and Frida Fahlström and Anton

Petterson who also had me as a guest severeal times in Vännfors.

51

Funding

Financial support was obtained from the Faculty of Medicine, Umeå University,

Idrottshögskolan, Umeå University, the J.C. Kempe and Seth M. Kempe

Memorial Foundations, Örnsköldsvik, Magn Bergvalls Stiftelse, The Swedish

National Centre for Research in Sports (CIF) and Margareta, Kjell and Håkan

Alfredsons Stiftelsen.

The founders had no role in study design, data collection and analysis, decision

to publish or preparation of the manuscript.

52

References

ACKERMANN, P. W., LI, J., LUNDEBERG, T. & KREICBERGS, A. 2003. Neuronal plasticity in relation to nociception and healing of rat achilles tendon. J Orthop Res, 21, 432-41.

AHMED, I. M., LAGOPOULOS, M., MCCONNELL, P., SOAMES, R. W. & SEFTON, G. K. 1998. Blood supply of the Achilles tendon. J Orthop Res, 16, 591-6.

ALBAYDA, J. & CHRISTOPHER-STINE, L. 2012. Novel approaches in the treatment of myositis and myopathies. Ther Adv Musculoskelet Dis, 4, 369-77.

ALFREDSON, H. 2005. The chronic painful Achilles and patellar tendon: research on basic biology and treatment. Scand J Med Sci Sports, 15, 252-9.

ALFREDSON, H. 2011. Midportion Achilles tendinosis and the plantaris tendon. Br J Sports Med, 45, 1023-5.

ALFREDSON, H. & LORENTZON, R. 2000. Chronic Achilles tendinosis: recommendations for treatment and prevention. Sports Med, 29, 135-46.

AMATO, A. A. T., R.; KISSEL, J.; BAROHN, R. 2011. A randomized, pilot trial of etanercept in dermatomyositis. Ann Neurol, 70, 427-36.

ANANDACOOMARASAMY, A., HOWE, G. & MANOLIOS, N. 2005. Advanced refractory polymyositis responding to infliximab. Rheumatology (Oxford), 44, 562-3.

ANDERSSON, G., DANIELSON, P., ALFREDSON, H. & FORSGREN, S. 2007. Nerve-related characteristics of ventral paratendinous tissue in chronic Achilles tendinosis. Knee Surg Sports Traumatol Arthrosc, 15, 1272-9.

ANDRADE, P., HOOGLAND, G., DEL ROSARIO, J. S., STEINBUSCH, H. W., VISSER-VANDEWALLE, V. & DAEMEN, M. A. 2014. Tumor necrosis factor-alpha inhibitors alleviation of experimentally induced neuropathic pain is associated with modulation of TNF receptor expression. J Neurosci Res, 92, 1490-8.

ANSEL, J. C., BROWN, J. R., PAYAN, D. G. & BROWN, M. A. 1993. Substance P selectively activates TNF-alpha gene expression in murine mast cells. J Immunol, 150, 4478-85.

ARMSTRONG, R. B., OGILVIE, R. W. & SCHWANE, J. A. 1983. Eccentric exercise-induced injury to rat skeletal muscle. J Appl Physiol Respir Environ Exerc Physiol, 54, 80-93.

ARMSTRONG, R. B., WARREN, G. L. & WARREN, J. A. 1991. Mechanisms of exercise-induced muscle fibre injury. Sports Med, 12, 184-207.

ASHTON-MILLER, J. A. 1999. Response of Muscle and Tendon to Injury and Overuse. Work-Related Musculoskeletal Disorders: Report, Workshop Summary, and Workshop Papers. Washington (DC).

BACKMAN, C., BOQUIST, L., FRIDEN, J., LORENTZON, R. & TOOLANEN, G. 1990. Chronic achilles paratenonitis with tendinosis: an experimental model in the rabbit. J Orthop Res, 8, 541-7.

53

BAER, A. N. 2006. Advances in the therapy of idiopathic inflammatory myopathies. Curr Opin Rheumatol, 18, 236-41.

BAER, M., DILLNER, A., SCHWARTZ, R. C., SEDON, C., NEDOSPASOV, S. & JOHNSON, P. F. 1998. Tumor necrosis factor alpha transcription in macrophages is attenuated by an autocrine factor that preferentially induces NF-kappaB p50. Mol Cell Biol, 18, 5678-89.

BALKWILL, F. 2009. Tumour necrosis factor and cancer. Nat Rev Cancer, 9, 361-71.

BALUK, P., YAO, L. C., FENG, J., ROMANO, T., JUNG, S. S., SCHREITER, J. L., YAN, L., SHEALY, D. J. & MCDONALD, D. M. 2009. TNF-alpha drives remodeling of blood vessels and lymphatics in sustained airway inflammation in mice. J Clin Invest, 119, 2954-64.

BARBE, M. F. & BARR, A. E. 2006. Inflammation and the pathophysiology of work-related musculoskeletal disorders. Brain Behav Immun, 20, 423-9.

BJUR, D. 2009. Thesis, The human Achilles tendon. Thesis, Umeå University. BLACK, R. A., RAUCH, C. T., KOZLOSKY, C. J., PESCHON, J. J., SLACK, J. L.,

WOLFSON, M. F., CASTNER, B. J., STOCKING, K. L., REDDY, P., SRINIVASAN, S., NELSON, N., BOIANI, N., SCHOOLEY, K. A., GERHART, M., DAVIS, R., FITZNER, J. N., JOHNSON, R. S., PAXTON, R. J., MARCH, C. J. & CERRETTI, D. P. 1997. A metalloproteinase disintegrin that releases tumour-necrosis factor-alpha from cells. Nature, 385, 729-33.

BOETTGER, M. K., HENSELLEK, S., RICHTER, F., GAJDA, M., STOCKIGT, R., VON BANCHET, G. S., BRAUER, R. & SCHAIBLE, H. G. 2008. Antinociceptive effects of tumor necrosis factor alpha neutralization in a rat model of antigen-induced arthritis: evidence of a neuronal target. Arthritis Rheum, 58, 2368-78.

BONGARTZ, T., SUTTON, A. J., SWEETING, M. J., BUCHAN, I., MATTESON, E. L. & MONTORI, V. 2006. Anti-TNF antibody therapy in rheumatoid arthritis and the risk of serious infections and malignancies: systematic review and meta-analysis of rare harmful effects in randomized controlled trials. JAMA, 295, 2275-85.

BOUSHEL, R., LANGBERG, H., GREEN, S., SKOVGAARD, D., BULOW, J. & KJAER, M. 2000. Blood flow and oxygenation in peritendinous tissue and calf muscle during dynamic exercise in humans. J Physiol, 524 Pt 1, 305-13.

BRAUN, J., BARALIAKOS, X., BRANDT, J., LISTING, J., ZINK, A., ALTEN, R., BURMESTER, G., GROMNICA-IHLE, E., KELLNER, H., SCHNEIDER, M., SORENSEN, H., ZEIDLER, H. & SIEPER, J. 2005. Persistent clinical response to the anti-TNF-alpha antibody infliximab in patients with ankylosing spondylitis over 3 years. Rheumatology (Oxford), 44, 670-6.

BRENNAN, F. M., CHANTRY, D., JACKSON, A., MAINI, R. & FELDMANN, M. 1989. Inhibitory effect of TNF alpha antibodies on synovial cell interleukin-1 production in rheumatoid arthritis. Lancet, 2, 244-7.

BROCKHAUS, M., SCHOENFELD, H. J., SCHLAEGER, E. J., HUNZIKER, W., LESSLAUER, W. & LOETSCHER, H. 1990. Identification of two types of tumor necrosis factor receptors on human cell lines by monoclonal antibodies. Proc Natl Acad Sci U S A, 87, 3127-31.

54

BROOKE, M. H. & KAISER, K. K. 1970. Muscle fiber types: how many and what kind? Arch Neurol, 23, 369-79.

BRUNASSO, A. M., ABERER, W. & MASSONE, C. 2014. New onset of dermatomyositis/polymyositis during anti-TNF-alpha therapies: a systematic literature review. ScientificWorldJournal, 2014, 179180.

BRUNELLESCHI, S., BORDIN, G., COLANGELO, D. & VIANO, I. 1998. Tachykinin receptors on human monocytes: their involvement in rheumatoid arthritis. Neuropeptides, 32, 215-23.

BRUUSGAARD, J. C., LIESTOL, K., EKMARK, M., KOLLSTAD, K. & GUNDERSEN, K. 2003. Number and spatial distribution of nuclei in the muscle fibres of normal mice studied in vivo. J Physiol, 551, 467-78.

BUYUKAKILLI, B., ATICI, A., BALLI, E., OZKAN, A., GURGUL, S., TASDELEN, B. & DAGTEKIN, O. 2014. Effects of a tumor necrosis factor-alpha inhibitor (etanercept) on the sciatic nerve in a hypoxic ischemia-induced neonatal rat model. Adv Clin Exp Med, 23, 705-13.

CADOT, B., GACHE, V. & GOMES, E. R. 2015. Moving and positioning the nucleus in skeletal muscle - one step at a time. Nucleus, 6, 373-81.

CAMARA-LEMARROY, C. R., GUZMAN-DE LA GARZA, F. J. & FERNANDEZ-GARZA, N. E. 2010. Molecular inflammatory mediators in peripheral nerve degeneration and regeneration. Neuroimmunomodulation, 17, 314-24.

CAPERS, C. R. 1960. Multinucleation of skeletal muscle in vitro. J Biophys Biochem Cytol, 7, 559-66.

CARATSCH, C. G., SANTONI, A. & EUSEBI, F. 1994. Interferon-alpha, beta and tumor necrosis factor-alpha enhance the frequency of miniature end-plate potentials at rat neuromuscular junction. Neurosci Lett, 166, 97-100.

CARLSON, B. M. 1973. The regeneration of skeletal muscle. A review. Am J Anat, 137, 119-49.

CARR, A. J. & NORRIS, S. H. 1989. The blood supply of the calcaneal tendon. J Bone Joint Surg Br, 71, 100-1.

CARSTENS, P. O. & SCHMIDT, J. 2014. Diagnosis, pathogenesis and treatment of myositis: recent advances. Clin Exp Immunol, 175, 349-58.

CARSWELL, E. A., OLD, L. J., KASSEL, R. L., GREEN, S., FIORE, N. & WILLIAMSON, B. 1975. An endotoxin-induced serum factor that causes necrosis of tumors. Proc Natl Acad Sci U S A, 72, 3666-70.

CHACUR, M., MILLIGAN, E. D., GAZDA, L. S., ARMSTRONG, C., WANG, H., TRACEY, K. J., MAIER, S. F. & WATKINS, L. R. 2001. A new model of sciatic inflammatory neuritis (SIN): induction of unilateral and bilateral mechanical allodynia following acute unilateral peri-sciatic immune activation in rats. Pain, 94, 231-44.

CHEN, S. E., JIN, B. & LI, Y. P. 2007. TNF-alpha regulates myogenesis and muscle regeneration by activating p38 MAPK. Am J Physiol Cell Physiol, 292, C1660-71.

CHEN, T. M., ROZEN, W. M., PAN, W. R., ASHTON, M. W., RICHARDSON, M. D. & TAYLOR, G. I. 2009. The arterial anatomy of the Achilles tendon: anatomical study and clinical implications. Clin Anat, 22, 377-85.

CHEVREL, G., GRANET, C. & MIOSSEC, P. 2005. Contribution of tumour necrosis factor alpha and interleukin (IL) 1beta to IL6 production, NF-

55

kappaB nuclear translocation, and class I MHC expression in muscle cells: in vitro regulation with specific cytokine inhibitors. Ann Rheum Dis, 64, 1257-62.

CHU, C. Q., FIELD, M., FELDMANN, M. & MAINI, R. N. 1991. Localization of tumor necrosis factor alpha in synovial tissues and at the cartilage-pannus junction in patients with rheumatoid arthritis. Arthritis Rheum, 34, 1125-32.

COLLINS, C. A., OLSEN, I., ZAMMIT, P. S., HESLOP, L., PETRIE, A., PARTRIDGE, T. A. & MORGAN, J. E. 2005. Stem cell function, self-renewal, and behavioral heterogeneity of cells from the adult muscle satellite cell niche. Cell, 122, 289-301.

COUDERC, M., MATHIEU, S., TOURNADRE, A., DUBOST, J. J. & SOUBRIER, M. 2014. Acute ocular myositis occurring under etanercept for rheumatoid arthritis. Joint Bone Spine, 81, 445-6.

CRAMERI, R. M., AAGAARD, P., QVORTRUP, K., LANGBERG, H., OLESEN, J. & KJAER, M. 2007. Myofibre damage in human skeletal muscle: effects of electrical stimulation versus voluntary contraction. J Physiol, 583, 365-80.

CUMMINS, E. J., ANSON, B. J. & ET AL. 1946. The structure of the calcaneal tendon (of Achilles) in relation to orthopedic surgery, with additional observations on the plantaris muscle. Surg Gynecol Obstet, 83, 107-16.

DE BLEECKER, J. L., MEIRE, V. I., DECLERCQ, W. & VAN AKEN, E. H. 1999. Immunolocalization of tumor necrosis factor-alpha and its receptors in inflammatory myopathies. Neuromuscul Disord, 9, 239-46.

DECLERCQ, W., DENECKER, G., FIERS, W. & VANDENABEELE, P. 1998. Cooperation of both TNF receptors in inducing apoptosis: involvement of the TNF receptor-associated factor binding domain of the TNF receptor 75. J Immunol, 161, 390-9.

DENADAI-SOUZA, A., CAMARGO LDE, L., RIBELA, M. T., KEEBLE, J. E., COSTA, S. K. & MUSCARA, M. N. 2009. Participation of peripheral tachykinin NK1 receptors in the carrageenan-induced inflammation of the rat temporomandibular joint. Eur J Pain, 13, 812-9.

DENNETT, X. & FRY, H. J. 1988. Overuse syndrome: a muscle biopsy study. Lancet, 1, 905-8.

DOHERTY, G. P., KOIKE, Y., UHTHOFF, H. K., LECOMPTE, M. & TRUDEL, G. 2006. Comparative anatomy of rabbit and human achilles tendons with magnetic resonance and ultrasound imaging. Comp Med, 56, 68-74.

DONG, Y., FISCHER, R., NAUDE, P. J., MAIER, O., NYAKAS, C., DUFFEY, M., VAN DER ZEE, E. A., DEKENS, D., DOUWENGA, W., HERRMANN, A., GUENZI, E., KONTERMANN, R. E., PFIZENMAIER, K. & EISEL, U. L. 2016. Essential protective role of tumor necrosis factor receptor 2 in neurodegeneration. Proc Natl Acad Sci U S A, 113, 12304-12309.

DORAL, M. N., ALAM, M., BOZKURT, M., TURHAN, E., ATAY, O. A., DONMEZ, G. & MAFFULLI, N. 2010. Functional anatomy of the Achilles tendon. Knee Surg Sports Traumatol Arthrosc, 18, 638-43.

DOS SANTOS, M. A., BERTELLI, J. A., KECHELE, P. R. & DUARTE, H. 2009. Anatomical study of the plantaris tendon: reliability as a tendo-osseous graft. Surg Radiol Anat, 31, 59-61.

56

EDHOLM, P., STRANDBERG, E. & KADI, F. 2017. Lower limb explosive strength capacity in elderly women: effects of resistance training and healthy diet. J Appl Physiol (1985), 123, 190-196.

EFTHIMIOU, P., SCHWARTZMAN, S. & KAGEN, L. J. 2006. Possible role for tumour necrosis factor inhibitors in the treatment of resistant dermatomyositis and polymyositis: a retrospective study of eight patients. Ann Rheum Dis, 65, 1233-6.

EKBLAD, E., MEI, Q. & SUNDLER, F. 2000. Innervation of the gastric mucosa. Microsc Res Tech, 48, 241-57.

ELLIOTT, D. H. 1965. Structure and Function of Mammalian Tendon. Biol Rev Camb Philos Soc, 40, 392-421.

FAJARDO, L. F., KWAN, H. H., KOWALSKI, J., PRIONAS, S. D. & ALLISON, A. C. 1992. Dual role of tumor necrosis factor-alpha in angiogenesis. Am J Pathol, 140, 539-44.

FEDCZYNA, T. O., LUTZ, J. & PACHMAN, L. M. 2001. Expression of TNFalpha by muscle fibers in biopsies from children with untreated juvenile dermatomyositis: association with the TNFalpha-308A allele. Clin Immunol, 100, 236-9.

FELDMANN, M., BRENNAN, F. M. & MAINI, R. N. 1996. Role of cytokines in rheumatoid arthritis. Annu Rev Immunol, 14, 397-440.

FIRESTEIN, G. S., ALVARO-GRACIA, J. M. & MAKI, R. 1990. Quantitative analysis of cytokine gene expression in rheumatoid arthritis. J Immunol, 144, 3347-53.

FONG, Y., TRACEY, K. J., MOLDAWER, L. L., HESSE, D. G., MANOGUE, K. B., KENNEY, J. S., LEE, A. T., KUO, G. C., ALLISON, A. C., LOWRY, S. F. & ET AL. 1989. Antibodies to cachectin/tumor necrosis factor reduce interleukin 1 beta and interleukin 6 appearance during lethal bacteremia. J Exp Med, 170, 1627-33.

FONTAINE, V., MOHAND-SAID, S., HANOTEAU, N., FUCHS, C., PFIZENMAIER, K. & EISEL, U. 2002. Neurodegenerative and neuroprotective effects of tumor Necrosis factor (TNF) in retinal ischemia: opposite roles of TNF receptor 1 and TNF receptor 2. J Neurosci, 22, RC216.

FOTIN-MLECZEK, M., HENKLER, F., SAMEL, D., REICHWEIN, M., HAUSSER, A., PARMRYD, I., SCHEURICH, P., SCHMID, J. A. & WAJANT, H. 2002. Apoptotic crosstalk of TNF receptors: TNF-R2-induces depletion of TRAF2 and IAP proteins and accelerates TNF-R1-dependent activation of caspase-8. J Cell Sci, 115, 2757-70.

FRIDEN, J. & LIEBER, R. L. 1992. Structural and mechanical basis of exercise-induced muscle injury. Med Sci Sports Exerc, 24, 521-30.

FRIDEN, J., LIEBER, R. L., MYERS, R. R., POWELL, H. C. & HARGENS, A. R. 1989. Myoneural necrosis following high-frequency electrical stimulation of the cast-immobilized rabbit hindlimb. Stereotact Funct Neurosurg, 53, 261-73.

FRIDEN, J., SJOSTROM, M. & EKBLOM, B. 1983. Myofibrillar damage following intense eccentric exercise in man. Int J Sports Med, 4, 170-6.

GABRIEL, D. A., KAMEN, G. & FROST, G. 2006. Neural adaptations to resistive exercise: mechanisms and recommendations for training practices. Sports Med, 36, 133-49.

57

GAIDA, J. E., BAGGE, J., PURDAM, C., COOK, J., ALFREDSON, H. & FORSGREN, S. 2012. Evidence of the TNF-alpha system in the human Achilles tendon: expression of TNF-alpha and TNF receptor at both protein and mRNA levels in the tenocytes. Cells Tissues Organs, 196, 339-52.

GALLANTI, A., PRELLE, A., MOGGIO, M., CISCATO, P., CHECCARELLI, N., SCIACCO, M., COMINI, A. & SCARLATO, G. 1992. Desmin and vimentin as markers of regeneration in muscle diseases. Acta Neuropathol, 85, 88-92.

GAZELEY, D. J. & CRONIN, M. E. 2011. Diagnosis and treatment of the idiopathic inflammatory myopathies. Ther Adv Musculoskelet Dis, 3, 315-24.

GESSLEIN, B., HAKANSSON, G., GUSTAFSSON, L., EKSTROM, P. & MALMSJO, M. 2010. Tumor necrosis factor and its receptors in the neuroretina and retinal vasculature after ischemia-reperfusion injury in the pig retina. Mol Vis, 16, 2317-27.

GOLLNICK, P. D., SJODIN, B., KARLSSON, J., JANSSON, E. & SALTIN, B. 1974. Human soleus muscle: a comparison of fiber composition and enzyme activities with other leg muscles. Pflugers Arch, 348, 247-55.

GONZALEZ-FREIRE, M., DE CABO, R., STUDENSKI, S. A. & FERRUCCI, L. 2014. The Neuromuscular Junction: Aging at the Crossroad between Nerves and Muscle. Front Aging Neurosci, 6, 208.

GORDON, P. A., WINER, J. B., HOOGENDIJK, J. E. & CHOY, E. H. 2012. Immunosuppressant and immunomodulatory treatment for dermatomyositis and polymyositis. Cochrane Database Syst Rev, CD003643.

GREFTE, S., KUIJPERS-JAGTMAN, A. M., TORENSMA, R. & VON DEN HOFF, J. W. 2007. Skeletal muscle development and regeneration. Stem Cells Dev, 16, 857-68.

GROUNDS, M. D., RADLEY, H. G., GEBSKI, B. L., BOGOYEVITCH, M. A. & SHAVLAKADZE, T. 2008. Implications of cross-talk between tumour necrosis factor and insulin-like growth factor-1 signalling in skeletal muscle. Clin Exp Pharmacol Physiol, 35, 846-51.

GRUNDTMAN, C. & LUNDBERG, I. E. 2009. Vascular involvement in the pathogenesis of idiopathic inflammatory myopathies. Autoimmunity, 42, 615-26.

GULATI, V., JAGGARD, M., AL-NAMMARI, S. S., UZOIGWE, C., GULATI, P., ISMAIL, N., GIBBONS, C. & GUPTE, C. 2015. Management of achilles tendon injury: A current concepts systematic review. World J Orthop, 6, 380-6.

HAFER-MACKO, C. E., YU, S., RYAN, A. S., IVEY, F. M. & MACKO, R. F. 2005. Elevated tumor necrosis factor-alpha in skeletal muscle after stroke. Stroke, 36, 2021-3.

HAWORTH, C., BRENNAN, F. M., CHANTRY, D., TURNER, M., MAINI, R. N. & FELDMANN, M. 1991. Expression of granulocyte-macrophage colony-stimulating factor in rheumatoid arthritis: regulation by tumor necrosis factor-alpha. Eur J Immunol, 21, 2575-9.

HENDERSON, C. & DAVIS, J. C. 2006. Drug insight: anti-tumor-necrosis-factor therapy for ankylosing spondylitis. Nat Clin Pract Rheumatol, 2, 211-8.

58

HENGSTMAN, G. J., VAN DEN HOOGEN, F. H., BARRERA, P., NETEA, M. G., PIETERSE, A., VAN DE PUTTE, L. B. & VAN ENGELEN, B. G. 2003. Successful treatment of dermatomyositis and polymyositis with anti-tumor-necrosis-factor-alpha: preliminary observations. Eur Neurol, 50, 10-5.

HESS, A., AXMANN, R., RECH, J., FINZEL, S., HEINDL, C., KREITZ, S., SERGEEVA, M., SAAKE, M., GARCIA, M., KOLLIAS, G., STRAUB, R. H., SPORNS, O., DOERFLER, A., BRUNE, K. & SCHETT, G. 2011. Blockade of TNF-alpha rapidly inhibits pain responses in the central nervous system. Proc Natl Acad Sci U S A, 108, 3731-6.

HESS, G. P., CAPPIELLO, W. L., POOLE, R. M. & HUNTER, S. C. 1989. Prevention and treatment of overuse tendon injuries. Sports Med, 8, 371-84.

HIKIDA, R. S., STARON, R. S., HAGERMAN, F. C., SHERMAN, W. M. & COSTILL, D. L. 1983. Muscle fiber necrosis associated with human marathon runners. J Neurol Sci, 59, 185-203.

HILL, M., WERNIG, A. & GOLDSPINK, G. 2003. Muscle satellite (stem) cell activation during local tissue injury and repair. J Anat, 203, 89-99.

HODGETTS, S., RADLEY, H., DAVIES, M. & GROUNDS, M. D. 2006. Reduced necrosis of dystrophic muscle by depletion of host neutrophils, or blocking TNFalpha function with Etanercept in mdx mice. Neuromuscul Disord, 16, 591-602.

HOFFMANN, A. & GROSS, G. 2007. Tendon and ligament engineering in the adult organism: mesenchymal stem cells and gene-therapeutic approaches. Int Orthop, 31, 791-7.

HOKFELT, T., BEAN, A., CECCATELLI, S., DAGERLIND, A., ELDE, R. P., GOLDSTEIN, M., MEISTER, B., MELANDER, T., NICHOLAS, A. P., PELTO-HUIKKO, M. & ET AL. 1992. Neuropeptides and classical transmitters. Localization and interaction. Arzneimittelforschung, 42, 196-201.

HOSAKA, Y., KIRISAWA, R., UEDA, H., YAMAGUCHI, M. & TAKEHANA, K. 2005. Differences in tumor necrosis factor (TNF)alpha and TNF receptor-1-mediated intracellular signaling factors in normal, inflamed and scar-formed horse tendons. J Vet Med Sci, 67, 985-91.

HUISMAN, E. S., ANDERSSON, G., SCOTT, A., RENO, C. R., HART, D. A. & THORNTON, G. M. 2014. Regional molecular and cellular differences in the female rabbit Achilles tendon complex: potential implications for understanding responses to loading. J Anat, 224, 538-47.

INGJER, F. & BRODAL, P. 1978. Capillary supply of skeletal muscle fibers in untrained and endurance-trained women. Eur J Appl Physiol Occup Physiol, 38, 291-9.

INOUE, J., ISHIDA, T., TSUKAMOTO, N., KOBAYASHI, N., NAITO, A., AZUMA, S. & YAMAMOTO, T. 2000. Tumor necrosis factor receptor-associated factor (TRAF) family: adapter proteins that mediate cytokine signaling. Exp Cell Res, 254, 14-24.

JANCALEK, R., DUBOVY, P., SVIZENSKA, I. & KLUSAKOVA, I. 2010. Bilateral changes of TNF-alpha and IL-10 protein in the lumbar and cervical dorsal root ganglia following a unilateral chronic constriction injury of the sciatic nerve. J Neuroinflammation, 7, 11.

59

JARVINEN, T. A., KANNUS, P., MAFFULLI, N. & KHAN, K. M. 2005. Achilles tendon disorders: etiology and epidemiology. Foot Ankle Clin, 10, 255-66.

JOZSA, L., LEHTO, M., KVIST, M., BALINT, J. B. & REFFY, A. 1989. Alterations in dry mass content of collagen fibers in degenerative tendinopathy and tendon-rupture. Matrix, 9, 140-6.

KADI, F. & THORNELL, L. E. 1999. Training affects myosin heavy chain phenotype in the trapezius muscle of women. Histochem Cell Biol, 112, 73-8.

KALOVIDOURIS, A. E. & PLOTKIN, Z. 1995. Synergistic cytotoxic effect of interferon-gamma and tumor necrosis factor-alpha on cultured human muscle cells. J Rheumatol, 22, 1698-703.

KANNUS, P. 2000. Structure of the tendon connective tissue. Scand J Med Sci Sports, 10, 312-20.

KARALAKI, M., FILI, S., PHILIPPOU, A. & KOUTSILIERIS, M. 2009. Muscle regeneration: cellular and molecular events. In Vivo, 23, 779-96.

KAUFMAN, K. R., BRODINE, S. K., SHAFFER, R. A., JOHNSON, C. W. & CULLISON, T. R. 1999. The effect of foot structure and range of motion on musculoskeletal overuse injuries. Am J Sports Med, 27, 585-93.

KAWAMURA, N., TAMURA, H., OBANA, S., WENNER, M., ISHIKAWA, T., NAKATA, A. & YAMAMOTO, H. 1998. Differential effects of neuropeptides on cytokine production by mouse helper T cell subsets. Neuroimmunomodulation, 5, 9-15.

KHAN, K. M., COOK, J. L., BONAR, F., HARCOURT, P. & ASTROM, M. 1999. Histopathology of common tendinopathies. Update and implications for clinical management. Sports Med, 27, 393-408.

KJAER, M., BAYER, M. L., ELIASSON, P. & HEINEMEIER, K. M. 2013. What is the impact of inflammation on the critical interplay between mechanical signaling and biochemical changes in tendon matrix? J Appl Physiol (1985), 115, 879-83.

KOLB, W. P. & GRANGER, G. A. 1968. Lymphocyte in vitro cytotoxicity: characterization of human lymphotoxin. Proc Natl Acad Sci U S A, 61, 1250-5.

KOMI, P. V., VIITASALO, J. T., RAURAMAA, R. & VIHKO, V. 1978. Effect of isometric strength training of mechanical, electrical, and metabolic aspects of muscle function. Eur J Appl Physiol Occup Physiol, 40, 45-55.

KONDO, M., MURAKAWA, Y., HARASHIMA, N., KOBAYASHI, S., YAMAGUCHI, S. & HARADA, M. 2009. Roles of proinflammatory cytokines and the Fas/Fas ligand interaction in the pathogenesis of inflammatory myopathies. Immunology, 128, e589-99.

KORTHUIS, R. J. 2011. Book. Skeletal Muscle Circulation. San Rafael (CA). KOST, A. L. & KOST, G. J. 1982. A comparison of fiber types and measurement

techniques in the medial gastrocnemius and soleus muscles of the rabbit. Microsc Acta, 86, 25-36.

KRIEGLER, M., PEREZ, C., DEFAY, K., ALBERT, I. & LU, S. D. 1988. A novel form of TNF/cachectin is a cell surface cytotoxic transmembrane protein: ramifications for the complex physiology of TNF. Cell, 53, 45-53.

KURU, S., INUKAI, A., KATO, T., LIANG, Y., KIMURA, S. & SOBUE, G. 2003. Expression of tumor necrosis factor-alpha in regenerating muscle fibers

60

in inflammatory and non-inflammatory myopathies. Acta Neuropathol, 105, 217-24.

KVIST, M. 1991. Achilles tendon injuries in athletes. Ann Chir Gynaecol, 80, 188-201.

KVIST, M. 1994. Achilles tendon injuries in athletes. Sports Med, 18, 173-201. LA FLEUR, M., UNDERWOOD, J. L., RAPPOLEE, D. A. & WERB, Z. 1996.

Basement membrane and repair of injury to peripheral nerve: defining a potential role for macrophages, matrix metalloproteinases, and tissue inhibitor of metalloproteinases-1. J Exp Med, 184, 2311-26.

LEXELL, J. 1995. Human aging, muscle mass, and fiber type composition. J Gerontol A Biol Sci Med Sci, 50 Spec No, 11-6.

LIDBURY, B. A., RULLI, N. E., SUHRBIER, A., SMITH, P. N., MCCOLL, S. R., CUNNINGHAM, A. L., TARKOWSKI, A., VAN ROOIJEN, N., FRASER, R. J. & MAHALINGAM, S. 2008. Macrophage-derived proinflammatory factors contribute to the development of arthritis and myositis after infection with an arthrogenic alphavirus. J Infect Dis, 197, 1585-93.

LIEBER, R. L., THORNELL, L. E. & FRIDEN, J. 1996. Muscle cytoskeletal disruption occurs within the first 15 min of cyclic eccentric contraction. J Appl Physiol (1985), 80, 278-84.

LIU, S. W., VELEZ, N. F., LAM, C., FEMIA, A., GRANTER, S. R., TOWNSEND, H. B. & VLEUGELS, R. A. 2013. Dermatomyositis induced by anti-tumor necrosis factor in a patient with juvenile idiopathic arthritis. JAMA Dermatol, 149, 1204-8.

LIU, T., CLARK, R. K., MCDONNELL, P. C., YOUNG, P. R., WHITE, R. F., BARONE, F. C. & FEUERSTEIN, G. Z. 1994. Tumor necrosis factor-alpha expression in ischemic neurons. Stroke, 25, 1481-8.

LJUNG, B. O., FORSGREN, S. & FRIDEN, J. 1999. Sympathetic and sensory innervations are heterogeneously distributed in relation to the blood vessels at the extensor carpi radialis brevis muscle origin of man. Cells Tissues Organs, 165, 45-54.

LOVE, L. A., LEFF, R. L., FRASER, D. D., TARGOFF, I. N., DALAKAS, M., PLOTZ, P. H. & MILLER, F. W. 1991. A new approach to the classification of idiopathic inflammatory myopathy: myositis-specific autoantibodies define useful homogeneous patient groups. Medicine (Baltimore), 70, 360-74.

LUBER-NAROD, J., KAGE, R. & LEEMAN, S. E. 1994. Substance P enhances the secretion of tumor necrosis factor-alpha from neuroglial cells stimulated with lipopolysaccharide. J Immunol, 152, 819-24.

LUO, D., LUO, Y., HE, Y., ZHANG, H., ZHANG, R., LI, X., DOBRUCKI, W. L., SINUSAS, A. J., SESSA, W. C. & MIN, W. 2006. Differential functions of tumor necrosis factor receptor 1 and 2 signaling in ischemia-mediated arteriogenesis and angiogenesis. Am J Pathol, 169, 1886-98.

MAFFULLI, N., SHARMA, P. & LUSCOMBE, K. L. 2004. Achilles tendinopathy: aetiology and management. J R Soc Med, 97, 472-6.

MALIK, A., HAYAT, G., KALIA, J. S. & GUZMAN, M. A. 2016. Idiopathic Inflammatory Myopathies: Clinical Approach and Management. Front Neurol, 7, 64.

MASCI, L., SPANG, C., VAN SCHIE, H. T. & ALFREDSON, H. 2015. Achilles tendinopathy-do plantaris tendon removal and Achilles tendon scraping

61

improve tendon structure? A prospective study using ultrasound tissue characterisation. BMJ Open Sport Exerc Med, 1, e000005.

MASTAGLIA, F. L. 2008. Inflammatory muscle diseases. Neurol India, 56, 263-70.

MAUGHAN, R. J., WATSON, J. S. & WEIR, J. 1983. Strength and cross-sectional area of human skeletal muscle. J Physiol, 338, 37-49.

MAURO, A. 1961. Satellite cell of skeletal muscle fibers. J Biophys Biochem Cytol, 9, 493-5.

MILLAR, N. L., WEI, A. Q., MOLLOY, T. J., BONAR, F. & MURRELL, G. A. 2009. Cytokines and apoptosis in supraspinatus tendinopathy. J Bone Joint Surg Br, 91, 417-24.

MORIMOTO, I. & OGATA, T. 1968. [Torsion of the achilles tendon in man and its anatomical and surgical significance]. Kaibogaku Zasshi, 43, 295-302.

MOSS, F. P. & LEBLOND, C. P. 1970. Nature of dividing nuclei in skeletal muscle of growing rats. J Cell Biol, 44, 459-62.

MUNRO, J. M., POBER, J. S. & COTRAN, R. S. 1989. Tumor necrosis factor and interferon-gamma induce distinct patterns of endothelial activation and associated leukocyte accumulation in skin of Papio anubis. Am J Pathol, 135, 121-33.

MURPHY, P. G., GRONDIN, J., ALTARES, M. & RICHARDSON, P. M. 1995. Induction of interleukin-6 in axotomized sensory neurons. J Neurosci, 15, 5130-8.

NAUDE, P. J., DEN BOER, J. A., LUITEN, P. G. & EISEL, U. L. 2011. Tumor necrosis factor receptor cross-talk. FEBS J, 278, 888-98.

NAYAK, S. R., KRISHNAMURTHY, A., RAMANATHAN, L., RANADE, A. V., PRABHU, L. V., JIJI, P. J., RAI, R., CHETTIAR, G. K. & POTU, B. K. 2010. Anatomy of plantaris muscle: a study in adult Indians. Clin Ter, 161, 249-52.

NEEDHAM, M. & MASTAGLIA, F. L. 2016. Sporadic inclusion body myositis: A review of recent clinical advances and current approaches to diagnosis and treatment. Clin Neurophysiol, 127, 1764-73.

NG, K. P., RAMOS, F., SULTAN, S. M. & ISENBERG, D. A. 2009. Concomitant diseases in a cohort of patients with idiopathic myositis during long-term follow-up. Clin Rheumatol, 28, 947-53.

OHBERG, L. & ALFREDSON, H. 2002. Ultrasound guided sclerosis of neovessels in painful chronic Achilles tendinosis: pilot study of a new treatment. Br J Sports Med, 36, 173-5; discussion 176-7.

OHBERG, L., LORENTZON, R. & ALFREDSON, H. 2001. Neovascularisation in Achilles tendons with painful tendinosis but not in normal tendons: an ultrasonographic investigation. Knee Surg Sports Traumatol Arthrosc, 9, 233-8.

PACIELLO, O., WOJCIK, S., GRADONI, L., OLIVA, G., TRAPANI, F., IOVANE, V., POLITANO, L. & PAPPARELLA, S. 2010. Syrian hamster infected with Leishmania infantum: a new experimental model for inflammatory myopathies. Muscle Nerve, 41, 355-61.

PANOSKALTSIS-MORTARI, A. & BUCY, R. P. 1995. In situ hybridization with digoxigenin-labeled RNA probes: facts and artifacts. Biotechniques, 18, 300-7.

62

PENNICA, D., NEDWIN, G. E., HAYFLICK, J. S., SEEBURG, P. H., DERYNCK, R., PALLADINO, M. A., KOHR, W. J., AGGARWAL, B. B. & GOEDDEL, D. V. 1984. Human tumour necrosis factor: precursor structure, expression and homology to lymphotoxin. Nature, 312, 724-9.

PETER, J. B., BARNARD, R. J., EDGERTON, V. R., GILLESPIE, C. A. & STEMPEL, K. E. 1972. Metabolic profiles of three fiber types of skeletal muscle in guinea pigs and rabbits. Biochemistry, 11, 2627-33.

PETERSON, M. D., SEN, A. & GORDON, P. M. 2011. Influence of resistance exercise on lean body mass in aging adults: a meta-analysis. Med Sci Sports Exerc, 43, 249-58.

PETTE, D. & STARON, R. S. 1997. Mammalian skeletal muscle fiber type transitions. Int Rev Cytol, 170, 143-223.

PHILIP, R. & EPSTEIN, L. B. 1986. Tumour necrosis factor as immunomodulator and mediator of monocyte cytotoxicity induced by itself, gamma-interferon and interleukin-1. Nature, 323, 86-9.

POTTER, H. G., HANNAFIN, J. A., MORWESSEL, R. M., DICARLO, E. F., O'BRIEN, S. J. & ALTCHEK, D. W. 1995. Lateral epicondylitis: correlation of MR imaging, surgical, and histopathologic findings. Radiology, 196, 43-6.

POZNIAK, P. D., DARBINYAN, A. & KHALILI, K. 2016. TNF-alpha/TNFR2 Regulatory Axis Stimulates EphB2-Mediated Neuroregeneration Via Activation of NF-kappaB. J Cell Physiol, 231, 1237-48.

PROBERT, L. 2015. TNF and its receptors in the CNS: The essential, the desirable and the deleterious effects. Neuroscience, 302, 2-22.

QI, L., ZHI, J., ZHANG, T., CAO, X., SUN, L., XU, Y. & LI, X. 2015. Inhibition of microRNA-25 by tumor necrosis factor alpha is critical in the modulation of vascular smooth muscle cell proliferation. Mol Med Rep, 11, 4353-8.

RADLEY, H. G., DAVIES, M. J. & GROUNDS, M. D. 2008. Reduced muscle necrosis and long-term benefits in dystrophic mdx mice after cV1q (blockade of TNF) treatment. Neuromuscul Disord, 18, 227-38.

RILEY, G. 2008. Tendinopathy--from basic science to treatment. Nat Clin Pract Rheumatol, 4, 82-9.

ROSENBERG, N. L. 1993. Experimental models of inflammatory myopathies. Baillieres Clin Neurol, 2, 693-715.

ROTHE, M., PAN, M. G., HENZEL, W. J., AYRES, T. M. & GOEDDEL, D. V. 1995. The TNFR2-TRAF signaling complex contains two novel proteins related to baculoviral inhibitor of apoptosis proteins. Cell, 83, 1243-52.

ROUBILLE, C., RICHER, V., STARNINO, T., MCCOURT, C., MCFARLANE, A., FLEMING, P., SIU, S., KRAFT, J., LYNDE, C., POPE, J., GULLIVER, W., KEELING, S., DUTZ, J., BESSETTE, L., BISSONNETTE, R. & HARAOUI, B. 2015. The effects of tumour necrosis factor inhibitors, methotrexate, non-steroidal anti-inflammatory drugs and corticosteroids on cardiovascular events in rheumatoid arthritis, psoriasis and psoriatic arthritis: a systematic review and meta-analysis. Ann Rheum Dis, 74, 480-9.

RUSSELL, F. A., FERNANDES, E. S., COURADE, J. P., KEEBLE, J. E. & BRAIN, S. D. 2009. Tumour necrosis factor alpha mediates transient receptor potential vanilloid 1-dependent bilateral thermal hyperalgesia with

63

distinct peripheral roles of interleukin-1beta, protein kinase C and cyclooxygenase-2 signalling. Pain, 142, 264-74.

SCHAFERS, M., GEIS, C., BRORS, D., YAKSH, T. L. & SOMMER, C. 2002. Anterograde transport of tumor necrosis factor-alpha in the intact and injured rat sciatic nerve. J Neurosci, 22, 536-45.

SCHAIBLE, H. G. 2010. [The role of TNF-alpha as pain mediator]. Z Rheumatol, 69, 237-9.

SCHMIDT-ROHLFING, B., GRAF, J., SCHNEIDER, U. & NIETHARD, F. U. 1992. The blood supply of the Achilles tendon. Int Orthop, 16, 29-31.

SCHOENFELD, B. J. 2010. The mechanisms of muscle hypertrophy and their application to resistance training. J Strength Cond Res, 24, 2857-72.

SCHULTZ, E., GIBSON, M. C. & CHAMPION, T. 1978. Satellite cells are mitotically quiescent in mature mouse muscle: an EM and radioautographic study. J Exp Zool, 206, 451-6.

SCHULZE-TANZIL, G., AL-SADI, O., WIEGAND, E., ERTEL, W., BUSCH, C., KOHL, B. & PUFE, T. 2011. The role of pro-inflammatory and immunoregulatory cytokines in tendon healing and rupture: new insights. Scand J Med Sci Sports, 21, 337-51.

SCOTT, W., STEVENS, J. & BINDER-MACLEOD, S. A. 2001. Human skeletal muscle fiber type classifications. Phys Ther, 81, 1810-6.

SHAW, H. M., SANTER, R. M., WATSON, A. H. & BENJAMIN, M. 2007. Adipose tissue at entheses: the innervation and cell composition of the retromalleolar fat pad associated with the rat Achilles tendon. J Anat, 211, 436-43.

SHIRI, R., VIIKARI-JUNTURA, E., VARONEN, H. & HELIOVAARA, M. 2006. Prevalence and determinants of lateral and medial epicondylitis: a population study. Am J Epidemiol, 164, 1065-74.

SIEBERT, T., LEICHSENRING, K., RODE, C., WICK, C., STUTZIG, N., SCHUBERT, H., BLICKHAN, R. & BOL, M. 2015. Three-Dimensional Muscle Architecture and Comprehensive Dynamic Properties of Rabbit Gastrocnemius, Plantaris and Soleus: Input for Simulation Studies. PLoS One, 10, e0130985.

SIMPSON, S. L., HERTZOG, M. S. & BARJA, R. H. 1991. The plantaris tendon graft: an ultrasound study. J Hand Surg Am, 16, 708-11.

SLATER-HAMMEL, A. T. 1950. Bilateral Effects of Muscle Activity. Research Quarterly of the American Association for Health, Physical Education, and Recreation, 203-209.

SOMMER, C. & SCHAFERS, M. 1998. Painful mononeuropathy in C57BL/Wld mice with delayed wallerian degeneration: differential effects of cytokine production and nerve regeneration on thermal and mechanical hypersensitivity. Brain Res, 784, 154-62.

SONG, Y. 2013. Cross transfer effects after unilateral muscle overuse: an experimental animal study about alterations in the morphology and the tachykinin system of muscles. Umea University.

SONG, Y., STAL, P. S., YU, J. & FORSGREN, S. 2013. Marked Effects of Tachykinin in Myositis Both in the Experimental Side and Contralaterally: Studies on NK-1 Receptor Expressions in an Animal Model. ISRN Inflamm, 2013, 907821.

64

SPANG, C. & ALFREDSON, H. 2017. Richly innervated soft tissues covering the superficial aspect of the extensor origin in patients with chronic painful tennis elbow - Implication for treatment? J Musculoskelet Neuronal Interact, 17, 97-103.

SPANG, C., ALFREDSON, H., DOCKING, S. I., MASCI, L. & ANDERSSON, G. 2016. The plantaris tendon: a narrative review focusing on anatomical features and clinical importance. Bone Joint J, 98-B, 1312-1319.

SPANG, C., HARANDI, V. M., ALFREDSON, H. & FORSGREN, S. 2015. Marked innervation but also signs of nerve degeneration in between the Achilles and plantaris tendons and presence of innervation within the plantaris tendon in midportion Achilles tendinopathy. J Musculoskelet Neuronal Interact, 15, 197-206.

SPINA, A. A. 2007. The plantaris muscle: anatomy, injury, imaging, and treatment. J Can Chiropr Assoc, 51, 158-65.

STAUBER, W. T. 2004. Factors involved in strain-induced injury in skeletal muscles and outcomes of prolonged exposures. J Electromyogr Kinesiol, 14, 61-70.

STILWELL, D. L., JR. 1957. The innervation of tendons and aponeuroses. Am J Anat, 100, 289-317.

STOLL, C., JOHN, T., CONRAD, C., LOHAN, A., HONDKE, S., ERTEL, W., KAPS, C., ENDRES, M., SITTINGER, M., RINGE, J. & SCHULZE-TANZIL, G. 2011. Healing parameters in a rabbit partial tendon defect following tenocyte/biomaterial implantation. Biomaterials, 32, 4806-15.

SUTER, M. R., WEN, Y. R., DECOSTERD, I. & JI, R. R. 2007. Do glial cells control pain? Neuron Glia Biol, 3, 255-68.

TETTA, C., CAMUSSI, G., MODENA, V., DI VITTORIO, C. & BAGLIONI, C. 1990. Tumour necrosis factor in serum and synovial fluid of patients with active and severe rheumatoid arthritis. Ann Rheum Dis, 49, 665-7.

TEWS, D. S. & GOEBEL, H. H. 1998. Cell death and oxidative damage in inflammatory myopathies. Clin Immunol Immunopathol, 87, 240-7.

TIDBALL, J. G. 2005. Inflammatory processes in muscle injury and repair. Am J Physiol Regul Integr Comp Physiol, 288, R345-53.

TSENG, W. P., SU, C. M. & TANG, C. H. 2010. FAK activation is required for TNF-alpha-induced IL-6 production in myoblasts. J Cell Physiol, 223, 389-96.

WAJANT, H., PFIZENMAIER, K. & SCHEURICH, P. 2003. Tumor necrosis factor signaling. Cell Death Differ, 10, 45-65.

VAN HERREWEGHE, F., FESTJENS, N., DECLERCQ, W. & VANDENABEELE, P. 2010. Tumor necrosis factor-mediated cell death: to break or to burst, that's the question. Cell Mol Life Sci, 67, 1567-79.

WANG, J. & AL-LAMKI, R. S. 2013. Tumor necrosis factor receptor 2: its contribution to acute cellular rejection and clear cell renal carcinoma. Biomed Res Int, 2013, 821310.

VASSALLI, P. 1992. The pathophysiology of tumor necrosis factors. Annu Rev Immunol, 10, 411-52.

WILSON, N. S., DIXIT, V. & ASHKENAZI, A. 2009. Death receptor signal transducers: nodes of coordination in immune signaling networks. Nat Immunol, 10, 348-55.

VITADELLO, M., DORIA, A., TARRICONE, E., GHIRARDELLO, A. & GORZA, L. 2010. Myofiber stress-response in myositis: parallel investigations on

65

patients and experimental animal models of muscle regeneration and systemic inflammation. Arthritis Res Ther, 12, R52.

YOON, J. H. & HALPER, J. 2005. Tendon proteoglycans: biochemistry and function. J Musculoskelet Neuronal Interact, 5, 22-34.