The histaminergic system regulates wakefulness and orexin/hypocretin neuron development via histamine receptor H1 in zebrafish

The FASEB Journal • Research Communication

The histaminergic system regulates wakefulness andorexin/hypocretin neuron development viahistamine receptor H1 in zebrafish

Maria Sundvik,*,† Hisaaki Kudo,*,† Pauliina Toivonen,*,†,‡ Stanislav Rozov,*,†

Yu-Chia Chen,*,† and Pertti Panula*,†,1

*Neuroscience Center, †Institute of Biomedicine, Anatomy, and ‡Department of Bioscience,Physiology, University of Helsinki, Helsinki, Finland

ABSTRACT The histaminergic and hypocretin/orexin (hcrt) neurotransmitter systems play crucialroles in alertness/wakefulness in rodents. We eluci-dated the role of histamine in wakefulness and theinteraction of the histamine and hcrt systems in larvalzebrafish. Translation inhibition of histidine decarboxyl-ase (hdc) with morpholino oligonucleotides (MOs) ledto a behaviorally measurable decline in light-associatedactivity, which was partially rescued by hdc mRNAinjections and mimicked by histamine receptor H1(Hrh1) antagonist pyrilamine treatment. Histamine-immunoreactive fibers targeted the dorsal telencepha-lon, an area that expresses histamine receptors hrh1and hrh3 and contains predominantly glutamatergicneurons. Tract tracing with DiI revealed that projec-tions from dorsal telencephalon innervate the hcrt andhistaminergic neurons. Translation inhibition of hdcdecreased the number of hcrt neurons in a Hrh1-dependent manner. The reduction was rescued byoverexpression of hdc mRNA. hdc mRNA injectionalone led to an up-regulation of hcrt neuron numbers.These results suggest that histamine is essential for thedevelopment of a functional and intact hcrt system andthat histamine has a bidirectional effect on the develop-ment of the hcrt neurons. In summary, our findingsprovide evidence that these two systems are linked bothfunctionally and developmentally, which may have impor-tant implications in sleep disorders and narcolepsy.—Sundvik, M., Kudo, H., Toivonen, P., Rozov, S., Chen,Y.-C., Panula, P. The histaminergic system regulates wake-fulness and orexin/hypocretin neuron development viahistamine receptor H1 in zebrafish. FASEB J. 25,4338–4347 (2011). www.fasebj.org

Key Words: locomotor activity � sleep disorders � dorsal telen-cephalon � tracing

In constantly changing environments, it is essen-tial to respond adequately to surrounding stimuli, asinability to respond properly can have fatal conse-quences. Many known neurotransmitters, includinghistamine and hypocretin/orexin (hcrt), regulate alert-

ness/wakefulness (1). Histamine and hcrt play comple-mentary roles in wakefulness of mice (2), but how thesystems interact is incompletely understood. Histamineproduced in the tuberomamillary nucleus neurons ofthe hypothalamus (3, 4) is involved in physiologicalfunctions from feeding to cognition (5). It acts through4 G-protein-coupled receptors, of which histamine re-ceptor H1 (Hrh1), histamine receptor H2 (Hrh2), andhistamine receptor H3 (Hrh3) are widespread in mam-malian brain tissue (5). At least Hrh1 and Hrh3 areassociated with alertness and wakefulness (6–9). How-ever, the exact sites of action of histamine with respectto wakefulness or alertness are not clearly identified inany vertebrate species. The hcrt system (10, 11) consistsof neurons in the hypothalamus with widespread pro-jections throughout the brain (12, 13), and lack of hcrtcauses narcolepsy (14). Interestingly, in the cerebrospi-nal fluid (CSF) of persons with idiopathic hypersomnia,histamine CSF levels are decreased (15), suggestingthat histamine in humans is a crucial regulator ofalertness/wakefulness.

Zebrafish have emerged as versatile organisms tostudy the neuronal basis of behavior. Zebrafish re-spond to various stimuli by expressing a repertoire ofbehaviors specific for these stimuli (16 –21). We wereinterested in understanding how histamine regulatesresponses of larval zebrafish to changes in the envi-ronment. We identified the expression domains ofthe histamine receptors that are important in behav-ioral regulation in zebrafish (22). We also hypothe-sized that histamine may regulate other systemsinvolved in wakefulness and identified histamine as anew developmental regulator of the hcrt system.

1 Correspondence: Neuroscience Center and Institute ofBiomedicine, Anatomy, Faculty of Medicine, P.O.B. 63, 00014University of Helsinki, Haartmaninkatu 8, 00290 Helsinki,Finland. E-mail: [email protected]

doi: 10.1096/fj.11-188268This article includes supplemental data. Please visit http://

www.fasebj.org to obtain this information.

4338 0892-6638/11/0025-4338 © FASEB

MATERIALS AND METHODS

Animals

A zebrafish line that has been maintained in the laboratoryfor over a decade and used in several studies was used (13, 23,24, 25). The permits for the experiments were obtained fromthe Office of the Regional Government of Southern Finlandin agreement with the ethical guidelines of the Europeanconvention. Zeitgeber time (ZT) light onset was at 9:00 AM(ZT 0), and lights went off at 11:00 PM (ZT 14), a 14- to 10-hlight-dark cycle.

Translation inhibition with morpholino oligonucleotides(MOs)

The following MOs were injected at the 1- to 4-cell stage:initiation site MO, CATCCCGTCACTCAGAGAAGATTAG;splice site 1 MO (hdc spl1), GAGCTGACTCTGACCAGAAG;splice site 2 MO (hdc spl2), GGCCTGTAGAACACACACACA-CACA; and standard control (std) MO, CCTCTTACCT-CAGTTACAATTTATA (Gene Tools, Philomath, OR, USA).

Pharmacological treatments

Drug concentrations were as follows: �-fluoromethylhistidine(�-FMH; a gift from Dr. J. Kollonitch; Merck Sharp & DohmeResearch Laboratory, Rahway, NJ, USA), 1 mM, administeredfor 1–5 or 1–7 days postfertilization (dpf); and Hrh1 antago-nist pyrilamine (Sigma-Aldrich, St. Louis, MO, USA), 100 �M,administered at 24 h prior to behavior or for 1–5 dpf (22).

Behavioral analysis

To assess the effect of histamine on behavior, several behav-ioral assays were used on larval zebrafish. First, locomotoractivity was assessed as described previously (22). Second, weobserved the activity of histamine-deficient zebrafish (in-duced by hdc MO) during a 24-h period. Two parameters wereanalyzed: frequency of movement and total distance movedper hour. Third, the wakefulness-related activity of hdc mor-phants during short phases of lights on and lights off withinthe active time of day was studied. To assess responses tochange in the environment, we used a camera system at 25frames/s to measure responses and assess whether the hdcMO larvae showed the same behavior as wild-type (WT)siblings. The behavioral data were then analyzed in 1-sintervals, which detect movement over a sufficiently longperiod but do not distinguish the body movement of theO-bend response during the transition from light to dark.Therefore, we called the response a dark-induced flash re-sponse. The fourth approach was a very simplified version ofthe optomotor assay by manually moving a paper with blackand with stripes (1 cm wide) for 30 s under a plate with 6- to7-dpf zebrafish larvae. All behavioral experiments were doneon zebrafish larvae at 5–7 dpf.

Tracing

Carbocyanine dye DiI (Vybrant DiI cell labeling solution;Molecular Probes/Invitrogen Corp., Carlsbad, CA, USA) wasinjected through the skin to the superficial part of the rightdorsal part of the dorsal telencephalon of 9-dpf anesthetizedlarvae. Information about the procedure was gathered fromprevious studies (reviewed in ref. 26) and further optimized.The fish was placed on a 1 ml Petri dish cover filled with 1%agarose gel. A small amount of 0.1 M phosphate buffer was

added to the agarose before placing the sample. Injectionswere done at a 45° angle from the lateral side of the brain.The needle was placed perpendicularly to the body axis.Micropipettes were pulled from 1-mm-diameter glass capillar-ies (Glass thinW; World Precision Instruments Ltd., Steve-nage, UK) with a micropipette puller (Flaming/Brown Mi-cropipette Puller P-97; Sutter Instrument Co., Novato, CA,USA). Pipettes were filled with 20% DiI solution (diluted in1:1 ethanol:DMSO) and were controlled by a Narishigemicromanipulator (Narishige, Tokyo, Japan). The tip of thepipette was cut with scissors and calibrated by injecting DiI toa drop of halocarbon oil (Halocarbon Oil 27, Sigma-Aldrich).The tracer was applied by pressure injector (PV830 Pneu-matic PicoPump; World Precision Instruments) with thepressure of 30 psi for 5 ms. Tracer (2 nl) was injected undera stereomicroscope, and targeting was verified immediately byfluorescence microscope (Leica MZFBL III; Leica Microsys-tems GmbH, Wetzlar, Germany). After the injection, thelarvae were kept alive for 1 h (27°C) and then killed withice-cold water and fixed with ice-cold fixative [4% 1-ethyl-3,3(dimethyl-aminopropyl) carbodiimide (EDAC); CMSChemicals, Abingdon, UK].

Histamine high-pressure liquid chromatography (HPLC)

Histamine was assayed by HPLC as described previously (27).Briefly, samples were collected by pooling 10 or 30 larvae,from which eyes and tails were removed for single samples.These samples were frozen on dry ice and stored at �80°Cuntil further processing for HPLC. Samples were then ho-mogenized by sonication in 2% perchloric acid, centrifugedfor 30 min at 15,000 g at 4°C, and filtered through a 0.45-�mPVDF filter (Pall Life Sciences, Ann Arbor, MI, USA) beforeloading onto the HPLC system. Protein concentration wasmeasured by the BCA kit (Thermo Fisher Scientific Inc.,Rockford, IL, USA) to normalize the results from HPLCmeasurement.

RNA isolation and quantitative RT-PCR

RNA was isolated from 30 pooled 5-dpf larvae for a singlesample. The RNA was isolated by Qiagen RNeasy Mini Kit(Qiagen, Hilden, Germany) following the protocol suppliedby the manufacturer. RNA quality and amount were analyzedspectrophotometrically, and cDNA was prepared by Super-Script III (Invitrogen). Primers used for quantitative RT-PCRwere hcrt A, forward TCTACGAGATGCTGTGCCGAG andreverse CGTTTGCCAAGAGTGAGAATC (13); and �-actin,forward CGAGCAGGAGATGGGAACC and reverse CAACG-GAAACGCTCATTGC (28).

Whole-mount in situ hybridization (WISH)

In situ hybridization was performed according to the protocolof Thisse and Thisse (29) with several modifications, asdescribed previously (30, 31). hcrt (13) and hrh1 and hrh3 (22)had been cloned into pGEM-Teasy vector as described previ-ously. The partial coding region of hdc (NM_001102593; ref.32) gene was also cloned into pGEM-Teasy vector withRT-PCR using forward and reverse primers GCAGCCGCAG-GAGTACATGC and GGCTGCCGGGTCACGACT, respec-tively. gad1, gad2, slc17a6a, slc17a6b, and slc17a7 had beencloned and were kind gifts from Dr. Shin-ichi Higashijima(National Institutes of Natural Sciences, Okazaki Institute forIntegrative Bioscience, Okazaki, Japan; ref. 33). These anti-sense and sense digoxigenin (DIG)-labeled RNA probes weresynthesized using the DIG RNA labeling kit (Roche Diagnos-

4339HISTAMINERGIC REGULATION OF hcrt IN ZEBRAFISH

tics, Mannheim, Germany), following the instructions of themanufacturer.

Cloning full-length cDNA and synthesizing capped RNA(mRNA) of hdc

The 5� half of hdc cDNA was amplified with primers ATG-CAGCCGCAGGAGTACAT and GGCTGCCGGGTCACGACT,with the partial hdc clone as PCR template. The 3� half wasamplified with GTCCTGAGCTGCGCTATTTC and GTTATT-TAGTAGGCAGCGGTGTG, by RT-PCR from total RNA ofadult hypothalamus. Full-length hdc cDNA was acquired bysplice overlap extension (SOE) PCR, with ATGCAGCCGCAG-GAGTACAT and GTTATTTAGTAGGCAGCGGTGTG prim-ers. All of the above-mentioned PCR reactions were done witha unique Phusion High-Fidelity DNA Polymerase (Finnzymes,Espoo, Finland), which made blunt-end PCR products. AnA-tailing procedure of the full-length fragment was per-formed to add 3�-A overhangs with GoTaq master mix (Pro-mega, Madison, WI, USA) for following TA cloning. Thefull-length hdc cDNA was cloned into pGEM T-easy vector andchecked for nonstop codon in the coding sequence. Then, itwas inserted into pMC vector at EcoRI and SpeI restrictionenzyme sites. Capped RNA was synthesized with the T7mMessage mMachine (Ambion, Foster City, CA, USA) afterlinearization of the cloned plasmid with NarI and purifiedwith the Qiagen RNeasy mini kit (Qiagen) after DNase Idigestion for removing template DNA. The purified cappedhdc RNA was diluted and injected into the yolk of embryos atthe 1- to 4-cell stage.

Immunohistochemistry (IHC)

A tyramide signal amplification (TSA) kit (PerkinElmer Lifeand Analytical Sciences, Boston, MA, USA) was used to enabledouble-staining of samples with primary antibodies from thesame species. For optimal staining of histamine immunoreac-tivity, it was necessary to use the bifunctional fixative EDAC, asdescribed previously (34–36). Samples were fixed in 4%EDAC with 0.1% paraformaldehyde overnight at 4°C. Theadult brains were cryoprotected in 20% sucrose overnight,embedded in embedding matrix, and sectioned at 20 �m witha Leica cryostat. Sections were stored at �20°C until furtherprocessing. IHC with TSA (PerkinElmer) was performedaccording to the manufacturer’s instructions. After TSA IHC,the samples were further stained and mounted in 1:1 glycerol/PBS. IHC of larval zebrafish was done as described previously(23). The following primary antibodies were used: rabbitanti-HA19c (ref. 35; 1:50,000 when used in the TSA protocol,otherwise 1:10,000), mouse anti-tyrosine hydroxylase (TH;1:1000; Diasorin Inc., Stillwater, MN, USA), rabbit anti-activecaspase 3 (1:500; BD Biosciences, Franklin Lakes, NJ, USA),and rabbit anti-Hcrt A (1:1000; Millipore/Chemicon, Bil-lerica, MA, USA). Preadsorption controls of the primaryantisera have been reported previously (13, 23, 35). Thesecondary antibodies were biotinylated goat anti-rabbit anti-body (1:750; Vectastain ABC kit; Vector LaboratoriesInc., Burlingame, CA, USA), streptavidin-fluorescein (1:50;PerkinElmer) and highly cross-purified Alexa fluorophore-conjugated goat anti-rabbit or anti-mouse antibodies (488,561, or 647 fluorophores; Molecular Probes/Invitrogen).

Microscopy and image analysis

Following WISH, samples were analyzed, numbers of hcrtneurons were counted with an inverted Leica DM IRB lightmicroscope, and images were acquired with the LeicaDFC490 camera and Leica Application Suite, MultiFocus

option (Leica Microsystems). IHC samples were all analyzedwith a Leica TCS SP2 AOBS confocal microscope. When twoor more channels were scanned simultaneously, sequentialscanning between frames was applied. For the 3-dimensional(3-D) analysis, we applied a step size of 0.2 �m, whereas forthe colocalization study, we used the optimized step sizecalculated by Leica software. Single focal planes of overlayimages were analyzed for colocalization. Maximum projec-tions of the acquired stacks were produced with Leica soft-ware for comparative analysis. Imaris 3-D image analysissoftware (Bitplane AG, Zurich, Switzerland) was used forvisualizing the network of histamine fibers in the telenceph-alon.

Statistical analysis

All results were analyzed in GraphPad Prism (GraphPadSoftware, La Jolla, CA, USA) or Microsoft Office Excel 2007(Microsoft, Redmond, WA, USA) using Student’s t test forshowing significant changes between two groups. For differ-ences between several groups, 1-way ANOVA and 2-way re-peated measures (RM) ANOVA were applied, depending onthe requirement of the data, with appropriate post hoc tests.

RESULTS

Lack of histamine induces a decline in light-associated activity and abolishes dark-inducedflash response

The histaminergic neurons in 5-dpf WT larvae, visual-ized with an antiserum against histamine, were seenexclusively in the posterior hypothalamus in a clusterwithin the caudal part of the periventricular hypothal-amus (Fig. 1A). The most prominent target of innerva-tion was the dorsal telencephalon, which received adense network of varicose fibers (Fig. 1A). Histaminedeficiency was induced in the zebrafish using transla-tion inhibition of Hdc or by �-FMH (an irreversibleinhibitor of Hdc). The hdc initiation site-targeting MOreduced histamine immunoreactivity significantly. Inlarvae injected with the hdc MO, traces of histamineimmunoreactivity were seen in the neuronal cell bodiesat 5 dpf, whereas immunoreactive fibers were notobserved (Fig. 1A). At 5 dpf, 2 ng of hdc MO signifi-cantly reduced the histamine content compared to WTfish (Fig. 1B), and a trend toward a decline was stillevident at 7 and 11 dpf (Supplemental Fig. S1A). It iscrucial to control the targeting specificity in MO exper-iments in several ways to avoid off-target effects (37,38). Notably, the gross phenotype of the fish injectedwith the hdc MO did not significantly differ from WTsiblings at 24 hpf (Fig. 1C) or at 6 dpf (Fig. 1D). In thisstudy, the hdc MO did not induce caspase-3 activation at5 dpf (Fig. 1F). The distribution and numbers ofTH-immunoreactive neurons in MO-injected fish wereunaltered at 7 dpf (Fig. 1E). Histamine immunoreac-tivity was also reduced by �-FMH at 5 dpf (Fig. 1G). Thenumbers of identifiable histamine-immunoreactiveneurons were significantly smaller in �-FMH-treatedfish than in control fish at 5 dpf: WT, 11.26 � 4.712;�-FMH, 2.368 � 2.813 (means � sd, P�0.05, Student’s

4340 Vol. 25 December 2011 SUNDVIK ET AL.The FASEB Journal � www.fasebj.org

t test, n�19/group). The std MO was used as a control,which did not significantly reduce histamine levels, asverified by HPLC and IHC (Fig. 1A, B). Further,coinjections of hdc MO and hdc mRNA were done (seefollowing section) to rescue the hdc MO-inducedchanges. Two other MOs were also tested. These wereboth splice site-blocking MOs, hdc spl1 and hdc spl2, ofwhich hdc spl1 reduced the histamine immunoreactivityat 5 dpf (Supplemental Fig. S1B). However, it produceda characteristic off-target effect with small brains (Sup-plemental Fig. S1B). Due to this effect, this MO was notused in further experiments. hdc Spl2 was toxic, andmost embryos died within the first 24 h after injection.

The activity of hdc morphants during the wake-sleepcycle was similar to the WT and std MO-injected siblingsonly during night (ZT 14–24; Fig. 2A). When lightswere turned on in the morning (ZT 0), the totaldistance moved by the hdc MO fish was increasedcompared to nighttime activity but remained signifi-

cantly lower than the activity induced in WT and stdMO controls (Fig. 2A). Two-way RM ANOVA showed aninteraction between time and treatment between WTand hdc MO larvae (P�0.001). Std MO did not inducea significant effect on the behavior of fish, suggestingthat the effect was specific to hdc MO. Frequency ofmovement initiation was also affected in the hdc MOlarvae (P�0.01, 2-way RM ANOVA; Fig. 2B). Theseresults show that hdc MO fish are less active than theirWT siblings during daytime (ZT 0–14).

Short intervals of lights on and lights off were used toobserve the responsiveness of hdc MO to an environ-mental cue during the light period (ZT 1–6). Theresponse was interpreted as alertness/wakefulness as itmeasured the ability of the fish to rapidly respond to anenvironmental cue. WT larvae exhibit a very briefdark-induced flash response, corresponding to an Obend (18), when the lights were turned off (Supple-mental Fig. S2A), whereas such a response was absent inthe hdc MO larvae (Fig. 2C and Supplemental Fig. S2B).hdc MO larvae increased their speed when the lightswere turned off, whereas the control fish did not(second minute of interval included in the analysis,1-way ANOVA, Tukey’s multiple comparison test,P�0.0001; Supplemental Fig. S2C). The first dark-induced flash response was impaired in hdc MO fish, asindicated by significant interaction between time andtreatment (P�0.05, 2-way ANOVA) when WT and hdcMO larvae were compared (Fig. 2C), and the MO hada significant effect (P�0.001, 2-way ANOVA). Dark-induced flash response was partially rescued by hdcmRNA injection, as no significant difference was foundbetween WT and hdc MOmRNA injected groups(P0.05, 2-way RM ANOVA; Fig. 2D). As Hrh1 antago-nist pyrilamine also abolished the dark-induced flashresponse (P�0.001, 2-way RM ANOVA; Fig. 2E), thebehavior is very likely mediated through Hrh1. �-FMH(1 mM) treatment for 1–5 dpf (P0.05, 2-way RMANOVA; Supplemental Fig. S2D) did not abolish theresponse, whereas 1–7 dpf treatment (P�0.05, 2-wayRM ANOVA; Supplemental Fig. S2E) abolished thebehavioral response in the same manner as hdc MO(Fig. 2C). The response to lights on/off was enhancedwhen fish were exposed to the alternation of lightson/off (30 min each for 3 h) before the 10 mintracking with 2 min lights on/off (Supplemental Fig.S2F). These results indicate that repeated and longexposure to alternation in lights on/off does not in-duce habituation or diminish the response. Becausedefects in the visual system might in part explain theresults, we analyzed the optomotor responses of thelarvae following hdc MO injection and found that theresponses of WT and hdc MO fish at 6 dpf were similar(Supplemental Fig. S2G). Defects in locomotion mightalso be a reason for the observed results, as the hdc MOfish move less than WT (Fig. 2A). We therefore alsoobserved the total distance the larvae moved during a10-min period immediately following the transfer tomeasuring arena but found no significant differencesbetween water-injected and hdc MO groups (Supple-

Figure 1. Histamine deficiency induced with hdc MO. A) Hista-mine IHC shows that the main target of the histaminergicneurons in the posterior hypothalamus is telencephalon, as seenin WT, std MO, and hdc MO fish at 5 dpf (representative imagesshown, n�4–5/group). B) Histamine concentration (pg/�gprotein) after hdc MO injections in whole larvae at 5 dpf.Graphed values are means � se of 3 replicates. Each sample inreplicate 1 consists of 30 individuals/group, in replicate 2 and 3,n � 10/group, *P � 0.05, Student’s t test. C) Gross phenotype ofWT and hdc MO fish at 24 hpf. D) Gross phenotype of WT, stdMO, and hdc MO fish at 6 dpf. E) TH immunoreactivity in WTand hdc MO fish (n�16–17/group). F) Caspase-3 activation inWT and hdc MO fish at 5 dpf (n�9–10/group). G) Histamineimmunoreactivity after �-FMH treatment at 5 dpf (n�19/group).

4341HISTAMINERGIC REGULATION OF hcrt IN ZEBRAFISH

mental Fig. S2H). Taken together, these results suggestthat histamine is important for the adequate rapidbehavioral response of larval zebrafish to changes inthe environment.

hrh1, hrh3, and glutamate transporters are expressedin the dorsal telencephalon, which is the main targetof histamine fibers

The behavioral data revealed that Hrh1 mediates thedark-induced flash response, and we were interested toknow which brain areas are important for the behavior.WISH expression patterns of hrh1 and hrh3 showed thatthe dorsal part of the dorsal telencephalon (Dd) wasthe main area of expression (Fig. 3A, B). Faint expres-sion of hrh1 was found in the ventral telencephalon,diencephalic and thalamic regions, and lateral hypo-thalamus (Fig. 3A). hrh3 was almost exclusively ex-pressed in the Dd (Fig. 3B). This area in fish isconsidered the fish counterpart of the mammaliancortex (39). hdc-expressing neurons were only found in

posterior hypothalamus (Fig. 3C), consistent with ourIHC (Fig. 1A) and previous studies (23, 27). Thetelencephalic region contained several different typesof neurons. GABAergic markers glutamate decarboxylase 1(gad1; Supplemental Fig. S3A) and glutamate decarboxyl-ase 2 (gad2; Supplemental Fig. S3B) were expressedpredominantly in the ventral part of the telencephalon(subpallium), whereas glutamatergic markers solute car-rier family 17, member 7 (slc17a7) and solute carrier family17, member 6b (slc17a6b) were concentrated in theposterior domains of the Dd (Supplemental Fig. S3D,E). Solute carrier family 17, member 6a (slc17a6a) wasexpressed anterior to the two other glutamatergicmarkers in an area that expressed both hrh1 and hrh3(Supplemental Fig. S3C). IHC combined with 3-Dconfocal microscopy of 10-dpf larval zebrafish brainsshowed that histaminergic fibers projected from thecaudal zone of periventricular hypothalamus (Hc) tothe telencephalon, where some fibers crossed at thecommissura anterior to contralateral side to innervate thecentral part of the dorsal telencephalon together with the

Figure 2. Activity during the wake-sleep cycle of hdc morphants and behavioral response to changes in light conditions in hdcmorphants. A) Distance (centimeters) moved per hour of 5- to 6-dpf larvae during a 24-h period. Values are means � se of24–36 larvae. B) Frequency of movement per hour (during a 24-h period) indicates how many times fish initialize movement.Values are means � se of 24–36 larvae. C) Short pulses of lights on (330 lux) and lights off (2 min duration) results indark-induced flash response in WT larvae. Statistical analysis of the first dark-induced flash response in hdc MO. Two-way RMANOVA (P�0.05) reveals a significant interaction between time and treatment when WT and hdc morphants are compared. WT,n � 51; hdc MO, n � 52; results pooled from 3 experiments; mean values. D) hdc mRNA rescued the behavioral response(P0.05, 2-way RM ANOVA when WT and MO mRNA are compared) WT, n � 27; hdc MO mRNA, n � 27; mean values.E) Treatment with Hrh1 antagonist pyrilamine abolished the dark-induced flash response (P�0.001, 2-way RM ANOVA). WT,n � 14; pyrilamine, n � 20; mean values.

4342 Vol. 25 December 2011 SUNDVIK ET AL.The FASEB Journal � www.fasebj.org

ipsilateral fibers (Fig. 3D). Taken together, hrh1 and hrh3are highly expressed in dorsal telencephalon in a domainthat contains predominantly glutamatergic neurons,whereas the ventral domain contained predominantlyGABAergic neurons in 5- to 7-dpf zebrafish.

By injection of the lipophilic tracer DiI into the dorsaltelencephalon (Fig. 4A and Supplemental Fig. S4), weidentified a fiber network that terminates lateral to thepostoptic commisure and in posterior hypothalamus (Fig.4A, B). TH immunoreactivity revealed that the fibersinnervate an area lateral to the postoptic commisure inrostral hypothalamus that harbors TH positive neurons(24) and Hcrt neurons (13), and the histaminergic neu-rons in posterior hypothalamus (Fig. 4A). All injectionswere targeted unilaterally to the Dd (Fig. 4B and Supple-mental Fig. S4). TH IHC was used to provide an anatom-ical map for distinguishing the target area of the projec-tions, as the anatomy and precise location of the THneurons was established (24).

Lack of histamine affects the developing hcrtneurotransmitter system in a Hrh1-dependent manner

Histamine and hcrt systems interact in the vertebratebrain to regulate wakefulness (13, 40). To determine

the mode of interaction between the histaminergic andhcrt systems, we identified the innervation patterns ofthese systems in regard to each other by TSA combinedwith IHC in adult zebrafish. No colocalization of thetwo markers was observed, and the closest contacts ofthe systems were observed in posterior hypothalamuswhere Hcrt fibers innervated the dendrites of histamin-ergic neurons (Fig. 4C, D). Hcrt-immunoreactive fiberswere seen more closely associated with the dendriticbranches of histaminergic neurons than with the cellbodies (Fig. 4C). The same was observed for histaminefibers in relation to Hcrt neurons (Fig. 4D). At 5 dpf,hcrt mRNA level was significantly decreased in hdc MO

Figure 4. Tracing of the projections from the dorsal part ofdorsal telencephalon (Dd) in 9-dpf larvae and visualization ofthe contacts between the histaminergic and hcrt system.A) Triple staining shows histaminergic (HA) neurons ingreen, TH-positive neurons in blue, and fibers labeled withDiI in red. The DiI projections terminated lateral to postopticcommisure in lateral hypothalamus in an area that alsoharbors Hcrt neurons. The rest of the fibers from the Ddterminated in the posterior hypothalamus, in the posteriorpart of the paraventricular hypothalamus, and innervatedthere the histaminergic neurons. Bottom panel is a lateralview of 3-D rendered data. In 7 of 9 larvae, the same patternwas visible. B) Horizontal illustration of the injection site inthe dorsal telencephalon (indicated by red oval) and projec-tions that were traced. Green dots represent histaminergicneurons. C) Histaminergic neurons visualized in green andHcrt fibers in red in the posterior hypothalamus. The Hcrtfibers contact dendrites of the histaminergic neurons ratherthan the cell somata. D) Hcrt neurons visualized in red andhistamine fibers in green in the postoptic commisure. n � 8.Scale bars � 20 �m (A); 50 �m (C, D). Cant, anteriorcommissure; Cpop, postoptic commisure; Hc, caudal zone ofperiventricular hypothalamus; PR, posterior recess. Brains areplaced with anterior to the left in microphoto images.

Figure 3. Visualization and characterization of the histamin-ergic system in telencephalon of larval zebrafish. A) WISH ofhrh1 showed the strongest expression in dorsal telencepha-lon. A faint signal for this receptor was detected in moremedial and ventral parts of telencephalon (top panel, lateralview), diencephalon, and anterior hypothalamus (bottompanel, dorsal view). B) hrh3 expression was restricted to dorsaltelencephalon. C) hdc-positive neurons reside only in theposterior hypothalamus. D) Afferent fiber projections ofhistaminergic neurons targeted dorsal telencephalon, as visu-alized by IHC combined with 3-D imaging of 10-dpf zebrafishlarvae. WISH was done on 5- to 7-dpf fish brains. Scale bar �100 �m. D, dorsal telencephalon; V, ventral telencephalon,Hc, caudal zone of periventricular hypothalamus; HA-ir,histamine immunoreactivity. Brains are mounted rostral tothe left.

4343HISTAMINERGIC REGULATION OF hcrt IN ZEBRAFISH

fish compared to WT fish (quantitative RT-PCR,P�0.05, Student’s t test; Fig. 5A). These results wereconfirmed with WISH of hcrt in hdc MO larvae. Asignificant decrease in the number of hcrt neurons afterhdc knockdown was observed compared to both WTand std MO fish (P�0.05, 1-way ANOVA followed byDunnett’s multiple comparison test; Fig. 5B, C). Nosignificant difference was observed between the WTand std MO fish. hdc mRNA (both 400 and 800 pg),when coinjected with hdc MO, rescued the reduction ofhcrt neurons (comparison to WT, P0.05, 1-wayANOVA followed by Dunnett’s multiple comparisontest; Fig. 5B, C and Supplemental Fig. S5), and the 800pg hdc mRNA injection alone led to an up-regulation ofhcrt neuron numbers (P�0.001, 1-way ANOVA followedby Dunnett’s multiple comparison test; Fig. 5B, C).Furthermore, pharmacological experiments showedthat �-FMH treatment decreased the hcrt neurons at 5dpf (P�0.05, Student’s t test; Fig. 5D) and that thiseffect is mediated through the Hrh1, as pyrilaminetreatment also significantly interfered with hcrt neurondevelopment at 5 dpf (P�0.001, Student’s t test; Fig.5E). A faint expression of hrh1 was observed also in thelateral hypothalamus by WISH (Fig. 3A). These resultsindicate that histamine is involved in the regulation of

expression and/or development of hcrt neurotransmit-ter system in a Hrh1-dependent manner.

DISCUSSION

Our results show that histamine in zebrafish regulateslocomotor activity during the light phase, dark-inducedflash response, and development of the hcrt system, allthrough Hrh1. Histamine deficiency produced bytranslation inhibition of hdc appeared more effectivethan that induced by the irreversible inhibitor of HDC,�-FMH. Notably, the phenotypes observed followinghdc MO were specific, because no increase of caspase-3activity was observed, unrelated systems appeared un-changed, morphological phenotypes characteristic ofoff-target effects were not observed, and the effect ofthe MO on both the behavior and hcrt system wasnormalized by hdc mRNA injection. The receptor re-sponsible for these effects appeared to be Hrh1. Pyril-amine abolished the dark-induced flash response. Thesame was not observed with �-FMH, suggesting that thehistamine level after �-FMH treatment was not lowenough. We have shown previously that the maximaldecline in histamine levels achievable with �-FMH is�70% (41), whereas hdc MO resulted in slightly stron-ger decrease in this study. Interestingly, both �-FMHand pyrilamine treatment interfered with the develop-ment of hcrt neurons.

In adult zebrafish, histaminergic neurons send denseafferent fiber projections to the dorsal telencephalon(13, 23), the major target for histaminergic neurons.Three histamine receptors, hrh1, hrh2, and hrh3, havebeen cloned and are expressed in the CNS of zebrafish,and antagonists of Hrh1 and Hrh3 have significantbehavioral effects in larval fish (22). Histamine is awakefulness-promoting factor in mammals, and theeffect is mediated at least in part through Hrh1 (8, 42).However, histamine receptors are widespread in mam-malian brain (reviewed in ref. 5), and it has beendifficult to identify which target sites are most impor-tant in maintaining wakefulness. Both Hrh1 and Hrh3are involved in alertness and wakefulness (6, 7) andexpressed in laminar manner in the cerebral cortex ofboth rodents (43, 44) and humans (45, 46). Hrh2expression in zebrafish brain has already been demon-strated (22).

Light is known to stimulate locomotor activity inzebrafish (18). We found that over a 24-h period, hdcMO fish moved less and initiated fewer periods ofmovement during the light phase compared to WTsiblings. These results are in accordance to what isknown in mammals (2). When the locomotor activitywas assessed during a 10-min period immediately fol-lowing transfer to measurement arenas, no significantdifference was observed between WT and hdc MO fish.These results indicate no basic mechanistic problemwith the locomotor apparatus but that a higher baselineactivity occurs in the animals at the beginning of theanalysis. Further, hdc MO fish were no more passive

Figure 5. Down-regulation of histaminergic system with hdcMO affects the developing hcrt system. A) hcrt mRNA levels inhdc morphants detected by quantitative RT-PCR at 5 dpf.Expression is normalized to �-actin. Data from 4 replicates,with 30 larvae pooled in each replicate. *P � 0.05; Student’st test. B) hdc MO decreases the number of hcrt neuronsdetected by WISH at 5 dpf, an effect normalized with hdcmRNA. Data from 10–15 fish/group. *P � 0.05, **P � 0.01;1-way ANOVA with Tukey’s multiple comparison test.C) Representative images of WISH samples, 5 dpf. Scale bar �100 �m. D) �-FMH treatment (1 mM) for 1–5 dpf reducedhcrt neuron number. Data from 20 fish/group. *P � 0.05;Student’s t test. E) Pyrilamine treatment (100 �M) for 1–5 dpfreduced hcrt neuron numbers. Data from 20 fish/group. *P �0.001, Student’s t test. Values are means � se.

4344 Vol. 25 December 2011 SUNDVIK ET AL.The FASEB Journal � www.fasebj.org

compared to WT when moved to a novel environment.Startle response, which is significantly different fromthe hyperactivity induced by dark flashes or periods(18, 47), can be induced by acoustic/vibrational stimuli(19). The dark flash as a stimulus is accompanied withhyperactivity several hundred milliseconds after thechange in light conditions, proposed to facilitate navi-gation back to illuminated areas (18). Movement anal-ysis with a high-speed camera has suggested that thisO-bend response is strictly navigational and Mauthnerneuron independent (18). Intriguingly, we found thatthe hdc MO fish did not show a dark-induced flashresponse and that these animals also showed a light-associated decrease in activity. The behavioral dataindicate that histamine and Hrh1 are needed forwakefulness-related activity induced by an environmen-tal cue, as the response was abolished by hdc MO andpyrilamine. �-FMH did not abolish the response at 5dpf, most likely because the histamine level is reducedto �30% of controls in �-FMH treated animals (41)compared to hdc MO, which reduces the levels slightlymore. The altered wakefulness and locomotor activityshown by the hdc MO fish is likely mediated at leastpartially by the dorsal telencephalon. This area isinnervated by histaminergic fibers, and the two hista-mine receptors relevant for wakefulness (hrh1 andhrh3) are strongly expressed only in this region. Expres-sion patterns of the main inhibitory GABAergic andexcitatory glutamatergic neuron markers showed thatthe dorsal telencephalon consists predominantly ofglutamatergic neurons, although IHC reveals also scat-tered GABAergic neurons in this area (48). The ze-brafish ventral telencephalon (subpallium) containedpredominantly GABAergic neurons. This area in ze-brafish corresponds to the mammalian basal ganglia(49). The neurons of the dorsal telencephalon pro-jected to the posterior hypothalamus and innervatedthe histaminergic neurons. Thus, there is a reciprocallyconnected system in which the histaminergic systemmay activate directly neurons and modulate otherinputs within the dorsal telencephalon, which in turnsends efferent inputs to the histaminergic neurons andother targets. Hrh3 is likely to regulate the release ofother neurotransmitters in this area, as it is localized innonhistaminergic target cells. Hrh1 may represent themajor postsynaptic target receptor for the histaminer-gic fibers as it is expressed in the same area as theglutamate transporters in zebrafish.

Intriguingly, we found that inactivation of the hista-minergic system severely affects the developing hcrtsystem. The hcrt system has been genetically manipu-lated in zebrafish in several studies to examine itsinvolvement in sleep. Manipulation of the hcrt systemin zebrafish by either Hcrt overexpression (50) or Hcrtreceptor null mutation (32) leads to an insomniaphenotype. To date, the sleep studies done in zebrafishhave utilized strictly behavioral definition of sleep.None of the studies has perused the full spectrum ofbehaviors, and electroencephalographic properties ofsleep in zebrafish. Both hcrt mRNA and the number

of hcrt neurons were down-regulated by hdc MO andoverexpression of hdc mRNA increased the number ofhcrt neurons. Anaclet et al. (2) compared hdc- andhcrt-knockout mice and found that histamine is respon-sible for the cortical wakefulness, whereas hcrt is re-sponsible for the wakefulness that is locomotion depen-dent. Similar results have been found regarding hcrt inzebrafish (51). In mammals, hcrt directly excites hista-minergic neurons (40, 52, 53) via the hypocretinreceptor 2 (54). Studies of patients with narcolepsypatients show a reduction in CSF histamine levels (15,55), although the hcrt levels were not always reduced.These results support the concept that low histaminelevels correlate with lower wakefulness and increasedsleepiness (56). This finding is further supported inthat Hrh3 ligands (57) improve wakefulness in narco-leptic animals. The exact mechanism via which hista-mine regulates the hcrt neurons is unknown. An earlierstudy in rodents showed that in hrh1-knockout mice,hcrt levels were reduced (58). Our results now suggesta clear new role for Hrh1 in hcrt neuron development,as hdc knockdown, �-FMH, and Hrh1 antagonism allinhibit the formation of hcrt neurons or expression ofhcrt mRNA, and hdc mRNA injection increases thenumber of hcrt mRNA-expressing neurons. Taken to-gether, our results suggest that histamine holds a keyrole as an alertness/wakefulness-promoting system inzebrafish, in accordance with what has been docu-mented in mammals, and in sensorimotor gating. No-tably, we identified a new regulatory role for histamineon the developing hcrt system via the Hrh1 receptor.This novel result offers a new avenue to study theetiology of sleep disorders.

The authors thank Dr. Shin-ichi Higashijima (NationalInstitutes of Natural Sciences, Okazaki Institute for Integra-tive Bioscience, Okazaki, Japan) for kindly providing thegad1, gad2, skc17a6a, slc17a6b, and slc17a7 constructs; HenriKoivula and Susanna Norrbacka for excellent fish care; AnnaLehtonen for technical assistance; and Dr. Saara Nuutinenand Dr. Piotr Podlasz for constructive discussions and com-ments on the manuscript. This study was funded by theAcademy of Finland (grants 116177 and 207352), the FinnishTechnology Development Fund (TEKES), and the SigridJuselius Foundation. M.S. was supported by the HelsinkiBiomedical Graduate School. The authors declare no con-flicts of interest.

REFERENCES

1. Cirelli, C. (2009) The genetic and molecular regulation of sleep:from fruit flies to humans. Nat. Rev. Neurosci. 10, 549–560

2. Anaclet, C., Parmentier, R., Ouk, K., Guidon, G., Buda, C.,Sastre, J. P., Akaoka, H., Sergeeva, O. A., Yanagisawa, M., Ohtsu,H., Franco, P., Haas, H. L., and Lin, J. S. (2009) Orexin/hypocretin and histamine: distinct roles in the control ofwakefulness demonstrated using knock-out mouse models.J. Neurosci. 29, 14423–14438

3. Panula, P., Yang, H. Y., and Costa, E. (1984) Histamine-contain-ing neurons in the rat hypothalamus. Proc. Natl. Acad. Sci.U. S. A. 81, 2572–2576

4. Watanabe, T., Taguchi, Y., Shiosaka, S., Tanaka, J., Kubota, H.,Terano, Y., Tohyama, M., and Wada, H. (1984) Distribution ofthe histaminergic neuron system in the central nervous system

4345HISTAMINERGIC REGULATION OF hcrt IN ZEBRAFISH

of rats; a fluorescent immunohistochemical analysis with histi-dine decarboxylase as a marker. Brain Res. 295, 13–25

5. Haas, H., and Panula, P. (2003) The role of histamine and thetuberomamillary nucleus in the nervous system. Nat. Rev. Neu-rosci. 4, 121–130

6. Lin, J. S., Hou, Y., Sakai, K., and Jouvet, M. (1996) Histaminergicdescending inputs to the mesopontine tegmentum and theirrole in the control of cortical activation and wakefulness in thecat. J. Neurosci. 16, 1523–1537

7. Passani, M. B., Lin, J. S., Hancock, A., Crochet, S., and Blandina,P. (2004) The histamine H3 receptor as a novel therapeutictarget for cognitive and sleep disorders. Trends Pharmacol. Sci.25, 618–625

8. Monti, J. M., Pellejero, T., and Jantos, H. (1986) Effects of H1-and H2-histamine receptor agonists and antagonists on sleepand wakefulness in the rat. J. Neural Trans. 66, 1–11

9. Monti, J. M., Jantos, H., Boussard, M., Altier, H., Orellana, C.,and Olivera, S. (1991) Effects of selective activation or blockadeof the histamine H3 receptor on sleep and wakefulness. Eur. J.Pharmacol. 205, 283–287

10. Sakurai, T., Amemiya, A., Ishii, M., Matsuzaki, I., Chemelli,R. M., Tanaka, H., Williams, S. C., Richardson, J. A., Kozlowski,G. P., Wilson, S., Arch, J. R., Buckingham, R. E., Haynes, A. C.,Carr, S. A., Annan, R. S., McNulty, D. E., Liu, W. S., Terrett, J. A.,Elshourbagy, N. A., Bergsma, D. J., and Yanagisawa, M. (1998)Orexins and orexin receptors: A family of hypothalamic neuro-peptides and G protein-coupled receptors that regulate feedingbehavior. Cell 92, 573–585

11. De Lecea, L., Kilduff, T. S., Peyron, C., Gao, X., Foye, P. E.,Danielson, P. E., Fukuhara, C., Battenberg, E. L., Gautvik, V. T.,Bartlett, F. S., 2nd, Frankel, W. N., van den Pol, A. N., Bloom,F. E., Gautvik, K. M., and Sutcliffe, J. G. (1998) The hypocretins:hypothalamus-specific peptides with neuroexcitatory activity.Proc. Natl. Acad. Sci. U. S. A. 95, 322–327

12. Peyron, C., Tighe, D. K., van den Pol, A. N., de Lecea, L., Heller,H. C., Sutcliffe, J. G., and Kilduff, T. S. (1998) Neuronscontaining hypocretin (orexin) project to multiple neuronalsystems. J. Neurosci. 18, 9996–10015

13. Kaslin, J., Nystedt, J. M., Ostergard, M., Peitsaro, N., and Panula,P. (2004) The orexin/hypocretin system in zebrafish is con-nected to the aminergic and cholinergic systems. J. Neurosci. 24,2678–2689

14. Peyron, C., Faraco, J., Rogers, W., Ripley, B., Overeem, S.,Charnay, Y., Nevsimalova, S., Aldrich, M., Reynolds, D., Albin,R., Li, R., Hungs, M., Pedrazzoli, M., Padigaru, M., Kucher-lapati, M., Fan, J., Maki, R., Lammers, G. J., Bouras, C.,Kucherlapati, R., Nishino, S., and Mignot, E. (2000) Amutation in a case of early onset narcolepsy and a generalizedabsence of hypocretin peptides in human narcoleptic brains.Nat. Med. 6, 991–997

15. Nishino, S., Sakurai, E., Nevsimalova, S., Yoshida, Y., Watanabe,T., Yanai, K., and Mignot, E. (2009) Decreased CSF histamine innarcolepsy with and without low CSF hypocretin-1 in compari-son to healthy controls. Sleep 32, 175–180

16. O’Malley, D. M., Kao, Y. H., and Fetcho, J. R. (1996) Imagingthe functional organization of zebrafish hindbrain segmentsduring escape behaviors Neuron 17, 1145–1155

17. Gahtan, E., Tanger, P., and Baier, H. (2005) Visual preycapture in larval zebrafish is controlled by identified reticu-lospinal neurons downstream of the tectum. J. Neurosci. 25,9294 –9303

18. Burgess, H. A., and Granato, M. (2007) Modulation of locomo-tor activity in larval zebrafish during light adaptation. J. Exp. Biol.210, 2526–2539

19. Burgess, H. A., and Granato, M. (2007) Sensorimotor gating inlarval zebrafish. J. Neurosci. 27, 4984–4994

20. Burgess, H. A., Johnson, S. L., and Granato, M. (2009) Unidi-rectional startle responses and disrupted left-right co-ordinationof motor behaviors in robo3 mutant zebrafish. Genes BrainBehav. 8, 500–511

21. Burgess, H. A., Schoch, H., and Granato, M. (2010) Distinctretinal pathways drive spatial orientation behaviors in zebrafishnavigation. Curr. Biol. 20, 381–386

22. Peitsaro, N., Sundvik, M., Anichtchik, O. V., Kaslin, J., andPanula, P. (2007) Identification of zebrafish histamine H1, H2and H3 receptors and effects of histaminergic ligands onbehavior. Biochem. Pharmacol. 73, 1205–1214

23. Kaslin, J., and Panula, P. (2001) Comparative anatomy of thehistaminergic and other aminergic systems in zebrafish (Daniorerio). J. Comp. Neurol. 440, 342–377

24. Sallinen, V., Torkko, V., Sundvik, M., Reenila, I., Khrustalyov,D., Kaslin, J., and Panula, P. (2009) MPTP and MPP targetspecific aminergic cell populations in larval zebrafish. J. Neuro-chem. 108, 719–731

25. Sallinen, V., Sundvik, M., Reenila, I., Peitsaro, N., Khrustalyov,D., Anichtchik, O., Toleikyte, G., Kaslin, J., and Panula, P.(2009) Hyperserotonergic phenotype after monoamine oxidaseinhibition in larval zebrafish. J. Neurochem. 109, 403–415

26. Kobbert, C., Apps, R., Bechmann, I., Lanciego, J. L., Mey, J., andThanos, S. (2000) Current concepts in neuroanatomical trac-ing. Prog. Neurobiol. 62, 327–351

27. Eriksson, K. S., Peitsaro, N., Karlstedt, K., Kaslin, J., and Panula,P. (1998) Development of the histaminergic neurons andexpression of histidine decarboxylase mRNA in the zebrafishbrain in the absence of all peripheral histaminergic systems. Eur.J. Neurosci. 10, 3799–3812

28. Keegan, B. R., Feldman, J. L., Lee, D. H., Koos, D. S., Ho, R. K.,Stainier, D. Y., and Yelon, D. (2002) The elongation factorsPandora/Spt6 and Foggy/Spt5 promote transcription in thezebrafish embryo. Development 129, 1623–1632

29. Thisse, C., and Thisse, B. (2008) High-resolution in situ hybrid-ization to whole-mount zebrafish embryos. Nat. Protocols 3,59–69

30. Chen, Y. C., Priyadarshini, M., and Panula, P. (2009) Comple-mentary developmental expression of the two tyrosine hydrox-ylase transcripts in zebrafish. Histochem. Cell Biol. 132, 375–381

31. Kudo, H., Liu, J., Jansen, E. J., Ozawa, A., Panula, P., Martens,G. J., and Lindberg, I. (2009) Identification of proSAAS ho-mologs in lower vertebrates: conservation of hydrophobic heli-ces and convertase-inhibiting sequences. Endocrinology 150,1393–1399

32. Yokogawa, T., Marin, W., Faraco, J., Pezeron, G., Appelbaum, L.,Zhang, J., Rosa, F., Mourrain, P., and Mignot, E. (2007) Char-acterization of sleep in zebrafish and insomnia in hypocretinreceptor mutants. PLoS Biol. 5, e277

33. Higashijima, S., Mandel, G., and Fetcho, J. R. (2004) Distributionof prospective glutamatergic, glycinergic, and GABAergic neuronsin embryonic and larval zebrafish. J. Comp. Neurol. 480, 1–18

34. Auvinen, S., and Panula, P. (1988) Development of histamine-immunoreactive neurons in the rat brain. J. Comp. Neurol. 276,289–303

35. Panula, P., Airaksinen, M. S., Pirvola, U., and Kotilainen, E.(1990) A histamine-containing neuronal system in humanbrain. Neuroscience 34, 127–132

36. Panula, P., Pirvola, U., Auvinen, S., and Airaksinen, M. S. (1989)Histamine-immunoreactive nerve fibers in the rat brain. Neuro-science 28, 585–610

37. Robu, M. E., Larson, J. D., Nasevicius, A., Beiraghi, S., Brenner,C., Farber, S. A., and Ekker, S. C. (2007) P53 activation byknockdown technologies. PLoS Genet. 3, e78

38. Eisen, J. S., and Smith, J. C. (2008) Controlling morpholinoexperiments: don’t stop making antisense. Development 135,1735–1743

39. Vargas, J. P., Lopez, J. C., and Portavella, M. (2009) What are thefunctions of fish brain pallium? Brain Res. Bull. 79, 436–440

40. Eriksson, K. S., Sergeeva, O., Brown, R. E., and Haas, H. L.(2001) Orexin/hypocretin excites the histaminergic neurons ofthe tuberomammillary nucleus. J. Neurosci. 21, 9273–9279

41. Peitsaro, N., Kaslin, J., Anichtchik, O. V., and Panula, P. (2003)Modulation of the histaminergic system and behaviour by alpha-fluoromethylhistidine in zebrafish. J. Neurochem. 86, 432–441

42. Moree, W. J., Li, B. F., Jovic, F., Coon, T., Yu, J., Gross, R. S.,Tucci, F., Marinkovic, D., Zamani-Kord, S., Malany, S., Brad-bury, M. J., Hernandez, L. M., O’Brien, Z., Wen, J., Wang, H.,Hoare, S. R., Petroski, R. E., Sacaan, A., Madan, A., Crowe, P. D.,and Beaton, G. (2009) Characterization of novel selectiveH1-antihistamines for clinical evaluation in the treatment ofinsomnia. J. Med. Chem. 52, 5307–5310

43. Pillot, C., Heron, A., Cochois, V., Tardivel-Lacombe, J., Ligneau,X., Schwartz, J. C., and Arrang, J. M. (2002) A detailed mappingof the histamine H(3) receptor and its gene transcripts in ratbrain. Neuroscience 114, 173–193

44. Haas, H. L., Sergeeva, O. A., and Selbach, O. (2008) Histaminein the nervous system. Physiol. Rev. 88, 1183–1241

4346 Vol. 25 December 2011 SUNDVIK ET AL.The FASEB Journal � www.fasebj.org

45. Jin, C. Y., and Panula, P. (2005) The laminar histamine receptorsystem in human prefrontal cortex suggests multiple levels ofhistaminergic regulation. Neuroscience 132, 137–149

46. Jin, C. Y., Anichtchik, O., and Panula, P. (2009) Alteredhistamine H3 receptor radioligand binding in post-mortembrain samples from subjects with psychiatric diseases. Brit. J.Pharmacol. 157, 118–129

47. Emran, F., Rihel, J., and Dowling, J. E. (2008) A behavioral assayto measure responsiveness of zebrafish to changes in lightintensities. JoVE 20, 923 doi: 10.3791/923

48. Perala, N., Peitsaro, N., Sundvik, M., Koivula, H., Sainio, K.,Sariola, H., Panula, P., and Immonen, T. (2010) Conservation,expression, and knockdown of zebrafish plxnb2a and plxnb2b.Dev. Dyn. 239, 2722–2734

49. Mueller, T., Wullimann, M. F., and Guo, S. (2008) Earlyteleostean basal ganglia development visualized by zebrafishDlx2a, Lhx6, Lhx7, Tbr2 (eomesa), and GAD67 gene expres-sion. J. Comp. Neurol. 507, 1245–1257

50. Prober, D. A., Rihel, J., Onah, A. A., Sung, R. J., and Schier, A. F.(2006) Hypocretin/orexin overexpression induces an insomnia-like phenotype in zebrafish. J. Neurosci. 26, 13400–13410

51. Naumann, E. A., Kampff, A. R., Prober, D. A., Schier, A. F., andEngert, F. (2010) Monitoring neural activity with biolumines-cence during natural behavior. Nat. Neurosci. 13, 513–520

52. Huang, Z. L., Qu, W. M., Li, W. D., Mochizuki, T., Eguchi, N.,Watanabe, T., Urade, Y., and Hayaishi, O. (2001) Arousal effectof orexin A depends on activation of the histaminergic system.Proc. Natl. Acad. Sci. U. S. A. 98, 9965–9970

53. Bayer, L., Eggermann, E., Serafin, M., Saint-Mleux, B., Machard,D., Jones, B., and Muhlethaler, M. (2001) Orexins (hypocretins)

directly excite tuberomammillary neurons. Eur. J. Neurosci. 14,1571–1575

54. Yamanaka, A., Tsujino, N., Funahashi, H., Honda, K., Guan,J. L., Wang, Q. P., Tominaga, M., Goto, K., Shioda, S., andSakurai, T. (2002) Orexins activate histaminergic neurons viathe orexin 2 receptor. Biochem. Biophys. Res. Commun. 290,1237–1245

55. Kanbayashi, T., Kodama, T., Kondo, H., Satoh, S., Inoue, Y.,Chiba, S., Shimizu, T., and Nishino, S. (2009) CSF histaminecontents in narcolepsy, idiopathic hypersomnia and obstructivesleep apnea syndrome. Sleep 32, 181–187

56. Scammell, T. E., and Mochizuki, T. (2009) Is low histamine afundamental cause of sleepiness in narcolepsy and idiopathichypersomnia? Sleep 32, 133–134

57. Guo, R. X., Anaclet, C., Roberts, J. C., Parmentier, R., Zhang,M., Guidon, G., Buda, C., Sastre, J. P., Feng, J. Q., Franco, P.,Brown, S. H., Upton, N., Medhurst, A. D., and Lin, J. S.(2009) Differential effects of acute and repeat dosing withthe H3 antagonist GSK189254 on the sleep-wake cycle andnarcoleptic episodes in ox-/- mice. Br. J. Pharmacol. 157,104 –117

58. Lin, L., Wisor, J., Shiba, T., Taheri, S., Yanai, K., Wurts, S., Lin,X., Vitaterna, M., Takahashi, J., Lovenberg, T. W., Koehl, M.,Uhl, G., Nishino, S., and Mignot, E. (2002) Measurement ofhypocretin/orexin content in the mouse brain using an enzymeimmunoassay: the effect of circadian time, age and geneticbackground. Peptides 23, 2203–2211

Received for publication May 16, 2011.Accepted for publication August 18, 2011.

4347HISTAMINERGIC REGULATION OF hcrt IN ZEBRAFISH