Top Banner
The E. Coli genome includes approximately 4,000 •Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce Chromosomes •Genes Segments of DNA that specify how to build a protein •genes may specify more than one protein in eukaryotes Chromosome maps are used to show the locus (location)
45

The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Dec 16, 2015

Download

Documents

Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

The E. Coli genome includes approximately 4,000 genes

• Chromosomes Strands of DNA that contain all of

the genes an organism needs to survive and reproduce

Chromosomes

• Genes

Segments of DNA that specify how to build a protein

• genes may specify more than one protein in eukaryotes

Chromosome maps are used to show the locus (location) of genes on a chromosome

Page 2: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

• Genetic Variation Phenotypic variation among organisms is due to genotypic variation

(differences in the sequence of their DNA bases)

Differences exist between species and within a species

• Different genes (genomes) different proteins (proteomes)

• Different versions of the same gene (alleles)

• Differences in gene expression (epigenetics)

Chromosomes

Page 3: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

• Cell Division (mitosis) Cells must copy their chromosomes

(DNA synthesis) before they divide so that each daughter cell will have a copy

A region of the chromosome remains uncopied (centromere) in order to hold the sister chromatids together

– Keeps chromatids organized to help make sure each daughter cell gets exactly one copy

– Nondisjunction is when sister chromatids do not assort correctly and one cell ends up with both copies while the other cell ends up with none

DNA Replication

Page 4: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

• DNA Synthesis The DNA bases on each

strand act as a template to synthesize a complementary strand

• Recall that Adenine (A) pairs with thymine (T)and guanine (G) pairs with cytosine (C)

The process is semiconservative because each new double-stranded DNA contains one old strand (template) and one newly-synthesized complementary strand

DNA Replication

A

G

C

T

G

T

C

G

A

C

A

G

C

T

G

T

C

G

A

C

A

G

C

T

G

T

C

G

A

C

A

G

C

T

G

T

C

G

A

C

T

C

G

A

C

A

G

C

T

G

Page 5: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

DNA Replication• DNA Polymerase

Enzyme that catalyzes the covalent bond between the phosphate of one nucleotide and the deoxyribose (sugar) of the next nucleotide

DNA Polymerization

Page 6: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

3’ end has a free deoxyribose

5’ end has a free phosphate

DNA polymerase:

can only build the new strand in the 5’ to 3’ direction

Thus scans the template strand in 3’ to 5’ direction

DNA Replication

Page 7: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Initiation• Primase (a type of RNA polymerase) builds an RNA primer

(5-10 ribonucleotides long)

• DNA polymerase attaches onto the 3’ end of the RNA primer

DNA Replication

DNA polymerase

Page 8: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Elongation • DNA polymerase uses each strand as a template in the 3’ to 5’ direction to build a complementary strand in the 5’ to 3’ direction

DNA Replication

DNA polymerase

Page 9: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Elongation • DNA polymerase uses each strand as a template in the 3’ to 5’ direction to build a complementary strand in the 5’ to 3’ direction results in a leading strand and a lagging strand

DNA Replication

Page 10: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Leading Strand1. Topisomerase unwinds DNA and then Helicase breaks H-bonds2. DNA primase creates a single RNA primer to start the replication3. DNA polymerase slides along the leading strand in the 3’ to 5’ direction

synthesizing the matching strand in the 5’ to 3’ direction4. The RNA primer is degraded by RNase H and replaced with DNA nucleotides by

DNA polymerase, and then DNA ligase connects the fragment at the start of the new strand to the end of the new strand (in circular chromosomes)

DNA Replication

Page 11: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Lagging Strand1. Topisomerase unwinds DNA and then Helicase breaks H-bonds2. DNA primase creates RNA primers in spaced intervals3. DNA polymerase slides along the leading strand in the 3’ to 5’ direction

synthesizing the matching Okazaki fragments in the 5’ to 3’ direction4. The RNA primers are degraded by RNase H and replaced with DNA nucleotides

by DNA polymerase5. DNA ligase connects the Okazaki fragments to one another (covalently bonds the

phosphate in one nucleotide to the deoxyribose of the adjacent nucleotide)

DNA Replication

Page 12: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Topoisomerase - unwinds DNA

Helicase – enzyme that breaks H-bonds

DNA Polymerase – enzyme that catalyzes connection of nucleotides to form complementary DNA strand in 5’ to 3’ direction (reads template in 3’ to 5’ direction)

Leading Strand – transcribed continuously in 5’ to 3’ direction

Lagging Strand – transcribed in segments in 5’ to 3’ direction (Okazaki fragments)

DNA Primase – enzyme that catalyzes formation of RNA starting segment (RNA primer)

DNA Ligase – enzyme that catalyzes connection of two Okazaki fragments

DNA Replication

Page 13: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Web ResourcesDNA Replication (synthesis)• http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter11/animation_quiz_2.html

• http://www.wiley.com/college/pratt/0471393878/student/animations/dna_replication/index.html

• http://www.biostudio.com/d_%20DNA%20Replication%20Coordination%20Leading%20Lagging%20Strand%20Synthesis.htm

• http://www.biostudio.com/d_%20DNA%20Replication%20Nucleotide%20Polymerization.htm

• http://www.dnalc.org/resources/3d/DNAReplicationBasic_w_FX.html (download this video file from the website to view it without interruptions)

• http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/dna-rna2.swf

• http://www.bioteach.ubc.ca/TeachingResources/MolecularBiology/DNAReplication.swf

Page 14: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

• DNA provides the instructions for how to build proteins

• Each gene dictates how to build a single protein in prokaryotes

• The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein

Protein Synthesis

Nucleotide sequence of His gene

Page 15: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis

Nucleotide sequence of His geneAmino acid sequence of

His protein

• DNA provides the instructions for how to build proteins

• Each gene dictates how to build a single protein in prokaryotes

• The sequence of nucleotides (AGCT) in DNA dictate the order of amino acids that make up a protein

Page 16: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

• Protein synthesis occurs in two primary steps

Protein Synthesis

mRNA (messenger RNA) copy of a gene is synthesized

Cytoplasm of prokaryotesNucleus of eukaryotes

1

mRNA is used by ribosome to build protein

(Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein)

Cytoplasm of prokaryotes and eukaryotes

Some proteins feed directly into rough ER in eukaryotes

2

Page 17: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

(eukaryotes)

Protein Synthesis1) INITIATION

• Transcription Initiation RNA polymerase binds to a region on DNA known as the promoter, which signals the start of a gene

Promoters are specific to genes

RNA polymerase does not need a primer

Transcription factors assemble

at the promoter forming a transcription initiation complex – activator proteins help stabilize the complex

Gene expression can be regulated (turned on/off or up/down) by controlling the amount of each transcription factor

Page 18: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis1) INITIATION

• Transcription Elongation RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another

Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template)•recall RNA uses uracil instead of thymine

AGTCAT

UCA GUA

Page 19: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• Transcription

Elongation RNA polymerase unwinds the DNA and breaks the H-bonds between the bases of the two strands, separating them from one another.

Base pairing occurs between incoming RNA nucleotides and the DNA nucleotides of the gene (template)•recall RNA uses uracil instead of thymine

RNA polymerase catalyzes bond to form between ribose of 3’ nucleotide of mRNA and phosphate of incoming RNA nucleotide

3’

5’

3’

5’

+ ATP

+ ADP

Page 20: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• Transcription

ElongationThe gene occurs on only one of the DNA strands; each strand possesses a separate set of genes

Page 21: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis1) INITIATION

• Transcription Termination A region on DNA known as the terminator signals the stop of a gene

RNA polymerase disengages the mRNA and the DNA

Page 22: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Exons are “coding” regions

Introns are removed

different combinations of exons form different mRNA resulting in multiple proteins from the same gene

Humans have 30,000 genes but are capable of producing 100,000 proteins

Protein Synthesis• Alternative Splicing (eukaryotes only)

Page 23: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Web ResourcesTranscription• http://www.biostudio.com/d_%20Transcription.htm

• http://www.youtube.com/watch?v=WsofH466lqk

• http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html

Alternative Splicing• http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related

Page 24: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

mRNA copy of a gene is synthesized

Cytoplasm of prokaryotesNucleus of eukaryotes

1

Protein Synthesis

mRNA is used by ribosome to build protein

(Ribosomes attach to the mRNA and use its sequence of nucleotides to determine the order of amino acids in the protein)

Cytoplasm of prokaryotes and eukaryotes

Some proteins feed directly into rough ER in eukaryotes

2

mRNA

Transcription

Translation

mRNA

tRNA synthesis

Page 25: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Transcription

Translation

mRNA

tRNA synthesis

Protein Synthesis• Translation

Every three mRNA nucleotides (codon) specify an amino acid

Page 26: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• Translation

tRNA have an anticodon region that specifically binds to its codon

Page 27: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Transcription

Translation

mRNA

tRNA synthesis

Protein Synthesis• Translation

Each tRNA carries a specific amino acid

Page 28: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Transcription

Translation

mRNA

tRNA synthesis

Protein Synthesis

Aminoacyl tRNA synthetases attach amino acids to their specific tRNA

Page 29: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• TranslationInitiation Start codon signals where the gene begins (at 5’ end of mRNA)

AUGGACAUUGAACCG…5’ 3’

start codon

Translation

mRNA

Page 30: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• TranslationInitiation Start codon signals where the gene begins (at 5’ end of mRNA)

Ribosome binding site (Shine Dalgarno sequence) upstream from the start codon binds to small ribosomal subunit

–then this complex recruits the large ribosomal subunit

Small ribosomal subunit

Small ribosomal subunit

Ribosome

Large ribosomal subunit

Page 31: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• TranslationScanningThe ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein

large ribosome subunit

small ribosome subunit

Page 32: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• TranslationScanningThe ribosome moves in 5’ to 3’ direction “reading” the mRNA and assembling amino acids into the correct protein

Page 33: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• TranslationTerminationRibosome disengages from the mRNA when it encounters a stop codon

Page 34: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Web ResourcesTranslation• Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related

• Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm

• http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm

• http://www.johnkyrk.com/DNAtranslation.html

• http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html

• http://www.dnalc.org/resources/3d/TranslationAdvanced.html

Page 35: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Practice QuestionTranslate the following mRNA sequence

AGCUACCAUACGCACCCGAGUUCUUCAAGC

Page 36: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Practice QuestionTranslate the following mRNA sequence

AGCUACCAUACGCACCCGAGUUCUUCAAGCSerine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

Page 37: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser

Practice QuestionTranslate the following mRNA sequence

AGCUACCAUACGCACCCGAGUUCUUCAAGCSerine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

Page 38: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Serine – Tyrosine – Histidine – Threonine – Histidine – Proline – Serine – Serine – Serine - Serine

Practice QuestionTranslate the following mRNA sequence

AGCUACCAUACGCACCCGAGUUCUUCAAGC

S – Y –H– T – H – P – S – S – S - S

Ser – Tyr – His – Thr – His – Pro – Ser – Ser – Ser - Ser

Page 39: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• Multiple RNA polymerases can

engage a gene at one time

• Multiple ribosomes can engage a single mRNA at one time

DNA mRNAs

Transcription

Translation

Page 40: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Protein Synthesis• Eukaryotes:

transcription occurs in the nucleus and translation occurs in the cytoplasm

• Prokaryotes: Transcription and translation occur simultaneously in the cytoplasm

Page 41: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

• There are four main types of RNA:1. mRNA

- RNA copy of a gene used as a template for protein synthesis

2. rRNA - part of structure of ribosomes

3. tRNA- amino acid carrier that matches to mRNA codon

4. snRNA - found in nucleus where they have several important jobs

RNA

Page 42: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

1. Why is DNA synthesis said to be “semiconservative”?

2. What role do DNA polymerase, DNA primase (a type of RNA polymerase), helicase, topoisomerase, RNase H, and ligase play in DNA replication?

3. What is the difference between how the leading strand and lagging strand are copied during DNA replication? Why do they have to be synthesized differently in this fashion?

4. What would happen if insufficient RNase H were produced by a cell? What if insufficient ligase were produced by a cell?

5. What are four key differences between DNA polymerase and RNA polymerase? (“they are difference molecules” doesn’t count as one!)

6. Compare and contrast codons and anticodons?

7. What is alternative splicing? Why is it necessary in eukaryotes?

8. During translation, what amino acid sequence would the following mRNA segment be converted into: AUGGACAUUGAACCG?

9. How come there are only 20 amino acids when there are 64 different codons?

10. How come prokaryotes can both transcribe and translate a gene at the same time, but eukaryotes cannot?

Practice Questions

Page 43: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Web ResourcesTranscription• http://www.biostudio.com/d_%20Transcription.htm

• http://www.youtube.com/watch?v=WsofH466lqk

• http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.html

Translation• Eukaryotic: http://www.youtube.com/watch?v=5bLEDd-PSTQ&feature=related

• Prokaryotic: http://www.biostudio.com/d_%20Protein%20Synthesis%20Prokaryotic.htm

• http://www.biostudio.com/d_%20Peptide%20Bond%20Formation.htm

• http://www.johnkyrk.com/DNAtranslation.html

• http://www.dnalc.org/resources/3d/TranslationBasic_withFX0.html

• http://www.dnalc.org/resources/3d/TranslationAdvanced.html

Alternative Splicing• http://www.youtube.com/watch?v=FVuAwBGw_pQ&feature=related

Page 44: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Insulin Example of Protein Synthesishttp://www.biotopics.co.uk/as/insulinproteinstructure.html

Hemoglobin Example of Protein Synthesishttp://www.biotopics.co.uk/as/insulinproteinstructure.html

Collagen Example of Protein Synthesishttp://www.biotopics.co.uk/JmolApplet/collagen.html

Web Resources

Page 45: The E. Coli genome includes approximately 4,000 genes Chromosomes Strands of DNA that contain all of the genes an organism needs to survive and reproduce.

Images• http://www.kscience.co.uk/as/module1/pictures/bacteria.jpg

• http://www.biologie.uni-hamburg.de/b-online/library/onlinebio/14_1.jpg

• http://pharmamotion.com.ar/wp-content/uploads/2009/12/nrti_mechanism_action_antiretrovirals.jpg

• http://biology200.gsu.edu/houghton/4564%20%2704/figures/lecture%204/AAAreverse.jpg

• http://www.ebi.ac.uk/thornton-srv/databases/pdbsum/2d8x/traces.jpg

• http://www.ncbi.nlm.nih.gov

• http://xarquon.jcu.cz/edu/uvod/09nucleus/092function/images/activation3.jpg

• http://www.ncbi.nlm.nih.gov

• http://bass.bio.uci.edu/~hudel/bs99a/lecture23/lecture4_4.html

• http://selfhpvdna.diagcorlab.com/images/images/CervicalCancer.jpg