The Biotechnology Of Cannabis Sativa

The Biotechnology of Cannabis sativa

Sam R. Zwenger

April, 2009

! "!

! #!

This book is dedicated to the future of humankind. Please distribute it at no charge.

“I smoke pot, and I like it.”

-Anonymous

Table of Contents:

Introduction

1. The Botany of Cannabis sativa

2. Plant Biotechnology

3. Tissue Culture

4. Agrobacterium tumefaciens

5. The GFP Leaf

6. Woody Cannabis

7. Terpene Production

8. The THC Pathway

9. Smoking Roses and Other Proposals

10. Cannabis DNA Sequencing

11. Molecular Tools

12. Marijuana Laws, Regulations, and Education

Appendix A: Representative list of interesting genes to be used for

Cannabis transformation.

Appendix B: Vendors of biotechnology equipment and reagents.

Glossary

! $!

Introduction

Marijuana, whose scientific name is Cannabis sativa, is perhaps the most famous plant

ever discovered by humans. Since its discovery it has been used by millions of people for

both inducing pleasure and alleviating pain. Cannabis has a rich history, complex biology

and a fascinating physiology.

Molecular biology and plant biotechnology are only beginning to uncover the secrets of

this plant. Scientists now have the opportunity to grow Cannabis plants in vitro (in a test

tube or Petri dish), thereby being able to genetically modify these plants in dozens of

ways. Fluorescent Cannabis, THC-producing roses, Cannabis that climbs like a vine, and

phenomenal increases in branch number and flower size are only a few of the ways in

which this plant can be enhanced through biotechnology.

Many would benefit from Cannabis biotechnology. For example, producing genetically

transformed, THC-containing weed species might be an effective way to bypass legal

issues and still allow sufferers of chronic illnesses to self-medicate. In other words, with

biotechnology the legalities concerning Cannabis cultivation diminish. Within the next

few years, through biotechnology, a surrogate plant will soon be created that synthesizes

THC. This might lead some policy makers to increase their vigilance against the THC

molecule itself. Conversely, they may finally put their war on this beneficial plant to rest.

The purpose of this book gives insight into the possibilities that biotechnology can

provide to the Cannabis community and the world. It begins with a botanical introduction

and continues with an explanation of biotechnology and techniques, examples and

purpose for genetically modifying Cannabis, THC biosynthesis and cellular interaction,

and information on some necessary molecular biology techniques.

The tools of biotechnology, such as DNA sequencing and gene cloning, are speeding up

the reality that this highly controversial plant will continue to make an impact on human

societies for generations to come. This book covers advances and techniques on how to

grow plant tissue in vitro, genetically modify this tissue, and re-grow it in order to

produce a transgenic Cannabis plant. Anyone who wants to know what the future holds

for Cannabis sativa and marijuana should read this book.

! %!

1. The Botany of Cannabis sativa

Before explaining the features of plant biotechnology, it is important to have an

understanding about what parts of the plant may be genetically modified. Therefore, by

introducing some concepts in plant anatomy and physiology, this chapter serves as a

platform for how a biotechnology experiment may modify the Cannabis plant.

Within the great diversity of life there exists the plant kingdom. This kingdom covers a

vast array of different species, some used by humans and others not yet discovered or

their potentials unrealized. The plant kingdom is unlike the animal and fungi kingdoms.

Plants make their own carbon compounds, such as sugars and starches, through their

ability to perform photosynthesis. They do this via intricate biochemical machinery that

has developed through more than 2 billion years of evolutionary forces.

The evolution of Cannabis represents a fascinating phenomenon. Early in the evolution

of life on earth, some floating cells in the ocean swallowed tinnier cells. This lead to the

theory of endosymbiosis, which states that these prehistoric larger cells were unable to

digest the smaller cells they had engulfed (Reyes-Prieto et al., 2007). This process

explains why plants have both chloroplasts (for photosynthesis) and mitochondria (for

respiration). Both of these organelles are easily observed with any compound microscope

and represent living proof of the past event of endosymbiosis.

This timeline shows that Cannabis is thought to have first arisen about 34 million

years ago based on work by McPartland and Nicholson (2003).

Thus, evolutionary change through time has pushed plants, like other organisms, to

become very efficient in their environmental interactions. Plants stand out from other

organisms not only because they do photosynthesis, but also because they have a cell

wall with depositions of cellulose, an incredibly large carbohydrate that functions like

rebar in concrete slabs. This is one reason that plants were able to make the transition

from water to land; they had better cellular structures (i.e., a rigid cell wall) to hold

themselves upright. The development of lignin, the compound that gives wood its

characteristic strength, came later in evolution and gave plants an added benefit for living

on land.

However the fundamental distinguishing characteristic, which sets plants apart from all

other organisms, is their alternating life cycles between a diploid sporophyte and a

! &!

haploid gametophyte. Diploid means that an organism has two copies of each

chromosome and haploid means it has only one copy of each chromosome. These

alternate between the organism and its reproductive cells. Hence, plants have an

alternation of generations. The large pine that might be observed in a city park or a

neighbor’s front yard is the diploid spore-bearing generation. The pollen you see in the

spring is the haploid gametophyte.

With this considered, the Cannabis plant is a sporophyte that releases gametes, which

includes the pollen. When pollen is released its main objective is to fertilize the ovule,

which upon fusing together, yields a diploid embryo. Wondering how plants to new areas

then, it follows that the marijuana embryo develops into a mature storage capsule (a seed)

that can be transported by birds, or in some cases, the postal service. This is, of course,

with the gracious assistance of seed companies.

The plant kingdom is nicely divided into many subdivisions, but perhaps the most

important one to many plant taxonomists is the family level. Plant families include the

sunflower family (Asteraceae), the bean family (Leguminosae), and the grass family

(Poaceae). There are more than 300 plant families but the one we will concern ourselves

with, at least in this book, is the hops and cannabis family (Cannabaceae).

Domain Eukaryota Eukaryota

Kingdom Planta Animalia

Phylum Angiosprems Chordata

Class Dicotyledones Mammalia

Order Cannabales Primates

Family Canabaceae Hominidae

Genus Cannabis Homo

species C. sativa H. sapiens

!"#$%&'(")*"+*,"-*#%&'./%)%*%)0*,/#%)(*%&1*$2%310*%33"&0')4*5"*3/&&1)5*

6'"2"4'3%2*32%(('+'3%5'")7

The Cannabaceae family is composed of two genera. Humulus, the plant used for making

beer taste “hoppy”, has two species within its genus. The genus Cannabis has only one

species C. sativa. However, this has been greatly debated. Some researchers argue that a

second species originating in India (C. indica) is a valid species. Others content that C.

indica is a subspecies and should be treated as a variety rather than an independent

species. Years ago, the wild type variety of hemp was referred to as C. ruderalis. The

origins of Cannabis have been examined using genetic tools (Mukherjee et al., 2008).

! '!

Because much of the debate continues on how many species of Cannabis exist, we will

leave it to rest for the time being.

One reason Humulus and Cannabis are placed in the same family is that hops and

marijuana both grow in similar sexual morphs. They are dioecious plants, which means

they have separate male and female flowers. Dioecy occurs in ~5% of flowering plants

(Thomson, 2006).

Nearly three-fourths of flowering plants have perfect flowers, due to having both male

(stamens) and female (pistil) parts within the same flower. Strangely, Cannabis and a few

other plants are outside of this normalcy; their male and female flowers grow on

completely separate individuals (i.e., they have imperfect flowers). Because there is a

male plant and a female plant, out-breeding (exchanging genetic material between non-

related individuals) is maximized, and may be seen as an evolutionary advantage because

it allows for more genetic diversity.

The female plant is what marijuana smokers are most interested in, unless they are

sexually propagating a new variety. The male plant is interesting too, from an

economical, environmental, and agricultural perspective. Indeed, many books have been

published on hemp (Robinson, 1996; Herer, 2000; Conrad, 1997). However, only a

limited number of governments have realized the strength of hemp fibers and have

subsequently allowed industrial production. China is by far the largest producer of hemp

in the world today (Wang and Shi, 1999)

Hemp is not considered to have large amounts of resin, the material that contains the

psychoactive compounds most breeders desire. Resin, a sticky and chemically complex

substance, is often secreted through glandular trichomes on Cannabis leaves and flower

surfaces. There are two basic types of trichomes, glandular and non-glandular. Non-

glandular trichomes, in most species, are small, hair-like projections of a modified

epidermal cell that have evolved to restrict water loss from the leaf’s stomatal pores,

which function similarly to the pores in human skin (i.e., they regulate internal

temperature). Although stomata often serve to transpire water vapor from the organism

and thus, facilitate a cooling effect, the plant eventually loses this water to the

atmosphere. The process of transpiration also helps distribute soil ions, water, and

nutrients through the plant. When plants lose water they eventually need additional water

at a later time for growth and cellular processes. Therefore to reduce this loss, non-

glandular trichomes help retain at least some of the plant’s water before it leaves the

stomata. Often plants that are adapted to arid or dry habitats are covered with non-

glandular trichomes.

Most important to Cannabis cultivators are glandular trichomes. These too are modified

epidermal cells but function in secreting resin. There are many functions of the resin.

Some have asserted that it aids in capturing pollen, however there is presently no research

that supports this belief. It seems more logical, and in fact has been correctly asserted,

that resin plays some role in attracting pollinators for the flower (Armbruster, 1984).

! (!

For example, if the female Cannabis is kept free from pollination, glandular trichomes

will secrete more resin. The subsequent resin production attracts pollinators through this

method. The sticky resin secreted by the glandular trichomes continues production as

long as pollen is prohibited from landing on the stigma. Subsequently, this is the reason

that many Cannabis growers seek to prohibit male plants from interfering with

pollinating their female plants. That is, keeping males plants out of Cannabis gardens

increases resin production in female plants.

When pollen is used it is often in the form of a controlled crossing experiment. Crossing

different plant species is difficult because the pollen grain has exterior surface proteins

that must match up with a genetically compatible female stigma of the same species,

similar to key fitting into a lock (it simply occurs on a molecular level). The stigma,

which is the top part of the pistil that the pollen lands on, also has recognition proteins on

its surface. Sometimes this method is faulty and different plant species by mistake

successfully interbreed, although this is a rare event.

*8*59$'3%2*+2"-1&*:2'29;*-'5,*6&%35(*2%612107*<,1*"=%&9*:)"5*(,"-);*'(*%5*5,1*6%(1*

%)0*%2")4*-'5,*5,1*(5'4#%*%)0*(5921*3"#$&'(1(*5,1*+2"-1&>(*$'(5'27*

Many genes control resin production. However many genes also control the genetic path

for plant development. Flowers are no exception to this and many genes have been

! )!

identified that play a role in the flowering process. The most popular model for flower

development is known as the ABC model (Soltis et al, 2007). This is based on the fact

that there are four whorls in a typical flower. The first whorl is the sepals. The petals

make up the second whorl and as one travels towards the center of the flower the next

two whorls are the stamens (male parts) and pistil (female part), respectively. The flowers

of Cannabis are interesting in themselves in that they lack petals but have retained their

sepals. Collectively, the sepals are termed the calyx and it is the calyx that surrounds the

fruit. Within the plant kingdom, various types of fruits exist, the description of which, is

beyond the scope of this botanical overview. Suffice it to say Cannabis produces a fruit

called an achene, where the seed and pericarp (outer fruit wall) are attached at the

funiculus (small stalk).

<,'(*(,"-(*5,1*6%('3*$%&5(*"+*%*59$'3%2*+2"-1&7*<,1*$10'312*+/)35'")(*%(*5,1*

(5%2?*"+*5,1*+2"-1&7*@'++1&1)5*$2%)5(*,%=1*1="2=10*0'++1&1)5*('A1(*%)0*)/#61&(*

"+*1%3,*$%&57*B"&*1C%#$21D*%*!"##"$%&*+2"-1&*2%3?(*$15%2(*%)0*/(/%229*,%(*#%21*

:(5%#1)(;*%)0*+1#%21*:$'(5'2;*$%&5(*")*(1$%&%51*$2%)5(7

! *+!

In many cases, transcription factors are needed to give the signal for turning a DNA

sequence into a functioning protein. The ABC model describes transcription factors,

which are proteins that act like an on/off switch for the genes that allow development of

flower parts. The exact function of the A, B, and C transcription factors has been

determined through creating mutated plants that have lost various functions of each of

these genes. By carefully tracking the mutational defects and the associated observable

trait, the function of each gene has been deciphered. Transcription factors for floral

development are normally initiated by alternating periods of light and dark, called the

photoperiod.

Transcription factor Parts encouraged to grow

A Sepals and petals

B Petals and stamens

C Stamens and carpels

E1)1*&14/2%5"&(*')="2=10*')*5,1*8F!*#"012*"+*+2"-1&')47*G%3,*5&%)(3&'$5'")*

+%35"&*'(*%*(#%22*$&"51')*5,%5*%35'=%51(*"5,1&*41)1(D*(5'#/2%5')4*0'++1&1)5*

+2"-1&*$%&5(*5"*01=12"$7*

!

Photoperiod has been shown to play a crucial role in plant flower development. Indeed,

this is a primary reason Cannabis continues vegetative growth in a light cycle of 14-16

hours. During the vegetative stage most indoor Cannabis growers keep their plants on a

long light cycle, in some cases the lights are never turned off. When the light is decreased

to 12 hours or less key signaling events occur within the plant that trigger the ABC

transcription factors that allow up-regulation, or turning on, of flowering genes.

With the diversity of plants on earth (~280 million species) it is a well-grounded

assumption that each plant species has evolved to respond in a slightly different way to

varying photoperiods. This partly explains the diversity in strains that have the ability to

flower early or late. Still, the ABC model of flowering applies to nearly all plants.

There also exists within Cannabis and other plants a protein called cytochrome (Bou-

Torrent et al., 2008). Cytochromes are protein molecules that harbor a chromophore, a

color-absorbing molecule. Depending on the wavelength of light striking the plant

surface, the phytochromes are converted between different states or forms. When the

phytochromes receive red light (660nm) they become the Pfr type, which is active and

allow flowering to proceed. If far-red light (730nm) is detected the phytochrome becomes

the Pr type. The Pr type is a biologically inactive form and so flowering cannot proceed.

An indoor gardener can use this principle to initiate flowering even in a light cycle of 14

or more hours. During the dark period of a plant’s life, they can be given a brief pulse of

red light. This changes the Pr type into the Pfr form and allows flowering to begin.

Interestingly, these same phytochrome proteins play a crucial role in seed germination.

! **!

For instance, the Pfr form of phytochrome allows germination to proceed. Therefore, if

one is having difficulty germinating recently purchased Cannabis seeds, they should try

exposing them to a short period of red light before planting them.

Transcription factors and cytochromes are still just part of a larger system within the

plant cell. Plant hormones are another important part of Cannabis development and

biochemistry and play a crucial role in its genetic modification. There are five prominent

classes of plant hormones, which include auxins, cytokinins, gibberellins, ethylene, and

abscisic acid. An imbalance in any of these can cause strange morphologies within a

plant (Robert-Seilianiantz et al., 2007). The hormones all act as chemical regulators of

gene expression and thus, guide development and the morphology (observable shape) of

Cannabis. After all, the word hormone means “to set motion to”.

Indole-3-acetic acid (IAA) and 2,4-dichlorophenoxyacetic acid (2,4-D) are perhaps the

most widely known auxins. The amino acid tryptophan is enzymatically modified to

produce indole-3-acetic acid. Auxins are commonly found in developing leaves and

seeds. They function to control apical dominance, which is cell division at a terminal bud

or stem. They also play an important role in stimulating flowering and fruit development,

stimulate adventitious roots (growing from the stem) in asexual cuttings (clones), and can

induce ethylene synthesis.

Cytokinins also have many identified structures, perhaps the most common one in plants

is zeatin. Cytokinins are synthesized in the roots and are moved through the xylem to the

shoots to regulate mitosis. Artificial application can induce lateral buds to branch.

Cytokinins will be discussed later due to their important role in culturing Cannabis in

vitro. Cytokinins can also cause a delay in leaf senescence.

Gibberellins were used early on in plant experiments. They elicit perhaps one of the most

dramatic effects on a plant. If two plants are grown in separate pots, side by side and

gibberellins are applied to one plant, that plant will grow several magnitudes taller than

the other. Gibberellic acid is one of the most important and common gibberellins in

plants. Gibberellins are produced from mevalonate, a precursor in synthesis of terpenes (a

class of plant metabolites). They are found in immature Cannabis leaves and seeds. In

most species gibberellins help in elongating shoots and regulate some seed enzymes,

which are proteins that speed up a reaction.

Ethylene (C2H4) is a gas, which functions as a plant hormone. The amino acid methionine

is the precursor, which leads to formation of ethylene. Because ethylene is a small

molecule, it can easily move from cell to cell via diffusion. This hormone gave rise to the

old adage that one bad apple can spoil the whole bunch. Ethylene is most well known for

hastening fruit ripening. When tomatoes are picked and shipped, they are green. Just prior

to arrival at the grocery store the tomatoes are sprayed with this gas, ripening and

reddening the tomato fruits.

Like gibberellins, abscisic acid is also synthesized from mevalonate. It is an important

regulator of stomates and plays a role in seed dormancy. By applying abscisic acid to

! *"!

seeds, they can be kept dormant for shipping, so as not to allow them to mistakenly

sprout.

It should be noted to the reader that only a basic introduction to plant hormones is

provided here. For example, there are additional classes of plant hormones, but limited

knowledge exists on their synthesis and function. These include jasmonates, systemin,

salicylic acid, and the brassinolides. For the purposes of this book, the focus will be on

auxins and cytokinins, since they are used in plant biotechnology.

In Cannabis tissue culture, auxins and cytokinins are used to control root and shoot

formation of a young tissue growing in vitro. From a scientific view it is interesting to

know how Cannabis plants are growing and being maintained within their cells.

Hormones regulate nearly every response and function within the marijuana plant. Most

importantly, because many synthetic hormones are available for anyone to purchase,

experiments with Cannabis and any of these plant hormones can easily be performed by

anyone with a basic understanding of plant biology.

When flowers appear on the plant, more energy is delivered into the flower cells rather

than the vegetative cells. Plants in nature start to lose their flowers and begin seed

production each season when their genetic makeup interacts with environmental cues.

These cues are signaling events that prepare the flower for seed production, seed

maturation, and eventually plant death (annuals) or dormancy (perennials).

The plant roots are important in taking up minerals, ions, and water. There exist small

root hairs on the roots to increase surface area. Therefore, when transferring Cannabis

plants from one container to another, one should be very cautious to keep the soil-root

interface in tact. Disturbance of this interface diminishes the capability for the plant to

take up its needed supplies for metabolism.

Polymer Monomer(s) Example

lipids fatty acids, glycerol cell membrane

proteins amino acids THCA synthase

carbohydrates monosaccharide glucose

nucleic acids nucleotide bases, sugar,

phosphate DNA, RNA

H%3&"#"213/21(*"+*2'+1*0'='010*')5"*5,1'&*#")"#1&*(/6/)'5(*%)0*

&1$&1(1)5%5'=1*1C%#$21(7

Metabolism includes both breaking down materials (catabolism) and building materials

(anabolism). These processes are needed to construct new cells and cellular structures

such as organelles (e.g., mitochondria and chloroplasts). Cellular structures are either

! *#!

made up of lipids, proteins, carbohydrates, or nucleic acids. Each of these four large

molecules necessary for life is found in every living organism and vary in their

arrangement and concentration. Each is also a polymer (multiple units) composed of

smaller monomers (single units).

Light gives plants the ability to make their own food through the process of

photosynthesis. The chromophore (absorbing pigment) in plant chloroplasts that captures

light is chlorophyll. This molecule absorbs strongly at the red and blue ends of the visible

light spectrum. This spectrum represents part of a larger electromagnetic spectrum. Since

energy travels in waves, this spectrum is divided according to its wavelength. Visible

light ranges from ~400-700 nanometers (nm), where one nanometer is a billionth of a

meter. That’s pretty damn tiny! Plants have a difficult time using wavelengths in the

middle of the visible spectrum (~500nm), which is reflected and seen by most humans as

the color green.

Perhaps the most important and familiar structure in the Cannabis plant is the nucleus.

This is the organelle that houses the DNA. Cannabis has twenty chromosomes and is

diploid. This means that it has two copies of each chromosome. By comparison, humans

have 23 chromosomes and are diploid. Genes along the DNA strand code for the proteins

that direct cellular development, flower development, etc. This is discussed in more detail

later, since it deserves its own chapter.

All of these botanical features and how they relate to Cannabis have not been described

in vain. They serve as a platform for the remainder of this book and facilitate a robust

background to host extending ideas on the genetic modification of Cannabis.

! *$!

2. Plant Biotechnology

In many ways plant biotechnology first began when humans initiated cultivating and

genetically crossing varieties of plant species to intentionally produce desired results. For

example, imagine a human ten thousand years ago collecting the pollen from a wheat

plant that was slightly taller then the other wheat plants then dusting this onto the female

flowers of other wheat plants. Over many years of collecting and dusting pollen from the

tall offspring and putting this pollen onto more wheat plants, most of the wheat plants

would be tall.

Nearly every crop food eaten today, including tomatoes, rice, potatoes, corn, barley,

apples, etc., all began as very strange looking varieties of undomesticated plants

thousands of years ago. Only when people recognized that there were patterns of

inheritance did they begin spreading select genes to other plants. Although the primitive

state (short height and small fruit size) of food crops offered our ancestors some gain in

nutrition, the capability to produce more food (taller height and large fruit size) has been

constantly pushed to the limits. Recent gains in realizing the genetic components of crop

species has led to a broader understanding of how foods have been improved over time

(Vaughan et al., 2007).

In fact most scientists today have optimistic views on food production. With

biotechnology there are few limits as to what sort of food can be grown. This means the

boundaries of plant genetic manipulation are still expanding. Biotechnology today is what

applying pollen onto flowers was for humans thousands of years ago. It has allowed our

species to gain larger yields of food on smaller areas of land.

The same basic ideas and patterns of inheritance of crop production have been applied to

marijuana plants. It logically follows that biotechnology should also be applied to

Cannabis crops. There are many benefits that biotechnology can offer Cannabis growers,

whether they are indoor or outdoor growers. The details of how this can be accomplished

are fairly basic but require a fundamental understanding of plant biotechnology to at least

have an intelligent conversation or carry out a reliable experiment. As stated by Albert

Einstein, imagination can be more powerful than knowledge. However imagination is

cultivated more easily through concepts of knowledge, making both imagination and

knowledge necessary for maximum progress.

One of the most fundamental components of plant biotechnology is the ability to

introduce foreign genes. Most high school students have seen the image of a glowing

tobacco (Nicotiana tobaccum) plant. This marked an important event in plant

biotechnology in that it stimulated public interest and created a deeper curiosity for plant

transgenics. Prior to fluorescing tobacco, people in the United States were introduced to

the Flavr Savr tomato, one of the first genetically modified foods introduced to

consumers (Marks, 2007). Boasted as having a longer shelf life in grocery stores, the

Flavr Savr tomato had little taste and left little to savor. This transgenic tomato remained

a poor seller on the market and so was pulled from shelves and discontinued.

! *%!

Among the agricultural industry, perhaps the most popularized gene that has been

introduced to plants is the gene that produces an insect toxin (Romeis et al., 2006). The

toxin, called Bt, is only toxic to certain insects and has no negative effects on humans.

Insects and humans have different proteins lining their digestive tracts. It was one of

these proteins to which the Bt toxin could bind to in insects. Humans lack this protein in

their digestive tract, and thus the toxin cannot bind and disrupt metabolism the way it

does in insects. This was the main reason it was allowed into corn plants. Researchers

subsequently found that insects avoided eating transgenic crop plants with the Bt gene, so

the plants were able to be grown without pesticide or stress from insect infestations. This

provided a huge savings to farmers who were commonly spraying their fields with

expensive pesticides. It also reduced the amount of chemicals going into the croplands.

In another example, quite different than the Bt gene, researchers have put genes into

plants that made them resistant to pesticides, which also grabbed the attention of the

agriculture industry. To give a specific example, the herbicide called glyphosate

(Roundup) kills plants but does not harm animals. Roundup kills plants by inhibiting a

metabolic pathway that only plants have (the pathway to make aromatic amino acids). So

when scientists put the Roundup resistance gene into crop plants, they gave it resistance

to the herbicide. When farmers sprayed with the Roundup pesticide, they did not kill their

crop plants. Instead, all other plants that did not have the Roundup resistance gene died,

including petulant weeds and unwanted invasive plants. The result was a happy crop

plant with no weedy competitors. This biotechnology advancement was so successful that

soybean and corn with Roundup resistance gene are now the most abundant transgenic

food crops grown in the US.

The US has been quick to embrace transgenic crops. Other countries have not been so

quick. At least part of this is due to the work of environmental groups such as Green

Peace, who is strongly opposed to GM (genetically modified) crops. Groups such as

Green Peace argue that some of these genes that are put into the plants can behave in

unpredictable ways. For example, suppose a person were to plant transgenic corn that had

the Roundup gene. Since all corn releases pollen during its flowering stage, that pollen

carries the gene for Roundup resistance. If the pollen with this gene were to then become

incorporated into a weedy or invasive plant species, there may be some concern. Imagine

a farmer that uses Roundup corn and then when they go to spray to kill the weeds, they

find that the weeds will not die; they have acquired the resistance to the pesticide. It has

been argued that the accidental incorporation of the resistance gene may produce such

“super weeds”.

Groups such as Green Peace often give both of these scenarios; transgenic Bt crops

killing beneficial insects or herbicide resistance genes being incorporated into other

plants to make “superweeds”. The process of genes migrating from genetically modified

plants into other non-genetically modified plants is known as gene pollution. Certainly

genetic pollution of the environment should be a concern. The emergence of transgenic

weeds that are resistant to an herbicide is not desirable by either the farmers or the

corporations selling the herbicides. In fact, preventing weedy plants from acquiring the

pesticide resistance genes is a major goal of agricultural biotechnology industries. This is

! *&!

because they have a vested interest in assuring that their pesticide continues to retain its

effectiveness.

Arguably, genetically modified crops need more research in order to understand their

complete role and influence on the natural environment. However, many countries have

moved ahead, confident that genetically modified crops are the best way to obtain food

and other raw materials such as cotton. Based on current statistics the United States is by

far the largest producer of transgenic crops (James, 2005). Argentina, Brazil, Paraguay,

and Canada are the next largest producers. Cotton is the most common transgenic non-

food crop while soybean is the largest transgenic food crop (Stewart, 2008).

The great majority of plant genetic research and information on plant biotechnology in

the last few decades was aided with a small mustard plant called Arabidopsis thaliana.

Many researchers like Arabidopsis because it offers a short life cycle of about six weeks

from seed to maturity, is easy to grow, is small and therefore easy to work with, and has a

small genome (~157 Mbp) (Johnston et al., 2005). An organism’s genome is the complete

set of genes, which all reside on the chromosomes, that it posses. Arabidopsis has served

as a model organism quite well, so well in fact, plant researchers around the world use it

for genetic, developmental, and evolutionary studies.

<,1*#"012*$2%)5*'("$%)*+&%&,-."/%"#"7*<,'(*(#%22*#/(5%&0*$2%)5*'(*/(10*

1C51)('=129*')*41)15'3*(5/0'1(*+"&*/)01&(5%)0')4*5&%'5(*"+*5,1*$2%)5*?')40"#7

There has been a wealth of information from this little mustard plant. Fortunately, much

that has been learned from Arabidopsis can be applied to Cannabis. There are many

genes that have been identified in Arabidopsis that are now waiting to be found in

! *'!

Cannabis (see Appendix A). Once these genes are found in Cannabis (called homologous

genes), they can be manipulated and induced to have a higher expression rate or knocked

out of the plant altogether. The result will be a plant of almost any form, with any trait

desirable. These genes are more exciting than the genes that stop insect damage or

provide herbicide resistance. In fact, the most difficult part of genetically modifying

Cannabis is going to be deciding on which gene to manipulate! The process of creating a

transgenic plant can often be tedious and time consuming. Fortunately, there only needs

to be one person to make transgenic Cannabis plants and then the seeds can be shared

with others. Regardless, it is important to understand the process of making a transgenic

Cannabis plant.

! *(!

3. Plant Tissue Culture

Tissue culture is a method where living tissue is sustained apart from an entire organism.

It allows for growing organs (i.e. roots) or cell masses in vitro, which literally means, “in

glass”. This requires the tissues be placed on a special growth media that contains all the

necessary ions and sugars to sustain its growth and energy needs. This is called plant

tissue culture. Fortunately for plant biotechnologists, plant tissues grown on this type of

media are also very susceptible to taking up foreign DNA. This is how transgenic plants

are often created.

Plant tissue culture has emerged as a way to genetically modify crop plants; hence many

techniques are available for specific species (Smith, 2008). There are three well-

understood methods for delivering a foreign gene into a plant. These are the floral dip,

the gene gun, and the bacteria, Agrobacterium tumefaciens. Each has advantages and

disadvantages and varies in use among institutions and researchers.

The floral dip is the easiest way to insert a foreign gene. When Arabidopsis is flowering,

it can be dipped upside down into a liquid broth culture of Agrobacterium.

Agrobacterium is a special type of bacteria that is able to transfer its DNA to the plant

(discussed more later). This means that some of the Arabidopsis flowers will be infected

with the Agrobacterium DNA. The floral dip is most commonly performed only with

Arabidopsis. Limited information exists on its efficacy on other plants. Considering the

size that Cannabis can become, this method may not be desirable. However, empirical

research is needed before this claim can be justified.

The second mode of introducing genes into plants is through the use of a gene gun. This

is a device that shoots microscopic metallic beads that are covered in a gene. The metal

beads are shot at a high enough velocity into a living plant so that some of the beads

penetrate the plant cell nucleus and the genes on the beads are incorporated into the plant

genome. The device costs a fortune (~15,000USD) and is therefore not used by the

majority of labs.

Perhaps the most pragmatic and cost-effective method of introducing a gene circles

around plant tissue culture. This method of plant transformation has proven to be quite

useful for many different species of plants. Although it takes many months from the start

tissue culture to the final product of a genetically modified plant, the method is very

affordable and most labs can accommodate the technical requirements. This method is

also the oldest of the three gene delivery methods, having its beginnings in the early

1900’s in Germany from work by Heldebrant (Thorpe, 2007).

Successful transfer of a foreign gene using plant tissue culture depends on a bacterium

known as Agrobacterium. The way Agrobacterium works is described in the next chapter

so will not be discussed in detail here. For now, it is important to know some plant

physiology pertaining to plant tissue culture.

! *)!

Plants have a meristematic region where cell division is actively occurring. The meristem

is similar to the stem cells of humans in that they can divide many times. This tissue also

has what is called totipotency, which is the ability to divide and develop into any plant

cell type. Tissue culture takes advantage of meristems by allowing the researcher to grow

a piece of stem on sterile growth media, which supports the meristematic tissue’s

nutritional and energy needs.

,-./0!123450215!6-.7!./!416830./0!38-2!4/!/80!8/-7!94802:;/8-8<7!9=0!.-58!6-./0!

948-8<7>!?;252!.32.5!@40;4/!6-./0!0455=25!.32!:8118/-7!A8=/B!8/!0;2!0465!83!50215!

./B!38805>!,23;.65!0;2!1850!A.14-4.3!0762!8A!12345021!45!.60-7!:.--2B!0;2!.64:.-!

12345021>!C64:.-!5416-7!32A235!08!0;2!-8:.048/!8A!0;2!0455=2D!40!45!A8=/B!8/!0;2!6-./0E5!

.62F!G83!2/B5H>!I4J4B4/<!:2--5!@40;4/!0;2!3880!.64:.-!12345021!.32!@;.0!.--8@!0;2!

6-./0!3880!08!<38@!A.30;23!B8@/!4/08!0;2!584->!K414-.3-7L!0;2!5;880!.64:.-!12345021!

.--8@5!A83!J2304:.-!<38@0;L!83!0.--/255L!8A!0;2!6-./0>!M;2/!!"##"$%&!2-8/<.025!405!

38805!./B!5;8805!0;2!.64:.-!123450215!.:0!.5!<=4B4/<!A83:25>!

C/80;23!12345021.04:!32<48/!45!N/8@/!.5!0;2!-.023.-!12345021>!M;4-2!0;27!.32!

5414-.3!4/!;.39834/<!.:04J2-7!B4J4B4/<!:2--5L!-.023.-!123450215!B4AA23!A381!.64:.-!

123450215!97!638J4B4/<!-.023.-!<38@0;>!?;2!:2--!B4J4548/!45!8::=334/<!O=50!=/B23!0;2!

6-./0E5!264B231.-!0455=25!.-8/<!50215!./B!93./:;25L!;2/:2!40!4/:32.525!0;2!0;4:N/255!

8A!0;252!6.305>!P83!4/50./:2L!-.023.-!123450215!4/!!"##"$%&!<4J2!0;2!6-./0!50=3B4/255!

./B!.94-407!08!;8-B!-.3<2!A-8@235!-.023!4/!405!-4A2!:7:-2>!Q.//.945!<38@235!@;8!;.J2!

52-2:02B!A83!4/:32B49-7!-.3<2!9=B5!8A02/!B25432!0;4:N!-.023.-!123450215!4/!83B23!08!

N226!0;243!6-./05!A381!A.--4/<!8J23>!

R23450215!.32!;8318/.--7!:8/038--2B!97!.=F4/>!?;232A832L!:;./<4/<!0;2!6-./05!.=F4/!

-2J2-5!4/J8-J2B!4/!54</.-4/<!.AA2:05!405!12345021.04:!32<48/5>!?;2!.=F4/!.:05!-8:.--7!8/!

0;2!.64:.-!12345021!97!4/B=:4/<!:2--!B4J4548/!9=0!@;2/!40!03.J2-5!08!80;23!9=B!

32<48/5L!0;2!.=F4/!4/;49405!0;21!A381!<38@4/<>!S/!0;2!32.-1!8A!6-./0!6;7548-8<7!0;45!

12:;./451!45!:.--2B!.64:.-!B814/./:2L!./B!45!0;2!1.4/!32.58/!0;.0!6-./05!8A02/!<38@!

0.--23!0;./!@4B2>!SA!.!62358/[email protected]!08!3218J2!0;2!B814/./0!.64:.-!12345021!G0;2!046!8A!

0;2!-8/<250!6.30!8A!0;2!1.4/!93./:;HL!-.023.-!9=B5!@8=-B!92!.--8@2B!08!B2J2-86!./B!

0;2!6-./0!@8=-B!0.N2!8/!.!9=5;7!.662.3./:2>!!

The lateral meristem is perhaps the most important meristem used in to plant

biotechnology. Again, this is because the lateral meristem that contains the totipotent

actively dividing cells. It is these cells that are allowed to grow on plant tissue culture

Petri plates.

*

! "+!

!<-"*59$1(*"+*3/25/&1*#15,"0(*+"&*4&"-')4*$2%)5*5'((/1*')*='5&"D*%*5&%0'5'")%2*

I15&'*0'(,*")*5,1*21+5*%)0*%*H%41)5%*3/25/&1*6"C*")*5,1*&'4,57*<,1*H%41)5%*6"C*

'(*2'?1*%*5%22*I15&'*0'(,*5,%5*#%')5%')(*(51&'21*3")0'5'")(*%)0*%22"-(*=1&5'3%2*

1C$%)('")*"+*%*5&%)(+"&#10*$2%)57

Just prior to initiating tissue culture, a plant is diced along its stem and the pieces, called

explants, are placed onto tissue media. Conditions must remain sterile so that the stem

pieces are not contaminated with microscopic dust particles that often contain fungal

spores and bacteria. If improper technique is used and sterility is not achieved, fungal or

bacterial contamination will be obvious in several days to a few weeks.

Because sterility of tissue culture is of the upmost importance, the details of the technique

need to be described. First, it is highly recommended that the plant stem be young (4-5

weeks). The Cannabis seedling should also be grown indoors as the outdoor air is filled

with spores and bacteria that will easily cling to the surface of the cut plant. If this

happens contamination will be noticeable a few days after the plant has been diced and

placed onto culture media.

Collection of the stem should be carried out with a few simple tools. A small tweezers is

used to clasp the plant at the base. Similarly, one might prefer to gently pinch the top of

the plant to keep it steady. A scissors is used to snip the young plant at the base. Any

leaves that have developed are trimmed off. Careful attention is given so that at no time

will the stem come into contact with the soil or any surface. The final product should be a

! "*!

slender, and preferably straight Cannabis stem. This is placed in a sterile tube and

capped. After capping the tube the stem is ready to be lightly washed with a mild

detergent and 70% alcohol solution. These solutions can be directly added to the tube.

Washing is just as crucial as cutting and trimming the stem. If the wash steps are too

long, the plant cells will die. If the washes are too short, any microbial contaminants will

remain and fungus or bacteria will overrun the growth media. Therefore, a delicate

balance must be achieved to successfully wash the stem without killing the plant cells.

Generally, an initial wash with 70% alcohol (e.g., 3mL water and 7mL 100% alcohol for

a total of 10mL) is used with a drop of tween20, a mild detergent. The detergent is not

always necessary, but it does aid in working the alcohol into the grooves on the outside of

the stem. The tube is capped and shaken vigorously and allowed to sit at room

temperature for 5 minutes. The tube is washed with sterile water and a second wash is

implemented in the same fashion as the first wash but without the detergent. A final wash

with a 1% bleach solution (1mL bleach and 99mL water, using only 10mL of this) is

preferred in some tissue culture methods, however when dealing with stems obtained

from indoor-grown plants this may be superfluous.

Sterile water is used for a series of no more than ten rinses to guarantee that the alcohol

and bleach have been completely washed from the stem. The closed tube is placed in a

sterile laminar flow hood. If you do not have access to a flow hood, you can make a

sterile hood-like environment. I have seen these in a few of my friends’ houses who do

experiments at home. However, biotechnology at home is its own endeavor and will not

be discussed in this book. Tissue culture media should be prepared ahead of time so the

stem can be carefully removed from the sterile tube, diced and placed onto the media.

! ""!

*8*2%#')%&*+2"-*,""0*'(*/(10*+"&*-"&?')4*')*(51&'21*3")0'5'")(7*J51&'21*%'&*'(*

#"=10*0"-)*+&"#*5,1*5"$*%)0*"/5*"+*5,1*,""0*")*5,1*('01(*5"*%="'0*

3")5%#')%5'")*69*/)-%)510*+/)4%2*%)0*6%351&'%2*($"&1(7

Preparing the growth media for Cannabis is not as difficult as one may think. Many

companies sell a powder form of mixed micro and macronutrients, which is mixed with

water and sterilized.

There are two types of media commonly used in plant tissue culture. The first is called

callus media. This is because after placing Cannabis meristematic tissue on it, the

appearance takes on tissue formed over a wound. Because callus media is the first media

used in a plant tissue culture experiment and it forces the plant tissue to form a callus, the

media is aptly named callus initiation media.

The second type of media in plant tissue culture is used at a later stage in the process.

This growth media is called MS media. In the 1970’s two researchers whose last names

were Murashige and Skoog developed this nutrient media (Murashige and Skoog, 1962).

Skoog was an undergraduate working in Dr. Murashige’s lab when he discovered this

media. It is now called MS media in their honor. Both of these media types will be

explained in greater detail. For now, concern will be given to proper preparation of the

media.

! "#!

<,'(*5%621*(,"-(*5,1*')4&10'1)5(*')*HJ*#10'%D*-,'3,*'(*)11010*+"&*4&"-')4*5,1*

$2%)5*5'((/1*+&"#*%*)")K0'++1&1)5'%5')4*3%22/(*')5"*%*3%22/(*-'5,*&""5(7*

Name of Chemical Molecular Formula/Description

ammonium nitrate NH4NO3

calcium chloride CaCl2

magnesium sulfate MgSO4

manganese sulfate MgSO4

Potassium phosphate KH2PO4

ferrous sulfate FeSO4

zinc sulfate ZnSO4

potassium nitrate KNO3

potassium iodide KI

cupric sulfate CuSO4

boric acid` H3BO3

cobalt chloride CoCl2

sodium molybdate Na2MoO4

niacin a coenzyme

pyridoxine (vitamin B6) a coenzyme

ethylenediamine tetra-acetic acid acts as a metal chelator

inositol a sugar

thiamine a coenzyme

glycine an amino acid

indole acetic acid (IAA) root hormone

kinetin shoot hormone

sucrose a common sugar

agar solidifies media

! "$!

Callus initiation media and MS media can be ordered from most any web resource that

deals with biological supplies. As in all other growth media, the contents are shipped in a

dry state, so they must be weighed and mixed with the appropriate amount of deionized

water. Deionized water is important to use because chlorine and other ions in tap water

may interfere with the growth of the explants. After measuring the proper amount of

deionized water, the contents of the media mixture (water and dry media powder) are

stirred and autoclaved.

The autoclave is an oven-like chamber that reaches high pressure and temperatures. The

highest temperature most autoclaves reach is 121°C/250°F. Such high temperatures are

needed because boiling sometimes does not kills bacterial endospores, a type of survival

state used by some bacteria. Prior to autoclaving, agar is also added to the media mixture.

Agar acts as a solidifying agent when the media cools. This too is a powder and is

weighed, usually adding 15 grams per Liter of water. Upon adding and mixing all

ingredients, the opening of the flask or glass container must be covered with aluminum

foil.

! "%!

*<,1*%/5"32%=1*'(*%*2%&41*"=1)K2'?1*3,%#61&D*-,'3,*'(*/(10*5"*(51&'2'A1*2%6*

1L/'$#1)57

After the mixture of water, plant nutrients and agar is autoclaved it is allowed to cool

inside a laminar flow hood. The laminar flow hood creates a negative pressure that aids in

! "&!

keeping the work area sterile. Above the working area, sterile air is blown down. The

flow of air is aided by perforations in the back of the hood and lower front part of the

hood opening that pull on the flowing air.

It is important to remember that the laminar flow hood is the only safe place for carrying

out any work that must be kept free from contamination. Petri dishes are often purchased

in bulk, so that media can be made on demand and MS media plates can be used when

needed. These Petri dishes are disposable, however reusable glass Petri dishes are

available.

J"#1*"+*5,1*6%('3*#%51&'%2(*)11010*5"*614')*!"##"$%&*5&%)(+"&#%5'")M*N;*

G&21)#191&*+2%(?D*O;*4&%0/%510*392')01&D*P;*HJ*%)0*3%22/(*#10'%D*Q;*%4%&D*R;*

$%&%+'2#D*S;*I15&'*0'(,1(D*T;*(3%21D*U;*5-11A1&(*%)0*(#%22*(3'(("&(D*V;*%)5'6'"5'37

Pouring plates is the method of removing the Petri dishes from a clear plastic sleeve,

making stacks of 4-5 plates (i.e., Petri dishes), and carefully opening them one at a time

(starting from the bottom of the stack) while pouring molten media into each plate. It is

one of the first techniques a new lab student learns. Only about 10-20mL of media is

needed for each plate, which is just more than enough to cover the bottom surface of the

plate. Callus media is used in the first part of the experiment, however these techniques

apply to MS media (used later in tissue culture) as well.

! "'!

?;2!12B4.!=52B!08!:=-0=32!:.--=525!8A!!"##"$%&!;.5!720!08!92!6=9-45;2B!4/!./7!

5:42/04A4:!O8=3/.->!T8@2J23L!.!32:462!0;.0!;.5!@83N2B!@2--!A83!1./7!6-./05!45!:.3380!

:.--=5!4/404.048/!12B4.>!K414-.3!12B4.!:./!.-58!92!=52B!A83!5;880!4/404.048/L!@;4:;!45!

:.--2B!:.3380!5;880!B2J2-8612/0!12B4.>!U80;!8A!0;252!:./!92!83B232B!8/-4/2!A381!

Q.38-4/.!U48-8<4:.-!K=66-7!G522!.662/B4F!UH>!?;45!:816./7!638J4B25!63214F2B!

6.:N205!8A!B37!12B4.L!@;4:;!:./!92!68=32BL!.-8/<!@40;!B37!.<.3L!4/[email protected]>!

CA023!.=08:-.J4/<!0;2!;80!-4W=4B!12B4.!45!68=32B!4/08!0;2!,2034!B45;25L!.5!O=50!

B25:3492B>!!

The plates are then carefully lifted one at a time from the stack and laid out inside the

laminar flow hood in a grid-like fashion. As they are placed onto the surface of the flow

hood, the lids are slightly tipped to the side to allow the media to cool faster and excess

moisture to escape. During placement and movement of the plates containing molten

media it is important to not splash media onto the inside lid of the plate. If this happens, it

increases the chance for contamination when working with the plates at a later time.

When the plates have cooled the lids are tipped correctly back into place and they are

restacked into one column. The sleeve is placed back on top of them and they are covered

and the entire contents can be inverted and are kept refrigerated at 4°C/39°F. The entire

process of making media and pouring plates takes approximately 2 hours, although the

time is greatly reduced with practice.

Which brings us back to the sterile tube with the Cannabis stem. The tissue culture plates

with the media should be made the day before the stem clipping and washing steps. Prior

to preparing the stem, the sterile plates should be removed from the refrigerator and

placed inside the flow hood. Inside the laminar flow hood there should also be a small

sterile scissors and tweezers. These should both be autoclaved, usually wrapped in

aluminum foil, to guarantee their sterility, and then opened only in the flow hood. In fact,

these items can be autoclaved along with the media.

There should also be an alcohol dish and a flame. Before use, the ends of the scissors and

tweezers are dipped in the alcohol after which the alcohol is burned off. Keeping them

from touching any part of the hood, the stem is removed with the tweezers and held

steadily over an uncovered Petri dish containing tissue media. Small sections (1-2mm) of

the plant are clipped with the scissors and allowed to fall onto the callus media. Often,

latex gloves are used as a precaution to allowing skin cells or bacteria to fall onto the

plate.

When 5-15 pieces of stem have fallen onto the plate, the sterile tweezers can be used to

manipulate and move the pieces of Cannabis stem. They should be placed equidistant

from one another and gently pushed down to ensure complete contact with the media.

The lid can then be placed back onto the Petri dish. Parafilm, a stretchy plastic film, is

wrapped along the edge of the plate and its lid. This helps in retaining moisture and

keeping the contents sterile.

! "(!

The tissue cultures are put away from any disturbance and are kept at room temperature

(22°C/72°F). They do not need light. After a few weeks the bits of Cannabis stem will

slowly start to change into an amorphous aggregate of totipotent cells. This is called a

tissue callus and contains the genetic components of Cannabis, but has the distinct

quality of being able to develop into any plant organ (totipotency).

Plants, due to their meristematic regions, are unlike animals, which have stem cells, in

that they can be asexually propagated. Using conventional techniques in the laboratory, a

cat's ear could not be grown into a new cat because there is an absence of meristematic

cells. Additionally, complications would arise due to the nutrient and energy demands of

the cat ear. Plant tissue culture is unique in that it allows rapid production of clones of a

desired species with minimal demands required for the growth media.

When the calluses have grown into masses that lack resemblance to the original bits of

stem, they can be inoculated with a few drops of the infectious plant bacterium,

Agrobacterium tumefaciencs.

! ")!

4. Agrobacterium tumefaciens

Much progress has been gained in research through the fundamental understanding that

microbes (bacteria and fungi) are ubiquitous. Bacterial and fungal species are in the air,

water, soil, on all types of surfaces, and can thrive in the human body. Each species has

evolved the molecular machinery to sustain their energy and nutrient needs. For these

reasons they have often been looked at to provide potentially beneficial industrial

applications (Pontes et al., 2007).

In order to reproduce, bacteria divide in a process called binary fission. This creates two

identical offspring, sometimes in as little time as twenty minutes. Fungal spores often

take much longer than this to reproduce. Regardless, the power of microbes should be

respected. Although they are often only a few micrometers in length, they have the power

to overtake a body with a weakened immune system. They have the ability to feed on raw

sewage with glee and a small percentage even smile in the face of antibiotics. It should

not be a surprise, then, that bacteria have found a way to colonize and infect plant tissue.

If the outer epidermal tissue is pierced and the delicate tissue of the plant is exposed to

the outside air, bacterial infection might result. This is often seen on the crown of the

plant, which is the base where the trunk meets the soil. The crown is a likely point of

entry because it is dividing and growing to support the weight of the tree, therefore the

outer layers of tissue are prone to splitting. Among the billions of bacteria that have been

discovered and described is a species known as Agrobacterium tumefaciencs.

This bacterium has evolved the molecular machinery to infect plants in a very interesting

way. It lives in the rhizosphere, which is the area directly around plant roots, and enters

and infects the plant when an opportunity arises. Interesting research has shown that the

relationship between Agrobacterium and some plants involves complex signaling events

(Yaun et al., 2008). The result of this cross talk is what most gardeners call crown root

gall but a plant biotechnologist thinks of as an expected and welcomed tool of

biotechnology.

! #+!

<,1*6%(1*"+*%*5&11*5&/)?*-'5,*%&&"-(*$"')5')4*5"*('51(*"+*')+135'")*69*

'0(*$"1-2(%34*(,"-(*5,1*3,%&%351&'(5'3*?)"6(*:5/#"&(;7

Like other bacteria, Agrobacterium has a genome that contains nearly all its genes needed

for routine metabolism and growth. What makes this bacterium unique is that it has an

extra chromosomal piece of DNA about 200 thousand bases (kb) in size. This extra

chromosomal piece is technically referred to as a plasmid, and can come in various

lengths depending on the bacterial species. It is also important to note that plasmids are

often circular in shape. Interestingly, a part of the plasmid within Agrobacterium can be

transferred to the genome of a plant, thereby passing bacterial genes to a “higher”

organism.

! #*!

@'%4&%#*"+*%)*'0(*$"1-2(%34*$2%(#'0*:)"5*5"*(3%21;7

The ori region, shown on the plasmid above, stands for the origin of replication. This is

the sequence on the DNA that has a specific base sequence that allows for an enzyme to

bind and begin copying the plasmid. Remember, the plasmid DNA must be copied before

a cell divides. Therefore, the enzyme that polymerizes a new plasmid must be able to find

this ori region. The enzyme is (not surprisingly) called DNA polymerase because it is

polymerizes DNA.

Most importantly to Cannabis biotechnology, plasmids can also take up new pieces of

DNA. Consider any gene and call it your gene of choice (or if you can’t think of one, see

Appendix A). This foreign gene can be first transferred to the plasmid, the plasmid

transferred to Agrobacterium, then the Agrobacterium transferred to a plant cell. This is

partly due to that when at the right size and stage, Cannabis callus cultures can be

intentionally infected with Agrobacterium containing the plasmid that contains your gene

of choice. Whew, now that’s a mouth full! Now that your imagination is blossoming with

potential genes to insert, it is important to know some details on these mechanisms. The

! #"!

remainder of this book deals with inserting genes into plasmids, infection of calluses with

Agrobacterium, gene delivery (transformation), and maturing the callus cultures into an

adult transgenic plant.

There are many different strains of Agrobacterium that are available for purchase to

infect plant calluses. Different strains have various positive and negative aspects, such as

the ability to only infect a certain species or type of plant. Many of these strains can be

ordered directly from Internet companies (see Appendix B). Some strains are designed

with part of the transferred DNA (T-DNA), which is the DNA segment that gets

transferred to the plant. For example, the T-DNA might contain the gene that encodes for

a protein with the ability to fluoresce visible light. However, many other genes can also

be chosen for transferring to the Cannabis plant genome. Additionally, many other genes

are necessarily transferred to the calluses. For instance, notice that the Agrobacterium

plasmid has a small gene coding for an enzyme that breaks down the antibiotic

kanamycin. This will become very important later in the transformation process.

The transferred DNA (T-DNA) also contains sequences of nucleotides that code for

enzymes that make two important components that the bacterium will need to survive in

the plant cell (McCullen and Binns, 2006). The first set of genes is for enzymes to make

plant growth hormones, which confuse the plant into dividing and growing its own tissue.

This ultimately results in a crown gall, a knobby protrusion that provides a nice home for

the Agrobacterium. This is fascinating because what is happening is that the

Agrobacterium hijacks control of the plant cell and dictates to the plant cells on how to

grow.

The second set of enzymes on the T-DNA is for enzymes that synthesize opines, rare

amino acids that Agrobacterium needs in order to grow. Opines are so unusual that plants

do not have enzymes that recognize them and therefore, cannot use them. Only the

bacteria can use them, which provides an advantage. The total size of the T-DNA

transferred to the plant is about 23kb.

In addition, the Agrobacterium has regions on the plasmid besides the T-DNA region.

There is a virulence region that is ~40kb and codes for proteins that help guide the T-

DNA into the nucleus of the plant cell. There is also what is called an origin of

replication, or ori region, which simply allows for plasmid replication. Although there are

many more regions of the Agrobacterium plasmid, we will concern ourselves with the T-

DNA segment, since that is of the upmost concern for transforming Cannabis.

After infecting the Cannabis callus with Agrobacterium, the tissue is allowed to remain

in its Petri dish for two days. This is called co-cultivation and gives the Agrobacterium

ample time to infect the plant cells. It is during this time that the T-DNA is inserted into

the plant genome.

When the two days of co-cultivation have passed, the callus tissue is transferred to new

callus growth media. Again, working in the flow hood and sterile conditions are

necessary to keep microbes from landing on the growth media. The new growth media

! ##!

contains two antibiotics. One is to kill the Agrobacterium. This is important because

letting the Agrobacterium continue its growth on the callus will eventual result in plant

cell death. Since the T-DNA has had time to be incorporated into the Cannabis genome,

the death of Agrobacterium is of no concern. A common antibiotic used is timentin,

which kills the Agrobacterium, but has no effect on plant cells.

The antibiotics in the media are not only present to kill Agrobacterium, but also to select

for transgenic plants. Part of the T-DNA passed to the plant genome confers resistance to

kanamycin and if a plant cell has taken up the T-DNA it will grow on media that has had

antibiotic added. Antibiotics are added to warm media after removing the media from the

autoclave. The temperature of the molten growth media should not be more than

55°C/131°F so as not to destroy the molecular structure of the antibiotic.

Plant cells do not tolerate kanamycin and therefore it kills them. Only transformed plant

cells containing the kanamycin resistance gene can survive on the kanamycin antibiotic

media. It is the kanamycin that kills any non-transformed callus cells and allows for only

those calluses that have been genetically modified to survive. This helps in selecting for

only plant calluses that have been genetically modified for subsequent manipulation.

The calluses at this point in the transformation process are very brittle and resemble

small, rough-shaped pieces of soap. When squeezing them with a tweezers they will

easily break into multiple pieces. Sometimes this is desired; many pieces of callus will

lead to many plants. However, many plants may not be necessary, so it is up to the plant

biotechnologist to decide how to distribute the calluses onto the new media.

! #$!

!%22/(1(*4&"-')4*")*I15&'*0'(,*-'5,*3%22/(*#10'%*-'5,*?%)%#93')*%)0*5'#1)5')*

%00107*W)*5,'(*$,"5"D*XY*2'4,5*-%(*(,'))10*5"*')0/31*+2/"&1(31)31*')*"&01&*5"*

3")+'&#*5,%5*5,1*EBI*41)1*-%(*(/331((+/229*5&%)(+1&&107

To make sure all the Agrobacterium have died and only transformed plant cells remain,

the calluses are transferred every 7-14 days to a new Petri dish with callus media and the

two antibiotics (kanamycin and timentin).

After 4-5 weeks of this process the calluses can be transferred for a final time. They are

moved once again using sterile technique. This time each callus is placed on media that

has plant hormones imbedded in it in addition to the antibiotics. The hormones will tell

the calluses that it is time to differentiate into specific cells (leaves, roots, shoots, etc.).

Instead of a Petri dish a taller container with MS media (with hormones) can be used.

This taller container, called a Magenta box, allows for more area that the roots and shoots

will need to grow.

! #%!

I15&'*0'(,*-'5,*+/)4%2*3")5%#')%5'")7*<,1*%&&"-*'(*$"')5')4*5"*5,1*%0=%)3')4*

1041*"+*5,1*+/)4%2*3"2")9D*-,'3,*,%(*%2&1%09*(/&&"/)010*2%&41&*3%22/(1(*5"*5,1*

2"-1&*21+5*%&1%*"+*5,1*0'(,7

To help the calluses develop shoots and roots, a cytokinin (e.g., zeatin) is present to

induce shoot formation while an auxin (e.g., indole acetic acid) is present to induce root

development. These can be used in different ratios, depending on what is desired. For

example, a high auxin to cytokinin ratio favors shoot formation.

Choosing the correct auxin:cytokinin ratio is for the biotechnologists to decide and

depends on the species one is using in the experiment. In some tissue culture powders,

hormones are added, allaying any concentration or ratio concerns that the plant

biotechnologist may have. Manipulating plant hormones within the tissue media is the

underlying reason that a callus changes from being totipotent to initiating organogenesis,

or shoot and root formation. The Cannabis tissue cultures are placed under a suitable

grow light in order to allow the transformed calluses to begin manufacturing chloroplasts

used in photosynthesis.

In as little time as a month small points and protrusions will be seen on the Cannabis

calluses. These are the young shoots and roots beginning to emerge. The calluses are

allowed to continue growing on the MS media until their shoots and roots are at a healthy

size. They will still be very delicate at this point. Just prior to removing the young

genetically modified plants from the Petri dish or Magenta box, they need to be exposed

to the external air. To do this, the lid of the container is opened and air is allowed to

! #&!

circulate through passive diffusion. This process, which lasts about two days, also helps

in hardening the plants in preparation for much lower humidity levels outside of the Petri

dish or Magenta box.

I,"5"4&%$,*"+*3%22/(1(*4&"-')4*")*&""5*')'5'%5'")*#10'%*-'5,*%&&"-(*$"')5')4*

5"*01=12"$')4*&""5(7*J"#1*3,2"&"$,922*:4&11);*$'4#1)5%5'")*'(*%2("*$&1(1)57*

<,1*(#%22*&""5*,%'&(D*-,'3,*')3&1%(1*(/&+%31*%&1%*+"&*"$5'#%2*-%51&*/$5%?1D*

%&1*%2("*='('6217*<,1*')(15*$,"5"*'(*%)*1)2%&41#1)5*"+*5,1*&""5')4*3%22/(7*

It is important to consider that once the developing plants are moved to soil their organs

will have to sustain a young plant. Care should also be taken to minimize exposure of the

young plants to pests or harsh environmental conditions such as temperature fluxuations.

Therefore, before transferring the developing plants consider where they will be grown.

An indoor growth chamber with adequate light is necessary in nearly all situations of

plant transformation. This provides a steady, equilibrated environment with an adequate

light source. Most plant growth chambers allow for temperature, light and sometimes

even CO2 control.

! #'!

A Cannabis callus that has been genetically modified with the GFP gene is shown

growing in a Magenta box. When its roots, shoot and leaves have further developed,

it can be placed in soil and moved to a growth chamber.

If moving the transformed Cannabis to a greenhouse or an outdoor area, they need time

to slowly adjust. Small increases of time in exposure to less favorable conditions are

made gradually over several weeks. This is extra work and lends itself to possible plant

death, wasting many months of hard work. Therefore using a growth chamber provides

the best chance for keeping the transgenic Cannabis alive.

! #(!

*8*&1+&'41&%5"&K('A10*4&"-5,*3,%#61&*/(10*+"&*4&"-')4*5&%)(+"&#10*$2%)5(*

-'5,*012'3%51*)1-*&""5(*%)0*(,""5(7

! #)!

*8*(#%221&*4&"-5,*3,%#61&D*-,'3,*$1&+"&#(*1L/%229*-122*3"#$%&10*5"*5,%5*"+*

5,1*2%&41&*&1+&'41&%5"&K('A10*3,%#61&D*3%)*%2("*61*/(10*+"&*"$5'#'A')4*5'((/1*

3/25/&1*3")0'5'")(7

*

! $+!

*B2"-*3,%&5*"+*!"##"$%&*5'((/1*3/25/&1*#15,"0*$&"4&1((')4*+&"#*5,1*"&'4')%2*

(51#*"+*5,1*!%))%6'(*$2%)5*5"*+/&5,1&*6&110')47*G%3,*(51$*(,"-)*,1&1*'(*"+51)*

(2'4,529*#"0'+'10*%33"&0')4*5"*5,1*59$1*"+*$2%)5*($13'1(*")1*'(*-"&?')4*-'5,7*

! $*!

5. The GFP Leaf

The simplest Cannabis transformation involves using Agrobacterium that has the green

fluorescent protein (GFP) gene in its T-DNA region. The GFP gene codes for a protein

that fluoresces ~500nm (green) wavelengths of light when exposed to blue light. In

respect to its size and relation to other protein molecules it is a relatively modest protein,

composed of only 238 amino acids. Agrobacterium that contains this gene (and an array

of other genes) can be readily purchased (see Appendix B).

Similar to the cytochrome discussed earlier, GFP contains a chromophore. The

chromophore has electrons that are excited by the blue light. Upon exposure to blue light

the electrons in the chromophore are elevated to a higher energy state. As they lose

excitation they release energy in the form of visible light, which is the cause of the

fluorescence. This brings us back to the concept of electromagnetic radiation, discussed

in the opening chapter. Visible light is a small part of a spectrum of different frequencies

of energy. High-energy waves have a higher frequency and a smaller wavelength. Low

energy waves of the spectrum have less energy and a lower frequency.

Gamma rays and X-rays are on the high-energy end of the spectrum while radio waves

are on the opposite end and have less energy. Visible light is somewhere in the middle of

these two extremes. At just a higher frequency than visible light is ultraviolet light, which

damages cells due to its high-energy nature. The colors on the visible part of the spectrum

can be divided into specific frequencies and have distinct wavelengths. Violet, next to

ultraviolet, is a higher frequency than red, while green is in between these two. An easy

way to remember the order of light and its frequencies is with the pneumonic, ROY G

BIV (red, orange, yellow, green, blue, indigo, and violet).

From knowing the colors and their associated wavelengths, understanding fluorescence is

straightforward. When something fluoresces it emits a lower energy color than the

incident, or incoming, wavelength that first strikes it. For example, shining a blue light on

something with fluorescent properties results in a lower energy wavelength of light being

emitted, such as green. The fluorescence itself arises due to an electron being

momentarily excited to a higher energy state and then falling back to a lower energy

state. The transition of energy states results in a particle of light (a photon) being

released. Humans see this as fluorescence.

The green fluorescent protein gene was first isolated from a jellyfish in the 1990’s. It has

since found many uses in plant biotechnology (Sheen et al., 1995; Davis and Vierstra,

1998). Its main use is to act as a reporter gene. This means that when performing a plant

transformation experiment, the GFP gene can be attached to the T-DNA region of the

plasmid. This then allows for visual confirmation of a successful plant transformation

experiment. Green fluorescent protein has become so important in many experiments that

the discoverers of GFP were awarded the Nobel Prize in Chemistry in 2008 (Cantrill,

2008).

! $"!

Since its discovery the GFP gene has been inserted into many other organisms, including

animals. This has included making glowing fish (Danio sp.), and mice. Many pet stores

now sell GFP fish to put into home aquariums. Perhaps the strangest creation of all has

been the GFP pig.

Induced mutations of the GFP gene make a protein that emits slightly different

wavelengths of light. Available in the biotech market today, there exists a GFP reporter

gene that will result in a protein that fluoresces nearly every color of the rainbow.

Transforming these genes into Cannabis would result in a plant with colorful buds when

under a black light.

The pragmatical reasons for doing a Cannabis-GFP transformation are difficult to argue.

However, science is not just about pragmatism, it’s also about discovery, exploration, and

excitement. When tobacco was first transformed with a firefly gene (that encoded for the

protein luciferase), everyone including the public sector as well as school kids were all

suddenly interested in how plant biotechnology might affect their lives. The same reasons

might be argued for creating a glowing Cannabis plant.

However, in some cases such as the creation of GFP mice was not simply for show. It

has, in fact, led to an important new method of studying brain function. Using different

variants of the GFP gene that emitted different wavelengths (colors) of light has allowed

scientists to study individual cells and differentiate between single neurons. Since brains

are often quasi-organized, but often with indiscernible entanglements, variation in neuron

color helps to distinguish individual neurons. Perhaps making a GFP Cannabis plant with

the same variety of fluorescence could lead to better viewing of the xylem and phloem.

The GPF experiments offer insight into how biotechnology provides advances in

knowledge and discovery. However, cutting a gene out of one organism and putting it

into another organism requires skill, proper knowledge and the proper lab equipment.

First, the experiment must be decided. The sequence of the gene of interest must at least

partially be known, which allows isolation and amplification of the gene. Second, a

potential organism to be transformed must be decided. Usually this is selected from a

choice of model organisms whose genome composition, ability to be transformed, and

growth conditions have been well established. Finally, one must then decide on the

vector, or the way that the gene will be transferred. We have previously discussed the

Agrobacterium plasmid as the vector for Cannabis transformation.

Inserting the gene into the chosen organism can only be done after the gene has been

ligated, or enzymatically linked, to a vector. Perhaps the most well established vector for

transforming plant calluses is the plasmid of Agrobacterium. Therefore, in order to

deliver the gene from Agrobacterium into plant calluses, the plasmid must be ligated to

the gene. Many molecular biology kits to carry this reaction out are commercially

available from a wide range of companies.

After ligation, the plasmid containing the gene can then be inserted into the

Agrobacterium in one of two ways. The plasmid with the ligated gene can be mixed with

! $#!

Agrobacterium cells and placed in a small tube called a cuvette. An electric shock is

given that forces the Agrobacterium to take up the plasmid. This process is known as

electroporation.

*8)*12135&"$"&%5"&D*-,'3,*'(*/(10*5"*#%?1*'0(*$"1-2(%34*5%?1*/$*5,1*$2%(#'07*

<,1*/$$1&*21+5*3"&)1&*(,"-(*5,1*3/=15517*8+51&*$2%3')4*84&"6%351&'/#*%)0*5,1*

$2%(#'0*')5"*5,1*3/=1551D*5,1*3/=1551*'(*')(1&510*')5"*5,1*$"0*%)0*%*(#%22*$/2(1*

"+*12135&'3'59*'(*4'=1)7

Selection for transformed Agrobacterium can then be carried out on antibiotic containing

Petri dishes that only allow Agrobacterium that has a plasmid to grow. This is because

the plasmid will have an antibiotic resistance gene, as previously discussed.

The second way to make Agrobacterium take up the ligated plasmid is called heat shock.

In this method, the Agrobacterium and plasmid are mixed in a small tube. This mixture is

transferred from ice to a warm water bath, then back to ice. The cells are then spread onto

the Petri dish, much like after doing an electroporation reaction.

After growing the Agrobacterium on a Petri dish, some of the cells can be picked off with

a sterile wire and dipped into a broth (liquid) culture, which is a growth media similar to

the Petri dish but without the solidifying agar. This broth is allowed to grow for two days,

or until the Agrobacterium reach a desired cellular density.

! $$!

A few drops of the broth culture cells can be dropped onto plant tissue callus. By their

nature, they will infect the plant callus tissue and insert the genes from the plasmid (the

T-DNA). This is the basis of genetically transforming the plant cells. If so chosen, the

Agrobacterium that was grown in broth can be grown in bulk and small aliquots frozen

for future use. Now that you have been provided the basics on how to make a transgenic

Cannabis plant, it seems necessary to divulge into some of the candidate genes.

! $%!

6. Woody Cannabis

Nearly all plant cells have a rigid, outer protective layer called a cell wall that provides

support and protection for the cellular contents. The cell wall is not a static entity. It has

enzymes imbedded that perform a wide array of biochemical functions. The main

component of plant cell walls is cellulose, a large polysaccharide made up of glucose

monomers.

Almost anyone who has taken a basic biology class knows that a cell is the smallest unit

of life. On a microscopic scale, cells are small factories where thousands of biochemical

process are occurring each second. All plant cells also have a plasma membrane, made up

of lipid-derived molecules. Seeing how the plasma membrane helps keep a cell together

can be understood when looking at oil and vinegar salad dressing. Notice that in this

dressing there are two distinct layers, an oily (water insoluble) phase and a liquid (lipid

insoluble) phase. You have to shake the bottle of dressing to try and bring the two layers

together. But after time, the layers separate again. A cell membrane is similar to the bottle

of oil and vinegar salad dressing in that it keeps the liquid phase, which contains all of the

cell’s machinery, together by making the oily outer layer called the plasma membrane.

The plasma membrane then is like an oil shell, providing a fairly constant internal

environment. Imbedded in this oily shell are proteins with various functions.

In a plant cell, in addition to the plasma membrane, part of keeping the internal parts

from bursting out from the oily shell layer (nucleus, mitochondria, chloroplast, etc.) is

provided by the most exterior layer called the cell wall. Integrity of the cell is maintained

by keeping the cell in tact by the rigid external layer of cellulose, a major component of

the cell wall. The cell wall also keeps the inner plasma membrane and its contents

protected from external environmental onslaught such as salinity changes or pressure

changes. It also protects the cell from popping due to internal pressure from water

accumulation. In fact, the cell wall was a crucial evolutionary step in the transition of

plants from their aquatic ancestors to colonize land.

There are two components to the cell wall, a primary and a secondary cell wall. The

primary wall is established first, early in the cell’s life. As time progresses the cell

matures and the secondary wall is established. This wall is laid down inside of the

primary wall. The secondary cell wall is the portion that often contains higher amounts of

lignin and is at least partly responsible for what is known as wood. Laying down lignin in

the cell wall is called lignification. Both the primary and secondary wall contain cellulose

but differ in concentration of lignin and the types of proteins. Between each plant cell and

on the outside of the cell wall there is a layer of a substance called pectin, which is a

carbohydrate that essentially glues adjacent cells together. Pectin is also the substance

that is used in thickening jellies and jams.

All of this is important because an interesting discovery occurred with researchers who

wanted to understand how lignin, the main component of wood, is produced in large trees

(Kirst et al., 2003). They examined the gene sequences of Arabidopsis, which usually

doesn’t produce wood.

! $&!

Using the tools of bioinformatics, which uses computers to understand sequences in

databases, they first found and identified several genes that played a role in secondary

xylem, or wood production. The researchers then started comparing the sequences of the

tree genes with Arabidopsis genes. To their surprise, they found remarkable similarities.

Although their morphological appearances were strikingly different, both shared the

genes needed for wood production. For some unknown reason, the lignin genes have

been turned off in Arabidopsis.

Since Arabidopsis, the small herbaceous mustard plant, had the genes for wood

production in its genome, other researchers have postulated that if these genes were to be

expressed, wood formation might occur. Indeed, research in this avenue has already

begun with some success (Mitsuda et al., 2007). Although Arabidopsis is usually thought

of as a herbaceous (non-woody) plant, this has been changed through the tools of

biotechnology.

Searching for the gene for wood production in Cannabis could prove to be difficult

considering that there is limited genomic information available. However, it would

indeed be possible to use the Arabidopsis study as a stepping-stone to reach the goal of

producing a woody Cannabis plant. The DNA sequence of a gene for one species is often

similar to the same gene in a different species. This is called gene homology, or as

sometimes referred to-two genes are homologous if they share similar sequences and are

found in different species. The gene for wood production is most likely hidden

somewhere in the Cannabis genome, much like it was hidden in the Arabidopsis genome.

The gene simply needs to be detected and properly expressed.

The construction of the plant cell wall and lignification depends on the activity of

enzymes responsible for synthesis of cellulose, lignin and other polymers. Most people

are familiar with plants, whether they are found in gardens, in homes, front yards, dinner

tables, or in a pipe, people are often directly interacting with plants. Interacting indirectly

with plants is inevitable, since breathing the oxygen they release is fundamental to most

life on earth. However, the great majority of people are less familiar with the plant cell.

Since Cannabis already has the machinery to produce primary and secondary cell walls,

the only necessary genetic changes would be to up-regulate lignin production in the

secondary wall. The challenge is to find and isolate the gene in Cannabis, which is

entirely possible through bioinformatics and understanding gene homology.

Transforming Cannabis with a gene for increased lignin production would be a practical

application of biotechnology. Having a woody plant would allow an outdoor gardener to

have a perennial Cannabis plant. Buying and planting new seeds to sew each year could

be eliminated. Cuttings to propagate a favorite strain would also be easier to obtain and

share among friends.

With the correct genes for both wood production and size, an extreme case of an entire

forest of Cannabis trees is possible. This would have ecological ramifications beyond

! $'!

releasing a genetically modified crop organism into the wild. For instance, imagine a

forest fire where the smoke has enough THC to get every man woman and child in an

adjacent city stoned. Firefighters rushing to the scene may find themselves unable to

focus on extinguishing the fire. Although an extreme scenario, this helps articulate the

fact that regulations of genetically modified organisms are indeed important.

Since hemp is already used as a sustainable crop in some countries, they may want to

consider growing hemp varieties with higher lignin production. These genetically

modified varieties could be useful for more durable goods than that made from traditional

hemp strains. The current hemp varieties are in fact better than trees for making paper

due in part because they have a lower lignin density. The lower lignin concentration

makes hemp an attractive plant because the higher lignin in trees requires more harsh

chemicals used in processing. In fact, it is because of the lignin that hemp is often

preferred over trees. Hemp also has a higher cellulose density than trees, making it great

for increasing product yields.

For these reasons one may argue against making a woody Cannabis plant. However, if

the countries where hemp is currently cultivated could be grown to increase lignin

production the country would surely benefit. A country with much of its land mass given

over to desert or dry area is often able to grow hemp. If these same areas could produce

lignin within their countries, they could rely less on the import of forest products. This in

turn would slow the destruction of forests in other countries. An advantage of higher

lignin content is also given to the plant. Many organisms cannot tolerate eating lignin and

therefore a transgenic hemp plant with higher lignin content may provide herbivore

resistance.

But other benefits abound for humans. A high lignin-producing hemp plant could provide

raw materials for building more durable goods than presently available from

contemporary hemp varieties. The current list of products made from hemp ranges in the

hundreds. Increasing lignin content could expand this list. Based on the current rate of

forest destruction, it may be absolutely necessary to make a transgenic hemp plant that

makes large amounts of lignin.

! $(!

7. Plant Secondary Metabolites and Terpene Production

Knowing the biochemistry that presently occurs in plants is vital to understanding plant

biotechnology. There are hundreds of biochemical pathways that lead to a plant product.

Knowing all of these pathways is unnecessary and can be time consuming (and

impossible) to learn. Therefore, one should primarily concern themselves with the

pathways that lead to important Cannabis compounds (e.g., tetrahydrocannibinol). To

begin this exploration the terpene pathway is introduced. However, it is also important to

know other plant secondary metabolites.

Previously we discussed plant primary metabolites. These consist of proteins (amino

acids), carbohydrates (sugars), fats and lipids, and DNA and RNA (nucleic acids).

Primary metabolites are crucial to plant survival. Without these four basic metabolites, a

plant could not carry out the daily requirements and processes of life.

Secondary metabolites differ from primary metabolites in that they are not always

necessary for plant survival. However, they are often advantageous or provide some

benefit to the plant. There are three major groups of plant secondary metabolites;

phenolics, alkaloids and terpenes. Phenolics are distinct in that they have a carbon ring

structure with a hydroxyl group (-OH derivative) attached. Lignin, a huge polymer of

phenolic rings, is the most common phenolic compound among plants. Other important

phenolic compounds include tannins, vanilla, nutmeg, capsaicin (the spicy hot molecule

in peppers), and anthocyanins (plant pigments).

Alkaloids represent another class of secondary metabolites. Alkaloids are bitter tasting

nitrogenous compounds. A popular alkaloid in the 1980’s was cocaine. Other well-known

alkaloids in include atropine, caffeine, psilocybin, strychnine, quinine, and morphine.

Terpene synthases are the enzymes that synthesize terpenes, the third and final class of

secondary metabolites. Terpene enzymatic pathways have been described in detail

(Pichersky et al., 2006). Terpenes provide a wide array of functions in plants. For

example, the tail portion of the chlorophyll molecule is composed of the terpene called

phytol, which is a diterpene. Citrus smells are possible because of limonene, a

monoterpene. In total there are about 60,000 known phenolics, alkaloids, and terpenes.

Terpenes make up the largest proportion of plant secondary metabolites.

The most important terpene, at least in this book, is geranyl diphoshpate, which is needed

for tetrahydrocannibinol (THC) biosynthesis. The basic enzymatic pathways leading to

molecules of terpenes incorporate carbon molecules based on multiples of fives.

Therefore, a nomenclature system has emerged that follows this pattern.

! $)!

Similarly, a nomenclature system exists for enzymes, the proteins that act as a catalyst to

speed reaction rates. One only needs to add the suffix ‘–ase’ onto a protein’s function to

give it a name. For example, a transferase is an enzyme that transfers one molecule to

another and a decarboxylase is an enzyme that removes a carbon. Most of the steps

leading from one molecule to another involve an enzyme. These enzymes are desirable to

understand because over expression of anyone of these protein’s genes could lead to

higher THC production in Cannabis.

The five carbon units for building terpenes consist of the phoshporylated (has a

phosphate added) starting materials isopentenyl diphosphate (IPP) and dimethylallyl

diphosphate (DMAPP). These can be joined in either “tail to tail” or “head to tail”

reactions. In the case of the atmosphere and its terpene constituents, the low molecular

weight terpenes have been shown to play are larger role, and hence have been more

widely studied in global climate.

Additionally, it has been observed that plants can produce terpenes (anabolism) and then

consume them by breaking them down (catabolism). Often, large terpene compounds can

be metabolically broken down and released in smaller (reduced molecular weight) forms.

The reactions of terpene biosynthesis are an important part of Cannabis biochemistry.

*

Terpene name Formula Molecular weight Isoprene units Example

Hemiterpene C5H16 76.2 0.5 2-methylbutane

(isoprene)

Monoterpene C10H16 136.2 1.0 pinene

Sesquiterpene C15H24 204.4 1.5 farnesol

Diterpene C20H32 272.5 2.0 phytol

Sesterterpene C25H40 340.6 2.5 leucosceptrine

Triterpene C30H48 408.7 3.0 squalene, THC

Tetraterpene C40H64 544.9 4.0 carotenoids

Polyterpene C!H! 100,000-1,000,000 1,500-15,000 natural rubber

! %+!

*J,"-)*%6"=1*'(*%*(')421*'("$&1)1*molecule (C5H16) is the primary constituent of

all terpenes.

!

!

There are two pathways, which lead to production of terpenes. The mevalonate (MVA)

pathway for terpene production in higher plants occurs in the cell cytoplasm and leads to

sesquiterpenes and triterpenes. The second pathway is called the 1-deoxy-D-xylulose

(DXP or non-MVA) pathway and occurs in the plastid. This pathway can lead to

monoterpenes and diterpenes.

I2%)5*3122*(,"-')4*1%3,*51&$1)1*$%5,-%97*E1&%)92*0'$,"($,%51*'(*/(10*')*<Z!*

(9)5,1('(7

! %*!

To begin the MVA pathway, thiolase catalyzes the synthesis of acetylacetyl-CoA by

fusing two acetyl-CoA molecules. HMG-CoA synthase synthesizes acetylacetyl-CoA

with a third acetyl-CoA to produce 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA). A

final reaction catalyzed by HMG-CoA reductase uses 2 NADPH to reduce HMG-CoA to

the six-carbon molecule mevalonate (MVA).

The high-energy molecule, adenosine triphosphate (ATP) is required for the next three

reactions, which ultimately lead to isopentenyl diphosphate. These reactions involve

MVA kinase, MVAP kinase, and MVAPP decarboxylase, and proceed with MVA,

mevalonic acid 5-phosphate (MVAP), mevalonic acid 5-diphosphate (MVAPP), and

isopentenyl diphosphate (IPP), respectively.

The plastidial pathway is initiated with the joining a pyruvate molecule to a

glyceraldehyde 3-phosphate molecule facilitated by the enzyme DOXP synthase. This

forms 1-deoxy-D-xylulose-5-phosphate (DOXP). This is reduced by the enzyme DOXP

reductoisomerase (DOXP-R) to form 2-C-methyl-D-erythritol 4-phosphate (MEP). A

cytidine triphosphate then incorporated to form 4-(cytidine-5-diphoshpo)-2-C-methyl-D-

erythritol (CDP-ME) via the enzyme CDP-ME synthase.

An ATP is used to add a phosphate to form 4-diphosphocytidyl-2C-methyl-D-erythritol

2-phosphate (CDP-ME-2P). The enzyme that catalyzes this reaction is CDP-ME kinase.

This product is then cyclized to form 2-C-methyl-D-erythritol 2,4-cyclodiphosphate

(CDP-ME diphosphate) via CDP-ME diphosphate synthase. After removing a water

molecule, (E)-4-hydroxy-3-mehtylbut-2-enyl diphosphate (HMBPP) is formed via

HMBPP synthase. The final step removes an additional water molecule while

simultaneously reducing (E)-4-hydroxy-3-mehtylbut-2-enyl diphosphate to yield

isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP).

! %"!

[/52')1*"+*5,1*395"("2'3*51&$1)1*$%5,-%9*%)0*5,1*$2%(5'0'%2*51&$1)1*$%5,-%97*

\"51*5,1*3&"((*5%2?*615-11)*1%3,*$%5,-%97*E1&%)92*0'$,"($,%51*'(*$1&,%$(*5,1*

#"(5*&121=%)5*#"213/21*5"*<Z!*6'"(9)5,1('(7

Since they are phosphorylated, the IPP and DAMPP can be used in the so-called “head to

head” or “tail to tail” combinations to build terpenes. DAMPP can also be produced from

IPP by the enzyme isopentenyl-diphosphate isomerase (IPP isomerase). Dimetheylallyl

transferase uses either IPP or DMAPP to form geranyl diphosphate or farnesyl

dihposphate via polyisoprene synthase. Geranyl diphosphate and farnesyl diphosphate are

monoterpenes and sesquiterpenes, respectively. It is geranyl diphosphate, which lends

! %#!

itself to THC synthesis. Finally, it is important to note that there can be exchange of

products between the cytosolic and plastidial pathways.

Many biochemical reactions taking place within plant cells are not carried out in such

sequential steps. Although biochemical pathways occur when precursor molecules initiate

the pathway, things can only proceed as fast as products are made. This is because

enzymes are often suspended within an intracellular matrix (the cytoplasm) or attached to

a cellular membrane, so that reactants must somehow join with the correct enzyme.

A complex interaction between enzymes and their substrate concentration is played out

where an enzyme may only be produced on demand. It follows from this that increasing

the concentration of the substrates can cause an increase the concentration of the

products. All of this has led to something called a rate-limiting step. This says that the

rate of any reaction depends on the previous reaction. When thinking about THC

production, it relies on previous steps within the THC biosynthetic process. The HMG-

CoA reductase enzyme is often considered a rate-limiting step.

The enzymatic reactions taking place within the plant cell all occur very rapidly and

depend heavily on the temperature and concentration of reactants and enzymes. The

terpene pathway is one of many plant biosynthetic pathways. Therefore it is not too

surprising that the terpene pathway also overlaps with other plant pathways, including

plant hormone synthesis. For example, gibberellins and auxins are both formed starting

with a molecule of mevalonate derived from the MVA pathway.

Since THC is the most active component of marijuana smoke, the importance of its

molecular synthesis cannot be overstated. Like the terpene pathway, the THC pathway

consists of different enzymatic steps and has intermediate molecules, for example it is

synthesized via a terpene. Each of these enzymes plays a crucial role in the overall

formation of plant secondary metabolites.

Becoming familiar with both the terpene pathway and the THC pathway allows one to

understand not only key enzymes, but also the genes that encode those enzymes. This is

crucial to relating the ways in which Cannabis can be genetically transformed. For

example, in order to increase the concentration of the psychoactive component of

Cannabis, an increase in IPP or DMAPP is needed. These molecules are produced in the

terpene pathway. The gene coding for the protein that synthesizes IPP or DMAPP needs

to be over expressed in Cannabis. Choosing any gene that codes for any enzyme within

the terpene pathway might produce a similar increase, but needs to be experimentally

verified. The important component to remember from these complex pathways of THC

synthesis is that transferring any of these genes is possible with today’s biotechnology

tools. Before detail on these tools and techniques are provided, a review of the THC

pathway is necessary.

! %$!

8. The THC Pathway

The terpene pathway is important to understand both because it serves as a model for the

other biosynthesis reactions, such as the THC pathway, and because the terpene geranyl

diphosphate is needed in THC biosynthesis. Similar reactions, albeit at different rates and

locations, occur within plant cells that result in production of THC. The chemical

structure of THC was first determined in the 1930’s (Pertwee, 2006). Knowing the

complete pathway to its production is considered an important piece of Cannabis

biotechnology.

*

*

!

J,"-)*,1&1*'(*5,1*#"213/2%&*(5&/35/&1*"+*<Z!8*%)0*<Z!*-'5,*%&&"-(*$"')5')4*

5"*5,1*=%&'%5'")*')*5,1*('01*4&"/$7*<Z!8*'(*5,1*3"#$")1)5*')*!"##"$%&*$2%)5(*

%)0*'5*'(*)"5*/)5'2*'5*'(*6/&)10*5,%5*<Z!*'(*+"&#107*

!

Interestingly, it is not until THCA is burned that it becomes chemically modified into a

more psychoactive form, which is THC (Hazekamp et al., 2005). The burning causes a

decarboxylation reaction, or a loss of a carbon group that is on the THCA molecule,

thereby converting it to the more psychoactive THC molecule.

However, the THCA component of Cannabis is the precursor of THC, so its formation

and accumulation within the plant influences the amount of THC when the plant is

smoked. Again, part of the THCA molecule is derived from the terpene geranyl

! %%!

diphosphate. Synthesis of THCA begins when a molecule of geranyl diphosphate (a

monoterpene) is joined to a phenolic ring (a circular molecule with six-carbons). This is

why THC is sometimes referred to as a terpenophenolic. Because it has a few extra

molecular attachments, the phenolic ring is called olivetolic acid and it is through the

enzyme geranylpyrophosphate:olivetolate geranyltransferase that forms cannabigerolic

acid, or CBGA. The final product after CBGA formation is THCA by way of

tetrahydrocannabinolic acid (TCHA) synthase. Subsequently, high levels TCHA are

found in Cannabis trichome cavity (Sirikantaramas et al., 2005).

*

8*2""?*')('01*5,1*!"##"$%&*3122D*(,"-')4*41&%)92*0'$,"($,%51*%)0*"2'=15"2'3*

%3'0*3"#6')')4*5"*9'120*<Z!87

The pathway leading to olivetolic acid is most likely synthesized from three molecules of

hexanoyl-CoA. However, work remains to be done to in order to understand the synthesis

of THCA in its fullest extent. Details on each enzymatic reaction, their substrates and

their products have been recently provided (Taura et al., 2007).

With all this biochemistry comes the curiosity of why Cannabis has evolved to produce

THC-like molecules. It has been hypothesized that the molecules can act as a sunscreen

for the plant (Lydon et al., 1987). In fact, research has shown that THC can absorb UV

light, thus the plants are protected from harmful radiation. Additionally, THC precursors

have believed to have antimicrobial activities, therefore these cannabinoids may also play

a role in plant defense.

Since the part of the biochemical pathway of THC has been elucidated, picking some of

the genes from the pathway for transgenic manipulation is possible. For example, if

! %&!

THCA synthase is attached to the CAMV35S promoter it will be highly over expressed.

This would produce transgenic lines of Cannabis that are loaded with THCA.

Putting these genes into other plants may serve useful to people in countries where

Cannabis cultivation is illegal. One species of plant that might be desirable to genetically

modify with THC genes is the weed species, Amaranthus retroflexus. This plant is in the

family Amaranthaceae, also known as the pigweed family. The common name for this

plant is redroot pigweed and is consumed as a food in some parts of the world (Kong et

al., 2009).

One reason for its candidacy for genetic modification stems from the fact that it is a

weed; it grows along railroad tracks, in ditches, and even between cracks in the middle of

parking lots. Therefore, very little labor would be required from the cultivator to maintain

healthy pigweed plants.

A second reason for its candidacy is that the flowers of pigweed are large and bulky. This

would provide the obvious advantage of producing large quantities of finished product.

Additionally, it needs little water, grows rapidly, produces lots of seed, and tolerates poor

soil and harsh growing conditions. In many respects it behaves like Cannabis, but is

legal. Growing a few plants of pigweed would not send the police to your house. For

instance, growing pigweed next to your tomato plants in your garden would not seem that

strange. Neighbors would not give the situation a second thought.

,

! %'!

'4"("#-.3&,(2-(*5/263&D*%*3%)0'0%51*+"&*41)15'3*#"0'+'3%5'")*-'5,*5,1*<Z!8*

(9)5,%(1*41)17*<,1*5"$*21+5*3"&)1&*(,"-(*%)*/$K32"(1*='1-*"+*5,1*2%&41*+2"-1&*

32/(51&(*"+*5,'(*$2%)57

! %(!

The prospect of growing a legal THC-containing plant might also seem alluring to

medical marijuana users. Within the US, medical marijuana is currently legal in only a

handful of states. While other countries have legalized or promoted the use of medical

Cannabis, the US Food and Drug Administration (FDA) has historically declared

marijuana to have only limited medical potential. This is contrary to continuing scientific

findings and the fact remains many patients currently use medicinal marijuana with or

without a doctor's recommendation.

The inflorescence (flower) of pigweed can be much larger and bulkier than marijuana,

which would allow for production of large amounts of medication for medical marijuana

patients. The biotechnology for producing transformed, THC-containing plants might be

an effective way to bypass legal issues and still allow sufferers of chronic illnesses to

self-medicate. Since Amaranthus is known to harbor terpenoid biosynthetic pathways,

inserting the THCA synthase gene should result in THC production.

Transforming a plant with one gene is relatively straightforward. Inserting multiple

genes, called gene stacking, has proven to be more difficult. In the past researchers had to

do laborious transformations starting with one gene, then grow the plant into an adult,

and breed it for multiple generations. Only then could they use this stem tissue for

creating calluses and insert a second gene. Success was far and few between. Fortunately,

many new vector systems, mainly in the form of plasmids, have shown to be more

versatile in their capacity to deliver multiple genes simultaneously (Dafny-Yelin and

Tzfira, 2007). The emergence of artificial plant chromosomes has allowed putting several

genes together and inserting them into a vector. With time, the complete THC pathway

will undoubtedly be inserted into other plant species.

! %)!

9. Smoking Roses and Other Proposals

There are limitless ways in which Cannabis and biotechnology will influence one

another. Having a basic knowledge of science and biology is imperative, but having an

imagination might prove equally as important. However, thinking of concepts and

applying logical ideas to them begins with a solid science education. This allows one to

gather reasonable arguments as to possibilities of Cannabis transformation that may arise

in the near future.

Work has already begun with yeast cells (Taura et al., 2007). These small fungi were

genetically modified to express the THCA synthase gene. Workers from the same lab

were also responsible for transforming tobacco, albeit under special conditions

(Sirikantaramas et al., 2004). For example, the THCA synthase enzyme had to be

provided with the THCA precursor molecule (cannabigerolic acid). The tobacco cells

were also grown in vitro. Nevertheless, the gene for THCA synthesis has been shown to

have the ability to successfully transfer and expressed in organisms other than Cannabis.

Some of the fastest advances in improving Cannabis and other plants have been through

application of chemicals or hormones. For example, inducing chromosomal duplications

in plants has been occurring since the discovery of colchicine. This chemical interferes

with the proteins that pull chromosomes apart during cell division. Applying colchicine

has been shown to cause complete genome duplications. Sometimes this leads to

doubling of all gene products and not just the genes. It follows, then, that a Cannabis

plant treated with colchicine might result in production of twice as much THC than an

untreated plant.

Although colchicine is commercially available, performing more drastic genetic

experiments are not so easily available. These require special aseptic conditions and

access to the necessary technology. Once these obstacles are overcome, transforming

Cannabis with any gene is simply a game of experimentation.

It is indeed possible to control genes and cause them to be upregulated in order to

increase their gene product. To do this, the known gene has to be attached, or ligated, to a

special region that communicates this to the Cannabis cell. This region is called a

promoter region, since it promotes the expression of that gene. The promoter region sits

just ahead of the gene along the chromosome.

Some promoter regions have been found to have such strong expression activity, that they

are routinely used in plant biotechnology. One such promoter is called the CaMV 35S

promoter (Venter, 2007). This promoter was first found in a virus, then carefully

removed, and finally ligated to a plant gene. When researchers did this they found that

whatever gene was attached resulted in a constant expression of that gene. The CaMV

35S promoter has since proven to be a useful promoter to make transgenic plants that

express large amounts of a foreign gene.

Since there is overlap of the THC and terpene biosynthetic pathways, adding an

! &+!

additional two or three terpene genes to Cannabis will likely result in that terpene

product. For example, many fruit scents and flavors are terpenes. Most anyone is familiar

with the citrus smell of an orange, grapefruit or lemon. This smell is the result of a

terpene known as limonene.

The biosynthesis of limonene is so well understood that there are multiple transgenic

plants that have been made expressing limonene. Putting the limonene gene into

Cannabis would give the buds a citrus-like smell. While some may find this aesthetically

appealing, others might simply enjoy something different. From a practical standpoint,

the paranoia of indoor growers might decrease upon learning that the smell their

neighbors are complaining about is lemons rather than from marijuana cultivation.

Since the precursor molecules needed early in the pathway of THC are known, increasing

these initial pathway substrates might result in more THC production. IPP and DMAPP

are the starting materials for terpenes. Upregulating the genes (isopentenyl diphosphate

synthase and dimethylallyl diphosphate synthase) would provide this possibility. These

gene sequences are known in other plants, therefore a model for isolation and

amplification of the Cannabis IPP and DMAPP synthase genes is available.

Another interesting experiment focuses around Cannabis flowers. Many roses are

currently sold as so called, double roses. This is because they have two whorls of petals,

not just one, as in typical roses. This was brought about not by genetic modification, but

through discovery of a mutant double flowered rose. The mutant was subsequently bred

with other roses to distribute the mutation through the offspring. Selection for double

roses and crossing between double roses produced only double roses, so much in fact,

that there are complete genetic lines of double flowered roses.

One of the most prominent desires from Cannabis growers is to increase yield. Many

cultivators would rather grow one plant that yields 2 kilos than to grow five or six plants

that produced this same amount. Luckily for Cannabis growers, a single gene controls

flower size, at least in some plant species. Upregulating this gene then, would be of huge

importance to the Cannabis community.

A different approach to making larger flowers in Cannabis would be to express the gene

for petals. The transcription factors of the ABC flowering model could be exploited to

facilitate this goal. Although Cannabis lacks petals, manipulation of the ABC

transcription factors could overcome this barrier.

Conversely, ignoring the petals and focusing on the sepals could produce a similar

outcome. Luckily enough, the A transcription factor controls both sepal and petal

production. Therefore, up-regulating the A transcription factor would likely result in buds

with enlarged petals and sepals. Ultimately, different experiments would be required to

find the best combination of which genes to up-regulate. In addition to larger buds,

producing many more buds seems just as important.

! &*!

Perhaps the goal should not be to make larger flowers or have more of them. Considering

how plants make their food might equally result in an increase in growth of its buds or at

least the time needed. For example, if the genes for photosynthesis are upregulated,

conferring hyper-photosynthetic ability, may shorten the time needed to grow Cannabis

in the vegetative stage. Cannabis producers could have the vegetative state of Cannabis

finish in two months instead of four months.

The possibility also exists that one can manipulate the genetic expression of trichomes.

The gene for trichome production has been found and described in detail. With trial and

error, a Cannabis plant with twice as many trichomes might result in twice as much THC.

Alternatively, the entire Cannabis plant can be discarded. Inserting THC-synthesizing

genes into any plant that can be cultured in vitro is a possibility. Roses with THC-

producing flowers may soon be available to everyday gardeners. The benefits would be

obvious. Since roses are perennials, their flowers can be harvested every year, sometimes

more than one time a year. Roses also have the unique characteristic of being able to

bloom multiple times in a season, which would provide a continuous supply of TCH-

containing flowers.

Before Cannabis consumers celebrate these transgenic advances with too much

excitement, there remains a caveat. If marijuana seed companies choose, they might use a

method similar to that which the agricultural biotech seed companies have chosen. For

example, in some transgenic food crops a suicide gene is inserted into the seed so the

person harvesting the crop will be unable to use seed from that crop for planting the

following year. The suicide gene essentially renders the seed infertile. This was the

method that the large agricultural giant Monsanto used in their “terminator” technology.

If a seed company has invested many months or years developing a plant, they may deem

it necessary to protect its secrets and stay in business. For now at least, marijuana seed

companies appear to be following a different philosophy than that of today’s corporate

agricultural giants.

! &"!

10. Cannabis DNA Sequencing

All life uses deoxyribonucleic acid (DNA) to transmit information to its offspring. In

eukaryotes (e.g., Cannabis and humans) DNA is contained in a nucleus, while

prokaryotes (e.g., Agrobacterium and other bacteria) lack a nucleus. Bacterial DNA floats

within a localized region, often called the nuclear region. The DNA represents the

organism’s genetic material. The scale of view transforms along a finer gradient from

chromosomes (or plasmids) to DNA to gene and finally to nucleotide bases.

Understanding how the order of nucleotide bases (adenine, thymine, guanine and

cytosine) contributes to an organism is fundamental to understanding an organism.

DNA sequencing began with scientists counting one base at a time. The bases were

translated as patterns or marks on paper and identifying a base was done manually. The

process was long and difficult, partly because it required the use of small amounts of

radioactive materials.

The development of automated sequencing resulted in a rapid increase in the number of

base pairs that could be read. Additionally, the accuracy and reliability increased.

However, the DNA had to be moved through large slabs of a gel. The process was less

labor intensive than counting manually and by hand as they did in the beginning of

sequencing projects but still consisted of hours of careful work.

Recently there has been rapid progress in DNA sequencing technologies. This has

claimed the name, next generation sequencing and represents most of the tools currently

used in sequencing labs. However, the technology continues to evolve, becoming

cheaper, faster, less labor intensive and more reliable. Researchers are now trying to get

the enzyme that polymerizes (extends or makes more of) DNA to do sequencing for

them. In this way, sequencing a DNA strand can be accomplished in real time through the

work of an enzyme. Because enzymes are so fast in their reactions, using DNA

polymerase would throttle sequencing speeds to an unprecedented rate.

Currently, there is a mad race to learn the sequence of as many organisms as possible.

Although this started with sequencing a bacterial virus, the trend quickly spread to

include the human and model organisms (e.g., Arabidopsis, mouse, and yeast). Knowing

an organism’s genetic sequence provides a blueprint for manipulating and experimenting

in order to discover biological secrets.

Since there is so much DNA sequencing data being discovered, there has evolved large

databases to in which to deposit this digital data. The European Molecular Biology

Laboratory (EMBL) is centralized in Heidelberg, Germany but also has other extensions

across Europe. The portion of EMBL involved in DNA sequencing is often referred to as

EMBL Nucleotide Sequence Database or, more succinctly, EMBL-Bank. It is important

to understand that there is a physical laboratory and then there is also a digital storage

component. This is the same situation for another large laboratory in Japan called the

DNA Database of Japan (DDBJ).

! &#!

The final database is called GenBank (in Bethesda, Maryland), which is part of the

National Center for Biotechnology Information (NCBI). EMBL-Bank, DDBJ and

GenBank are the three large constituents that comprise an international consortium of

bioinformatics data (essentially digital data). Each database is linked to one another and

they exchange information daily. For instance, although the scientists who sequenced

THCA synthase were from Japan and deposited their gene sequence data in DDBJ,

people in Europe and North America also have access to this sequence. In fact, anyone

with an Internet connection has free access to any sequence data deposited in any of these

three databases.

*

<,1*@\8*(1L/1)31*"+*<Z!8*(9)5,%(1D*5,1*$&"51')*&1($")('621*+"&*<Z!8*

(9)5,1('(7*<,1*(1L/1)31*"+*)/321"5'01(*'(*5&%)(2%510*')5"*%)*%#')"*%3'0*

(1L/1)31D*-,'3,*3")(5'5/51(*5,1*<Z!8*1)A9#17

! &$!

J3&11)(,"5* "+* 5,1*\!FW*-16* ('517* J1%&3,1(* 3%)* 61* $1&+"&#10*#%)9*0'++1&1)5*

-%9(*')32/0')4*?19*-"&0(D*)/321'3*%3'0*(1L/1)31(D*"&*$&"51')(*(1L/1)31(7

There are thousands of different proteins, all encoded by different sequences of

nucleotides (e.g., adenine, guanine, cytosine, and thymine). Imagine finding a DNA

sequence that coded for an enzyme that gobbled up hazardous waste, rapidly removed

carbon from the atmosphere and could combat global climate change, synthesized a life-

saving drug, or that could break down garbage in city dumps or pollutants in streams.

These examples highlight just a few of the reasons why knowing as many sequences as

possible is beneficial. Knowing the sequence of an organism allows researchers and

bioinformaticists to tease out these important protein biomachines. There are many

methods of DNA sequencing, with so-called next generation sequence methods gaining

popularity because of its affordability and increase in data output.

Before a complete Cannabis genome sequence is provided to the public, a more

affordable and abbreviated sequence may arrive first. This technique is called a cDNA

library, much like a library where people borrow books. When a plant makes a protein it

! &%!

must obey the central dogma of biology and the central dogma is fundamental to any

biology student. The central dogma is logical in its flow and can be easily understood

upon closer inspection.

The central dogma of biology states that a gene is the sequence of nucleotide bases that

resides on a chromosome within the nucleus. A gene has the ability to be turned on or off.

When a gene is turned on, it produces a transcript called messenger RNA, or mRNA.

This mRNA is moved from the nucleus to the cell cytoplasm where it is translated by

ribosomes. Ribosomes clasp the mRNA, which then allow binding of amino acid-

carrying molecules called transfer RNA, or tRNA. This is an extremely macroscopic

view, as the actual events are based on subatomic interactions that happen in a fraction of

a second.

The amino acids that arrive on the tRNA are attached in an order that compliments the

sequence of the mRNA strand. Each amino acid brought to the mRNA has a unique side

chain that interacts with its environment. The interaction with all of these different side

chains (one for each of the 20 amino acids) elicits different properties that make it unique

to the function of the protein to which they are incorporated. Since every DNA sequence

is slightly different, organisms can produce a huge variety of amino acid sequences that

fold into many different enzymes.

Regardless, the entire central dogma starts with a gene, which is then changed into

mRNA, and ends with a gene product (a protein). One important tool used in sequencing

today is the cDNA library. This is the representation of all or most of the expressed genes

in a tissue at any given time. To make a cDNA library the mRNA is first isolated from a

tissue or organ. Using enzymes within a small reaction tube, this mRNA strand is reverse

transcribed back into DNA. The molecule remaining is complimentary DNA, or cDNA.

Thus, a collection of cDNA sequences is called a cDNA library. These can be sequenced

and compared to known sequences in the large public databases such as GenBank.

! &&!

*8)*"=1&29*('#$2'+'10*01$'35'")*"+*,"-*5"*(1L/1)31*1C$&1((10*41)1(*+&"#*

!"##"$%&7*3@\8*2'6&%&9*3")(5&/35'")*'(*&"/5')129*0")1*+"&*#%)9*"&4%)'(#(*%)0*

"+51)*+"/)0*')*0%5%6%(1(*%(*1C$&1((10*(1L/1)31*5%4(*:GJ<(;7

Obviously, there will be many different genes being produced in any cell at any time. For

instance, flowers will have different cDNA sequences then sequences from a root cell.

Different biotechnology companies provide complete cDNA construction kits, and all

cost relatively modest amounts. However, one can also choose to send isolated Cannabis

RNA to a company that will construct and sequence a cDNA library for an extra charge.

However, some Cannabis cDNA sequences do exist. As mentioned, the public database

GenBank is a repository full of digital information and can be freely searched. Currently,

the majority of sequences available in this database are from a hemp plant, what most

Cannabis cultivators would not find very interesting. However, it can be used to study

other aspects of Cannabis. There are also a handful of Cannabis sequences from other

researchers as well. Since this information is publically available, anyone with an Internet

connection has access. With such huge amounts of genetic data and so few researchers

mining the information, potential discoveries are waiting to be found this very moment.

! &'!

11. Molecular Tools

There are a plethora of molecular tools being used in molecular biology today. Covering

them all would be far beyond the scope of this book. However a few important and

common methods are covered. Reading this chapter will certainly help in understanding

greater detail on how transgenic plants are made.

Perhaps the tool that any individual wanting to learn plant biotechnology must become

familiar with is the polymerase chain reaction (PCR) This process was developed in the

1970’s and has been a crucial advancement to the development in all areas of molecular

biology and biotechnology. Starting with a DNA sample, any sequence from that sample

can be amplified in sufficient quantities to perform further experiments. The entire

process takes only a few hours.

It is important to make many copies of a DNA segment (a gene) because the gene of

interest must be amplified in large numbers before any other experiment can proceed.

Since there are many different genes along a DNA strand, the first step is identifying at

least a portion of the gene sequence that one is interested in isolating.

For example, isolating the THCA synthase gene requires starting with a sample of DNA

that contains the specific DNA sequence that codes for the THCA synthase protein. This

particular sequence on the DNA would be found in virtually any Cannabis plant. The

total genomic DNA (DNA isolated from the nucleus) is placed in a small test tube. In

addition, single stranded DNA fragments are added called primers that are 20 bases long.

The primers are added in very high concentrations because they get used up each time the

gene is amplified. Because the primers have the exact opposite sequence of the gene of

interest they bind and are able to anneal (or bind to) to the DNA molecule. Ideally, the

primers flank the sides of the gene.

Primer 1- tacttaacgagtcgtaaaag

Primer 2- cacttttggtttcgactaggc

In the test tube there is also an enzyme called DNA polymerase. This was discussed

previously when discussing how plasmids replicate at the ori region. As is the case with

both making more plasmid or more of a gene, DNA polymerase can only bind to double

stranded DNA. Therefore, when the primers bind to their complementary sites along the

DNA sample, DNA polymerase is then allowed to attach and begin to polymerize a new

fragment of DNA. Momentarily, however, in order to allow the DNA polymerase to

make more of the gene of interest, such as the THCA synthase gene, the double helix of

DNA must first become a single helix to allow primers to bind.

The details of this mechanism rely on manipulation of temperatures. To separate out the

DNA double helix in the sample, the sample tube is heated to 94°C/201°F. The high

! &(!

temperature melts the two genomic DNA strands apart from one another. A sudden drop

in temperature to ~55°C/131°F allows the smaller primers to find and anneal to the single

stranded genomic DNA. Once the primers are in place, the temperature rises to

72°C/162°F and the DNA polymerase is activated and polymerizes a new strand of DNA,

in our example, the sequence for THCA synthase. Since the primer is at a much higher

concentration than genomic DNA, repeating the series of temperature cycles allows DNA

polymerase to amplify a specific fragment of genomic DNA.

Often the PCR is carried out in a small machine that is automated to change temperatures

very quickly. The changes in temperature that allow for separating the double helix

strands, allowing primers to bind and activating DNA polymerase, can continue for many

cycles. The more cycles of this pattern of temperatures will allow for more gene product

to be amplified. Even if a homologous sequence is known, primers can be made based on

that sequence and a researcher can at least try to amplify a desired gene.

This amplified gene product, or PCR product, can then be slightly modified and

successfully transferred and ligated into a suitable vector such as a plasmid. This is

because the PCR product is a perfect double stranded piece of DNA with a single base

overhang on each end. This makes the ends “sticky”, which means they are able to fit

attach to another, complimentary end of DNA. For this reason, some plasmids are

designed to have a single base overhang that compliments the PCR product. Putting the

plasmid into a small tube with the PCR product provides the chance for these two pieces

of DNA to stick together. The enzyme DNA ligase seals the bond between the overhangs

that have hopefully found one another.

The ligated plasmid can then be successfully put into Agrobacterium. This can be done

via electroporation or heat shock. Once Agrobacterium takes up the plasmid, successful

genetic transformation of plant calluses can occur.

Often, when the PCR method is finished, the DNA polymerase, ions, and bits of small

nucleotides (like excess primers) must be removed before the PCR product can be used.

This requires using a small block of gel that rests within a box. The PCR reaction is put

into a small hole, or well, of the gel. The box is able to harbor a current of electricity so

the DNA molecules separate. Since DNA contains lots of negatively charged phosphates,

it migrates toward the positively charged end of the box. This procedure is aptly called

gel electrophoresis.

! &)!

*8*412*12135&"$,"&1('(*%$$%&%5/(*/(10*+"&*(1$%&%5')4*@\8*6%)0(*"+*=%&'"/(*

('A1(7*@\8*#"=1(*5"-%&0(*5,1*$"('5'=1*:&10;*1)0*%)0*%-%9*+&"#*5,1*)14%5'=1*

:62%3?;*1)07

The image taken from a gel electrophoresis is often shown on popular TV programs.

Usually this follows a crime scene investigation. There are apparent bands, which mean

nothing to the actors, and the viewers are supposed to infer some meaning. Television

grossly exaggerates reality and fails to explain anything with any clarity. In the real

world, understanding what the bands mean and how they became apparent is in fact

necessary.

Importantly, the rate that the PCR product moves through the gel depends on its length. A

longer piece of DNA will not be able to travel very fast through the gel, and so remains

closer to the end of the box where it was inserted into the gel well. Smaller fragments of

DNA travel faster through the gel and so a band farther down from the well implies the

fragment is smaller in length. The size of each band infers something about the size of the

DNA molecule, which represents the actual band. To make the bands become visible a

special dye is added to the gel and a light is applied, similar to eliciting the green

fluorescence from GFP. The difference is that the bands glow and a picture can be taken

and later analyzed.

If desirable, the band of DNA can be cut from the gel using a sharp blade. The small

piece of gel is placed in a tube and a series of clean up reactions is performed to remove

! '+!

the gel but leave the DNA behind. This DNA can be used in further biotechnological

applications or assays.

The US Drug Enforcement Agency (DEA) employs scientists who use specific primers

that bind to particular regions of Cannabis DNA. They often use many different

sequences of primers, which yields many different banding patterns. Since the Cannabis

has genetic varieties across the nation and globe, not all primers will bind to the same

regions of Cannabis DNA and, thus, patterns of bands will naturally be observed. This is

what is referred to as the genetic fingerprint. The genetic fingerprint can be helpful in

tracking where marijuana supplies are flowing from and, with enough samples, even

specific routes of transport can be elucidated.

Determining if a gene has been successfully transferred and is being expressed in a

Cannabis plant requires extraction of the RNA. The gene in the plant should be present

and if expressed, it will be in the form of mRNA. If the expression of the gene is

detected, then one can rightfully confirm successful transformation. As most molecular

biologists know, working with RNA can often be tricky due to ubiquitous degradating

enzymes. However, techniques can be employed to ensure proper experimental control.

In any case, if one is careful enough, a procedure called a northern blot can be carried out

for confirming that a transformation experiment was successful. Once the Cannabis

mRNA is extracted it can be separated on a gel and then transferred to a nylon

membrane. Similarly, it can be directly spotted onto a nylon membrane. A single stranded

DNA probe that has the capability of fluorescence or radiating a mark onto a special film

is applied to the nylon membrane. If the single stranded DNA probe finds an opposite

sequence of mRNA on the nylon membrane, it will successfully bind. The nylon

membrane is washed in special reagents. When placed under light a signal of

fluorescence will be detected if the mRNA was originally present.

Methods and machines also exist to quantify the amount of mRNA at any given time. In a

process called quantitative real time PCR (QRT-PCR), an RNA sample is amplified,

similar to regular PCR. However, the PCR machine used is connected to a detector that

can monitor the accumulation of the PCR product. This results in the ability to work in

reverse and determine the original quantity or RNA that was present. Again, if the RNA

is not present, the primers will not be able to bind and amplify anything, so nothing will

be detected by the QRT-PCR machine.

Another method similar to the northern blot is called a southern blot. It uses similar

principles but is used with DNA instead of RNA. Western blots are also used in

molecular biology. These use neither RNA nor DNA and instead are used in studying and

detecting proteins.

Many techniques also exist to take a gene back out of a plasmid. This might be desirable

if a person was to put their plasmid into a bacterial cell, then grow the bacterial cell in

bulk. After spinning the bacteria and removing the media, a basic plasmid extraction can

be performed. This leaves the researcher with a pellet of plasmid DNA that contains a

! '*!

gene of interest. The sites flanking the insert is known, so unique enzymes that will snip

the insert out of the plasmid can be used. The resulting reaction can be separated on a gel

as described earlier. The bands can be cut and cleaned for future use.

Some techniques rely on previously determined sequence data. If a cDNA library is made

from Cannabis, then short sequences of ~50bp from these sequences can be attached to a

glass slide in a matrix-like array, properly called a microarray. A person can then isolate

mRNA from any Cannabis plant and place that mRNA sample onto the microarray.

Often, the plant sample obtained has recently been under salt stress, drought stress, or any

biotic or abiotic influence. The mRNA is then added onto the microarray. The glass slide

containing the ~50bp fragments may contain hybridized mRNA sequences and this can

be confirmed by using a microarray scanner. Fluorescence is observed where there are

hybridization points. This method can provide an entire genomic expression profile for a

plant. From this, metabolic pathways, developmental regulation, and environmental

response genes can be studied for expression patterns and levels.

One of the newest fields of molecular biology is using RNA molecules to bind to and

inhibit mRNA sequences from making their way to the ribosome. For this reason the

technique has been dubbed RNA interference (RNAi). Research has since shown that the

joining of a 20-25 base pair long RNA molecule to a complimentary mRNA strand,

initiates a degradation pathway, destroying the mRNA. In other words, the mRNA leaves

the transcribed gene unable to make its way to the ribosome to be translated. Because the

mRNA molecule is the blueprint for manufacturing a protein, the cell can’t function

properly and dies.

There are potentially detrimental effects RNAi could have on Cannabis growers. For

example, RNAi could be used as an herbicide (targeting Cannabis). This might consist of

applying plant vectors or naturally occurring plant viruses that have an RNAi sequence.

The vector would then need to insert the RNAi into the plant cell. Genetically modified

plant viruses could one day carry out this process.

RNAicide, a term coined from RNAi and herbicide, might someday replace conventional

herbicides. In the case of eradication of Cannabis fields, RNAicide would need to be

directed at a sequence-specific (and species-specific) mRNA target, thereby initiating the

gene-silencing pathway. This view represents an extreme case of plant biotechnology,

and is not yet being tested.

However, rather than targeting marijuana with a pesticide, just the opposite is possible.

The gene for pesticide resistance can be inserted into marijuana. This has been done for

multiple crop species including soybean and corn. The gene for pesticide resistance also

has been inserted into cotton. In fact, of all the transgenic crops produced in the world,

pesticide resistance is the most common trait that has been exploited. At first glance it

may seem odd that humans have inserted a gene for pesticide resistance into the major

crop species. Further inspection reveals the logic behind this situation.

! '"!

Throughout history pesticides have been used to fight unwanted weed and insect species

from encroaching on cultivated food. Pesticides include both insecticides that target

insects and herbicides that target herbaceous plants (weeds). Chemical companies

profited from pesticides by making billions of dollars, farmers could better control their

land, governments obtained larger profits and less land was needed to obtain greater

yield. It was not until Monsanto, perhaps now the worlds largest agribusiness, inserted a

gene for herbicide resistance into crops that ultimately led to such unforeseeable profits.

The most common gene used in pesticide resistant crops is resistance to glyphosate.

Glyphosate is more commonly known as Roundup. What glyphosate does is it inhibits a

plant’s ability to manufacture amino acids that have an aromatic ring (a six carbon circle)

attached. By inhibiting this metabolic pathway, which is called the shikimic acid

pathway, a plant cannot manufacture functional proteins and dies. Subsequently, the

enzyme is called 3-enolpyruvylshikimate-5-phosphate synthase, or EPSPS for short.

Transgenic crops with glyphosate resistance have a variant form of EPSPS and so are not

affected by glyphosate. The glyphosate herbicide is non-specific that is it can inhibit any

green plant from making aromatic amino acids.

If a crop species such as corn is not inhibited by glyphosate a farmer is able to apply this

herbicide across an entire field. Since the entire crop of corn has this gene for glyphosate

resistance only the weeds surrounding the field will be killed. This leaves more sun,

water and soil for the crop species and allows for easier production of the crop.

This process has large implications for marijuana growers. First, if cultivators are

growing their crop on many acres, glyphosate-resistant Cannabis could be sprayed with

glyphosate and reduce competition from surrounding plants. This would ultimately yield

larger quantities and therefore may require smaller space to produce more Cannabis.

Secondly, the US government carries out glyphosate spraying on Cannabis crops. If

producers were growing genetically modified Cannabis, application of glyphosate would

have no effect on the plants. In fact, the US government would be doing a favor to

growers by limiting the surrounding vegetation. One may wonder when the successful

drug lords will begin investing in Cannabis biotechnology.

In summary, the mechanism for glyphosate resistance has been described in greater

detail. The molecular function of the gene for resistance, EPSPS, has also been described

in detail. Since this gene can be inserted into plants, glyphosate resistance is potentially

less than a year from being reality. Other herbicides sprayed on Cannabis crops also have

known resistance genes. Therefore, it is up to the researchers working on the betterment

of Cannabis to transform these genes, in addition to glyphosate resistance, in order to

preserve the vast fields of Cannabis product.

*

*

*

*

*

! '#!

NO7*Marijuana Laws, Regulations, and Education !

Before beginning any Cannabis research it is important to know the laws and regulations.

Research laws vary among countries. Some states within the US have some of the most

stringent laws on simple possession of marijuana while other states are more progressive.

For example, California legalized medical marijuana in the mid 1990’s. Recently there

has been legislation initiated within California and Massachusetts to legalize marijuana to

increase state revenues, possibly providing more than a billion dollar in revenue.

The ease people can grow marijuana is obvious. After all, it evolved as a weed and shows

its resilience by taking up residence in waste sites and along roadsides. Among the plant

kingdom, its large equatorial range is difficult to surpass. It seems hopeful that research is

becoming more progressive and research on Cannabis is becoming less restricted.

Japan has produced some of the most recent research on elucidating the THC pathway

and potentials for THC in biotechnology (Sirikantaramas et al., 2007). However, science

is an international phenomenon and listing all who have contributed to Cannabis research

is far beyond the scope of this book.

In other countries, especially in the United States, governments limit or prohibit

Cannabis research. At least in the United States, this may be due to the fact that the

politicians are making a portion of their salaries from alcohol sales tax. Many people

think that marijuana, if legalized for recreational purposes, might be incredibly difficult

to regulate by a government.

Limitations have also been placed on medical marijuana clubs and repositories, which

were routinely raided by federal officials under the Bush Administration. Since President

Barack Obama has taken office, his administration, specifically the Attorney General Eric

Holder, has publically announced they will not interfere with state medical marijuana

laws (i.e., no more federal raids). The Obama Administration has seemed so progressive

on marijuana laws that the slogan, “Yes we cannabis” has emerged. (His popularized

campaign slogan was “Yes we can”.)

Much of the debate around marijuana seems to have emerged partly from the U.S. anti-

marijuana campaign. This misinformation has greatly distorted the science behind

marijuana. However, informative and objective literature has been circulating among

scientific circles on the potentials of Cannabis and its influence on the brain.

What is currently known about the physiological influences is that marijuana’s

psychoactivity can be attributed to cannabinoids, small molecules with a distinct

molecular conformation that bind to distinct mammalian cell receptors. The highest

concentrations of these cannabinoids are found in Cannabis flowers. Humans too, make

cannabinoid-like compounds internally, called endocannabinoids. We have subsequently

evolved cell receptors (proteins on our cells’ plasma membranes) for these internally

produced (endogenous) molecules to bind and cause a cascade of biochemical reactions.

This reaction ultimately provides the euphoric feeling, or high, after smoking. However,

! '$!

the binding of THC to our cells’ receptors is actually due to cross-reactivity. In other

words, it’s due to sheer chance that THC binds to cell receptors that originally evolved to

allow endogenous molecules to bind.

While the cannabinoid-like compounds in our bodies (called endocannabinoids) elicit the

same euphoric response as THC, they have a noticeably different molecular structure.

Still, they have enough similarity in their overall molecular structures that THC cross-

reacts and can bind the receptors to elicit a euphoric effect. The details of the physiology

and underlying mechanisms of reactivity have recently been outlined in explicit detail

(Berghuis, 2007).

Previous studies, which have warned of the negative effects of smoking marijuana, were

exaggerated with faulty claims (Ponto, 2006). On the contrary, it has been demonstrated

that mice given cannabinoids stimulates neuronal activity within certain regions of their

brains. Indeed, endocannabinoids have been shown to play a large role in facilitating

neuronal growth and development (Harkany et al., 2008). I have often wondered if high-

ranking officials suppress marijuana because of its potential to produce new ideas and

make people feel more spiritually empowered. If people were indeed able to think for

themselves, they would not be so heavily dependent on a government’s direction on how

to live their lives through societal servitude.

Scientifically studying how Cannabis interacts with our nervous system could be helpful

in many ways to the public. The diminishing use of alcohol would serve a larger benefit

to all of society. This logic has repeatedly been presented from many different groups

trying to both prohibit alcohol and to legalize marijuana. The fact remains that drunk

drivers, child and spousal abuse, binge drinking, violence and harsh crimes, cancers and

liver failure, and public stupidity almost always involve alcohol consumption. In addition

to the nearly infinite list of dangers that alcohol offers, it is a biological toxin and is used

routinely to kill microbes on surfaces, in wounds, etc. With so many negative effects

stemming from alcohol, one should logically expect to see politicians embracing safer

alternatives to alcohol, such as marijuana.

Public education has largely remained a grass-roots effort to discuss the benefits and

science of marijuana, although Oxford University Press has recently published the second

edition of, The Science of Marijuana. Popular culture (e.g., High Times) has also aided

the effort to spread the facts on marijuana. Taken together, these means of education

seem to be effective enough to have allowed marijuana to persist in our culture. With the

rise of the biotechnology of Cannabis sativa, more people will undoubtedly become

involved in working to understand and discuss potential benefits.

My own use of marijuana has helped stimulate an interest in the sciences and ask more

questions about life. When I was in high school my interest level in learning was below

zero. I barely graduated my senior year. Whether I was bored or not, I can’t remember. It

was a time of confusion and fear, not knowing much about myself and listening to what

older people were telling me to do. There was little room for independent thought.

! '%!

When I was finished with high school, I joined the US Army. This wasn’t odd,

considering many kids from my town used that as an option for immediate escape into

the world. The military provided comfort in that I was with people my own age, with

similar educational and socioeconomical background, and making friends came fairly

easily. But then I ended up with a life-changing experience while I was serving, one so

radical that many would not believe my story and so I dare not discuss it within the

framework of this book.

I left the military and went back to my hometown. There, I learned about the local

university, where kids were able to take classes of their choice and interest. I enrolled and

within a few weeks I knew that college would be one of the most stimulating things I

may ever encounter. But then, not long after I started my freshman year, I met someone

who smoked marijuana. He was a regular user, probably more than regular actually. I

smoked with him a few times and then I bought a small bag from him.

It was very unfamiliar to me. It was dry, smashed, and smelly. I took it home to the

apartment where I lived alone. I didn’t touch it for a few days. I read a little more about

what it was and learned that it was a flower from a plant. Eventually, after I was finished

reading for my modern world civilization class, I loaded a small pipe I had bought, went

to my living room and I took some hits. My house suddenly became very quiet. The small

sounds of the creaky floor and the wind against the windows were very crisp, I was very

alert. At the same time my mind seemed to be speeding through hundreds of ideas each

second.

First I was thinking about Akbar from the ancient Middle East, then Diderot and his

encyclopedia, and then suddenly it was my houseplants and how they were responding to

the dim light of my living room. My mind was simultaneously brought to an ease that I

had never felt before. These two extremes, rapid flow of thoughts and calmness of my

mind, switched back and forth repeatedly for quite some time. Everything in my life

seemed to suddenly make sense and my purpose became obvious. I wanted to learn as

much as I could while in college and make the most out of my life.

I also fell in love that night with a plant called Cannabis sativa. I had found meaning to

my life, and the smoke from my pipe had given me clarity and purpose for college. I

wanted to study my history more, while thinking of the role marijuana played in shaping

it. I wanted to study my human anatomy and physiology book and think about how

marijuana travels through and is metabolized by the human body. I wanted to study my

plant taxonomy book and figure out where Cannabis fit into the diverse kingdom. I

wanted to learn everything I could about everything there was.

Since my undergraduate years have passed, I have smoked less and less marijuana.

However, I have not forgotten its effect on my life. I am grateful for this plant and in

many ways I feel I am indebted to it. It has allowed me to grasp abstract ideas in a more

concrete way and provided me opportunities that I otherwise would have never had. It

has given me motivation and drive to learn. I know that this is not the experience

everyone has after smoking marijuana. Some people who are introduced to it smoke and

! '&!

are not motivated to do anything. For me, the best times of my undergraduate years were

reading quietly for long hours alone in my apartment then smoking and thinking about

what I had just read. For others, they are caught in a vicious and unproductive cycle of

television and video games; they use marijuana to zone out, to avoid the rest of the world.

I can’t say this is wrong, but I do wonder why Cannabis has opposite effects on each

person. We need to give more scientific study this plant, both for its biochemistry and its

potential in biotechnology.

Biotechnology may not be limited to Cannabis. For instance, those with the ability to

invest large amounts of money into creating their own labs and hiring competent plant

biotechnologists, may be able to create any plant with any drug they want. Production of

a cocaine-producing plant that is tolerant of conditions in North America would bring

billions in drug sales. It may also wipe out communities and increase instability among

otherwise stable regions. This is not to say Cannabis biotechnology should not be

pursued. Its use however should remain up to the individual.

One drawback of marijuana use may be when an individual shares their pipe or other

device with friends they may also be sharing oral diseases. A recent opinion article

argued that there might be an increase in the rate of oral cancers among marijuana

smokers. This may not be due to marijuana smoke; rather it is possibly due to passing

virus particles and germs from an infected individual to an uninfected individual

(Zwenger, 2009). For instance, oral human papilloma virus (HPV), commonly associated

with warts in all areas of the body but now being increasingly found in the mouths of

younger people, might be one reason for the increase in oral cancers. HPV has previously

been linked with vaginal and oral cancers.

Therefore, marijuana smokers should be cautious about sharing with anyone, since

detection of HPV is uncommonly reliable by sight alone. This should not discourage one

from smoking with friends. Rather it should serve as beneficial advice. It should serve as

a warning to anyone who cares about his or her future health and safety to retain their

own smoking device for themselves.

Knowledge such as this should not be looked upon as depressing. Indeed, knowledge is a

good thing to posses, whether it is about how the universe operates, the meaning of life,

or Cannabis (which often is the meaning of life for some people). Understanding more

about Cannabis, which is one of the most intriguing plants that humankind has ever

discovered, could allow humans to prosper far beyond their present state. Changing the

genetic structure could prove even more beneficial by discussing its science, chemistry,

and importance to human mental health.

The future is bright for Cannabis biotechnology. There could be no better time to create

transgenic plants harboring select genes. This book has touched on some of the unique

Cannabis plants that are waiting to be created. I leave it to the student of plant

biotechnology to decide when to bring these ideas to reality. Improving Cannabis

through biotechnology will most likely occur within the next decade. The only question

that remains is, who will be the first to smoke it?

! ''!

References:

Armbruster, W. S. “The role of resin in angiosperm pollination: ecological and chemical

considerations.,” Amer J Bot (71) 1986, pp. 1149--1160.

Berghuis, P., Rajnicek, A. M., Morozov, Y. M., Ross, R. A., Mulder, J., Urbán, G. M.,

Monory, K., Marsicano, G., Matteoli, M., Canty, A., Irving, A. J., Katona, I., Yanagawa,

Y., Rakic, P., Lutz, B., Mackie, K. and Harkany, T. "Hardwiring the brain:

endocannabinoids shape neuronal connectivity.," Science (316:5828), 2007, pp. 1212--

1216.

Bou-Torrent, J., Roig-Villanova, I. and Martínez-García, J. F. "Light signaling: back to

space.," Trends Plant Sci (13:3), 2008, pp. 108--114.

Cantrill, S. Nobel Prize 2008: Green fluorescent protein.,” Nature Chem

doi:10.1038/nchem.75, 2008.

Conrad, C. Hemp for health: The medicinal and nutritional uses of Cannabis sativa.,”

1997, Healing Arts Press.

Dafny-Yelin, M. and Tzfira, T. "Delivery of multiple transgenes to plant cells.," Plant

Physiol (145:4), 2007, pp. 1118--1128.

Harkany, T., Keimpema, E., Barabás, K. and Mulder, J. "Endocannabinoid functions

controlling neuronal specification during brain development.," Mol Cell Endocrinol

(286:1-2 Suppl 1), 2008, pp. S84--S90.

Hazekamp, A., Ruhaak, R., Zuurman, L., van Gerven, J. and Verpoorte, R. "Evaluation

of a vaporizing device (Volcano) for the pulmonary administration of

tetrahydrocannabinol.," J Pharm Sci (95:6), 2006, pp. 1308--1317.

Herer, J. “The Emperor Wears No Clothes: The Authoritative Historical Record of

Cannabis and the Conspiracy Against Marijuana.,” 2000, Quick American Archives.

James, C. “Global Status of Commercialized Biotech/GM Crops: 2005.,” 2005, ISAAA,

Ithica, NY.

Johnston, J. S., Pepper, A. E., Hall, A. E., Chen, Z. J., Hodnett, G., Drabek, J., Lopez, R.

and Price, H. J. "Evolution of genome size in Brassicaceae.," Ann Bot (Lond) (95:1),

2005, pp. 229--235.

Kirst, M., Johnson, A. F., Baucom, C., Ulrich, E., Hubbard, K., Staggs, R., Paule, C.,

Retzel, E., Whetten, R. and Sederoff, R. "Apparent homology of expressed genes from

wood-forming tissues of loblolly pine (Pinus taeda L.) with Arabidopsis thaliana.," Proc

Natl Acad Sci U S A (100:12), 2003, pp. 7383--7388.

! '(!

Lydon, J., Teramura, A. H. and Coffman, C. B. "UV-B radiation effects on

photosynthesis, growth and cannabinoid production of two Cannabis sativa

chemotypes.," Photochem Photobiol (46:2), 1987, pp. 201--206.

Marks, L. A., Kalaitzandonakes, N., Wilkins, L., Zakharova. “Mass media framing of

biotechnology news.,” Public Underst Sci (16:2), 2007, pp. 183--203.

McCullen, C. A. and Binns, A. N. "Agrobacterium tumefaciens and plant cell interactions

and activities required for interkingdom macromolecular transfer.," Annu Rev Cell Dev

Biol (22), 2006, pp. 101--127.

Mitsuda, N., Iwase, A., Yamamoto, H., Yoshida, M., Seki, M., Shinozaki, K. and Ohme-

Takagi, M. "NAC transcription factors, NST1 and NST3, are key regulators of the

formation of secondary walls in woody tissues of Arabidopsis.," Plant Cell (19:1), 2007,

pp. 270--280.

Mukherjee, A., Roy, S., De Bera, S., Jiang, H., Li, X., Li, C., Bera, S. “Results of

molecular analysis of an archaeological hemp (Cannabis sativa L.) DNA sample from

North West China.,” Genet Resour Crop Evol (55:4), 2008, pp. 481--485.

Murashige T. and Skoog, F. “A revised medium for rapid growth and bioassays with

tobacco tissue cultures.,” Physiol Plant (15:3), 1962, pp. 473-497.

Pertwee, R. G. "Cannabinoid pharmacology: the first 66 years.," Br J Pharmacol (147

Suppl 1), 2006, pp. S163--S171.

Pichersky, E., Noel, J. P. and Dudareva, N. "Biosynthesis of plant volatiles: nature's

diversity and ingenuity.," Science (311:5762), 2006, pp. 808--811.

Pontes, D. S., Lima-Bittencourt, C. I., Chartone-Souza, E. and Nascimento, A. M. A.

"Molecular approaches: advantages and artifacts in assessing bacterial diversity.," J Ind

Microbiol Biotechnol (34:7), 2007, pp. 463--473.

Ponto, L. L. B. "Challenges of marijuana research.," Brain (129:Pt 5), 2006, pp. 1081--

1083.

Reyes-Prieto, A., Weber, A. P. M. and Bhattacharya, D. "The origin and establishment of

the plastid in algae and plants.," Annu Rev Genet (41), 2007, pp. 147--168.

Robert-Seilaniantz, A., Navarro, L., Bari, R. and Jones, J. D. G. "Pathological hormone

imbalances.," Curr Opin Plant Biol (10:4), 2007, pp. 372--379.

Robinson, R. “The great book of hemp: The complete guide to the environmental,

commercial, and medicinal uses of the world's most extraordinary plant.,” 1996, Park

Street Press, Rochester, VT.

! ')!

Romeis, J., Meissle, M. and Bigler, F. "Transgenic crops expressing Bacillus

thuringiensis toxins and biological control.," Nat Biotechnol (24:1), 2006, pp. 63--71.

Sheen, J., Hwang, S., Niwa, Y., Kobayashi, H. and Galbraith, D. W. "Green-fluorescent

protein as a new vital marker in plant cells.," Plant J (8:5), 1995, pp. 777--784.

Sirikantaramas, S., Morimoto, S., Shoyama, Y., Ishikawa, Y., Wada, Y., Shoyama, Y.

and Taura, F. "The gene controlling marijuana psychoactivity: molecular cloning and

heterologous expression of Delta1-tetrahydrocannabinolic acid synthase from Cannabis

sativa L.," J Biol Chem (279:38), 2004, pp. 39767--39774.

Sirikantaramas, S., Taura, F., Morimoto, S. and Shoyama, Y. "Recent advances in

Cannabis sativa research: biosynthetic studies and its potential in biotechnology.," Curr

Pharm Biotechnol (8:4), 2007, pp. 237--243.

Sirikantaramas, S., Taura, F., Tanaka, Y., Ishikawa, Y., Morimoto, S. and Shoyama, Y.

"Tetrahydrocannabinolic acid synthase, the enzyme controlling marijuana psychoactivity,

is secreted into the storage cavity of the glandular trichomes.," Plant Cell Physiol (46:9),

2005, pp. 1578--1582.

Smith, R. “Plant tissue culture: Techniques and experiments.,” 2008, Academic Press.

Soltis, D. E., Ma, H., Frohlich, M. W., Soltis, P. S., Albert, V. A., Oppenheimer, D. G.,

Altman, N. S., dePamphilis, C. and Leebens-Mack, J. "The floral genome: an

evolutionary history of gene duplication and shifting patterns of gene expression.,"

Trends Plant Sci (12:8), 2007, pp. 358--367.

Stewart, S. “Plant biotechnology and genetics: Principles, techniques and applications.,”

2008, Wiley-Interscience.

Taura, F., Dono, E., Sirikantaramas, S., Yoshimura, K., Shoyama, Y. and Morimoto, S.

"Production of Delta(1)-tetrahydrocannabinolic acid by the biosynthetic enzyme secreted

from transgenic Pichia pastoris.," Biochem Biophys Res Commun (361:3), 2007, pp. 675--

680.

Taura, F., Sirikantaramas, S., Shoyama, Y., Shoyama, Y. and Morimoto, S.

"Phytocannabinoids in Cannabis sativa: recent studies on biosynthetic enzymes.," Chem

Biodivers (4:8), 2007, pp. 1649--1663.

Thomson, J. “Tactics for male reproductive success in plants: contrasting

insights of sex allocation theory and pollen presentation theory.,” Integr Comp Biol

(46:4), 2006, pp. 390--397.

Thorpe, T. A. "History of plant tissue culture.," Mol Biotechnol (37:2), 2007, pp. 169--

180.

! (+!

Vaughan, D. A., Balázs, E. and Heslop-Harrison, J. S. "From crop domestication to

super-domestication.," Ann Bot (Lond) (100:5), 2007, pp. 893--901.

Venter, M. "Synthetic promoters: genetic control through cis engineering.," Trends Plant

Sci (12:3), 2007, pp. 118--124.

Wang, Q. and Guanming S. “Industrial Hemp: China’s experience and global

implications.,” Rev Ag Eco, (21:2), 1999, pp. 344-57.

Yuan, Z.-C., Haudecoeur, E., Faure, D., Kerr, K. F. and Nester, E. W. "Comparative

transcriptome analysis of Agrobacterium tumefaciens in response to plant signal salicylic

acid, indole-3-acetic acid and gamma-amino butyric acid reveals signalling cross-talk and

Agrobacterium--plant co-evolution.," Cell Microbiol (10:11), 2008, pp. 2339--2354.

Zwenger, S. “Bogarting that joint might prevent oral HPV among Cannabis users.,” Curr

Oncol. (16), 2009. In Press.

! (*!

Appendix A

Presented here is a representative list of genes with the potential to be used for

transforming (or up-regulating) into Cannabis plants. Gene symbols are given along with

the complete name, which also may describe the function. Although these were originally

described in the model plant Arabidopsis thaliana, they most likely have analogous

sequences in Cannabis sativa. It should be noted that this is not an exhaustive list and

many other genes could be transformed into Cannabis. For example, the gene for the

ability to make tendrils, which are simply modified leaves, is not listed.

E1)1*J9#6"2** Complete Gene Name

CUQ! ! ! C9233./0!:;-8386-.505

CUK C9/831.-L!.98302B!522B5

CQM C-0232B!:[email protected]

CIX Adagio

CYK, Separase

AFO Abnormal floral organs

ALAC Alarm clock

ALE Abnormal leaf shape

AN Angustifolia

AS Asymmetric leaves

BAL Ball

BAM Big apical meristem

BDY Buddy

BIF Bifid stigma

BLB Blueberry

BNS Bonsai

BPE Bigpetal

BSH Bushy plants

BST Bristled

BUD Bulkhead

BUS Bushy

CA Caespitosa

CAF Carpel factory

CBB Cabbage

CEL Callus expression of RBCL

CHP Chlorophyll mutant

CLV Extra carpels

CLY Early flowering

COD Cone head

CTS Comatose

CUT Altered epicuticular wax

CYL Cyclops

DFL Dwarf in light

! ("!

DIS Distorted trichomes

DLS Delayed leaf senescence

DM Dangerous mix

DPR Drought and pathogen resistant

DRA Dracula

DRO Drought tolerant

DSR Dark green leaves, stunted roots

DVL Devil

DWG Dwarf gigantica

DYA Dyad

EAF Early flowering

ECL Early curly leaf

EEP Early extra petals

ELF Early flowering

ELG Elongated

ELL Extra long lifespan

ER Erecta

ERH Ectopic root hair

ERT Early trichomes

ESI Elongated, stout internodes

ESK Eskimo

EXC Extra cells

EXI Exigua

FAC Embryonic factor

FAF Fantastic four

FAX Fewer axillary branches

FDH Fiddlehead

FE Late flowering

FEY Forever young

FIF Flower in flower

FIL Filamentous flower

FKD Forked

FLH Flowering H

FLK Flaky pollen

FTR Fat root

GCT Grand central

GGL Gargoyle

GI Gigantea, late flower

GLM Gollum

GLO Glabrous, chlorotic

GMB Gumby

GRA Grandifolia

GRE Glyphosate responsive

GRM Gremlin

GTR Glassy trichome

HAP Hapless

! (#!

HBT Hobbit

HCA High cambial activity

HIC High carbon dioxide

HIO High oil (altered seed content)

HOR High expression of abiotic responsive gene

HRT Heartless

HST Hasty

HYV High vigour

IAD Increased apical dominance

ICA Icarus

ICU Incurvata

IKU Haiku

IMP Impotent

IRN Yellow-green

ITN Increased tolerance to NaCl

IVR Invasive root

ZC[! ! Z.<<2B

ZCM K233.02B!-2.J25

ZK\ Z.58/

]C] ].N0=5!! !

]Y[! ! ! ]226!8/!<84/<

]Y^! ! ! ]2=-2

]S,! ! ]4/N7!68--2/

]Z]! ! ! ]8O.N

]_,! ! ]37608/402

]\U! ]/89;2.B

VCI! ! V.02!./0;23!B2;45:2/:2

VYR! ! ! V2.A!1836;8<2/2545!B453=602B

VTM! ! V8/25812!;4<;@.7

VS?! ! V48/5!0.4-

RCC! ! ! R.<.0.1.

RCI! ! ! R.-2!<.12086;704:!B2A2:04J2

RCV! ! ! R.39-2B!-2.J25

RPX! ! ! R=-04A8-4.!1./7!-2.J25

RSQ! ! R4:N27

RXI! ! ! R85.4:!B2.0;

RKT! ! ! R./7!5;8805

\XQ! ! ! \8!:807-2B8/5 NOT Loves-me-not

NPG No pollen germination

NSM Insomniac

NZZ Nozzle

OLT Old timer

OMO Odd man out: male meiosis defective

ORB Orbiculata

PAC Pale cress

! ($!

PAN Extra perianth organs

PBH paintbrush

PBO Peek-a-boo

PBR Polar bare

PCK Peacock

PCL Phytoclock

PEP Pepper

PHD Pothead

PI Pistillata

PIC Pinocchio

PKL Pickle

PLT Plethora

PLU Pluto

PNT Peanut

POL Poltergeist

PRA Prairie

PRK Peter Parker

PRS Pressed flower

QBL Quibble

QRT Quartet

QUA Quasimodo

RAT Resistant to Agrobacterium transformation

RBE Rabbit ears

RBY Ruby

RCK Rock-n-rollers

RCU Recurvata

RD Rotundata

RED Red light elongated

RFI Rastafari

RGM Rapid germination

RLP Revertant for leafy petiole

RNT Runt

RON Rotunda

ROU Rouge

RTY Rooty

RUG Rugosa

SAB Sabre

SAG Sagittatus

SAW Sawtooth

SCA Scabra

SCF Scarface

SCN Supercentipede

SDD Stomatal density, distribution

SEA Serrata

SHD Shepherd

SHI Short internodes

! (%!

SHN Shine

SHV Shaven

SLK Seuss-like

SLO Slowcoach

SLOMO Slowmotion

SMB Sombrero

SML Stamen loss

SNO Snoball

SNV Supernova

SPCH Speechless

SPK Spock

SPR Spiral

SPS Supershoot

SPT Spatula

SRB Shoot and root branching

SSE Shrunken seed

STA Satchel

SUP Superman

SWE Sweetie

TARA Tarantula

TASTY Tasty

TAX Trichome anthocyanin expansion

TBR Trichome birefringence

TCU Transcurvata

TDL Trichome density locus

TFA Things fall apart

TIL Tilted

TIN Tinman

TIO Two-in-one

TLZ Tlazolteotl

TMM Too many mouths

TNY Tiny

TOAD Toadstool

TOP Tower of Pisa

TPL Topless

TRL Troll

TRN Tornado

TRY Triptychon

TWD Twisted dwarft

UCN Unicorn

UCU Ultracurvata

UFO Unusual floral organs

ULA Hula

ULT Ultrapetala

UMA Umami

URM Unarmed

! (&!

URO Upright rosette

UTC Up the creek

Uzi Unzipped

VAR Variegated

VCH Vertically challenged

VEP Vein patterning

VHE Van Helsing

VHI Vascular highway

VIR Virescent

WAG Wag

WAR Wax restorer

WCO White cotyledons

WDY Woody

WER Werewolf

WHG Warthog

WIG Wiggum

WLC Wavy leaves, cotyledons curled back

WOL Wooden leg

WOW Wonderwoman

WVS Wavy sepal

WYR Wryd

XS Extra-small sisters

XTG Extinguisher

YAB Yabby

YAK Yakka

YDA Yoda

YEL Yellow

YI Yellow inflorescence

YOR Yosemite resistance

YSV You’re so vein

YUC Yucca

ZEU Zeus

ZIG Zig zag stem

ZLL Zwille

ZPL Zeppelin

ZPY Zippy

ZWG Zwergerl

ZWI Zwichel

! ('!

Appendix B

Provided here is a small representation of the many biotechnology companies that are

currently selling useful products for plant biotechnology research. Each company varies

by product and location, while some companies specialize in only certain products.

Needless to say, there are many other companies in addition to the ones listed here.

-Bio-Rad, http://www.bio-rad.com

This company sells electroporation equipment, although these devices are often very

expensive. They also sell a huge variety of molecular research tools and reagents for labs

ranging from labs with high-tech needs to high school labs.

-Carolina Biological Supply Company, http://www.carolina.com

This is primarily a company that specializes in classroom kits and products. However,

they also sell callus initiation media, containers and dishes for plant tissue culture, and

pre-made sterile media.

-Eppendorf, http://www.eppendorf.com

This is perhaps one of the world’s largest suppliers of biotechnology equipment and sells

plastic-ware and pipettors to distribute cells and small amounts of liquid.

-Lucigen Corporation, http://www.lucigen.com

This international company sells different kits to splice and cut genes into different

vectors and have established themselves as a reliable source for biotechnology research.

Additionally, they offer cDNA library construction.

-pGreen, http://www.pgreen.ac.uk

pGreen is part of the biotechnology resources for Arable Crop Transformation (BRACT),

located in the UK. This is one of the best resources for purchasing strains of

Agrobacterium. Agrobacterium cells that have been transformed with GFP can be

purchased here as well.

-Hoffmann-La Roche, http://www.roche.com

Although best known for its biomedical supplies, this Swiss company is a giant in the

biotechnology industry and sells enzymes and cells, which may be pertinent to some

experiments in plant biotechnology.

-Sentryair Purification Systems, http://www.sentryair.com

This company specializes in providing sterile working conditions, that is crucial in plant

biotechnology experiments. They offer a huge selection of laminar flow hood models and

sizes.

Sigma-Aldrich, http://www.sigmaaldrich.com

A huge chemical supply company with locations in multiple countries that sells

chemicals of all kinds. Some of its newest products focus on RNAi research.

! ((!

-Streamline Laboratory Prodcuts, http://www.streamlinelab.com

This company offers laminar flow hoods, PCR hoods, ductless hoods, and tissue culture

hoods. They supply many different models with a variety of price ranges.

! ()!

Glossary

2,4-dichlorophenoxyacetic acid (2,4-D)- an auxin hormone that causes cell division and

root formation

abscisic acid- a cytokinin used to promote cell division and shoot formation

achene- a type of fruit that has

agar- polysaccharide used to solidify media

Agrobacteirum- bacteria used to infect plants and transfer foreign DNA

alternation of generations- the life cycle of plants that alternates between a haploid

gametophyte and a diploid sporophyte

annual- a plant that lives for only one year

antibiotic- chemical that can inhibit cells from growing

apical dominance- the case where a terminal bud suppresses the growth of lateral buds

archaea- one of the three domains of life that is composed of extremophiles

asexual propagation- process where cuttings of a plant can be re-grown into complete

organisms

Asteraceae- the sunflower or composite plant family

auxin- plant hormone involved in root formation and used in tissue culture

bacteria- one of the three domains of life that contains most bacteria; a single celled

prokaryote

biotechnology- the process where cells are manipulated for desirable genetic outcomes

bud- a general term for a flower

callus- an undifferentiated mass of plant cells

callus media- growth substrate used for growing bits of plant stem into calluses

calyx- term used for that includes all of the sepals

Cannabaceae- the Cannabis and hops plant family

! )+!

Cannabis sativa- the scientific name for marijuana plant

carbohydrate- an organic molecule such as cellulose or glucose that can be used for

energy

carpel- the female reproductive part of the flower

cDNA library- a collection of sequences that represent actively transcribed genes

cell- the smallest unit of life; many cells constitute a tissue

cell wall- the outer layer of the cell that serves to protect and maintain the contents of the

cell

cellulose- large polysaccharide that is the main constituent of plant cell walls

central dogma of biology- fundamental process of biology where a gene is transcribed

into mRNA, which is then translated into a protein

chromosome- the piece of DNA that harbors genes, it is composed of many nucleic acids

co-cultivation- process in plant tissue culture that allows time for the Agrobacterium to

infect the callus

complimentary DNA (cDNA)- reverse transcribed mRNA that represents an expressed

gene

corolla- term for all the flower petals combined

cytochromes- plant proteins responsible for detecting various wavelengths of light

cytokinins- plant hormones that can induce cell division and shoot formation

cytoplasm- the intracellular matrix in which organelles, proteins and molecules are

suspended in

deoxyribonucleic acid (DNA)- a polymer that is the genetic material of all life

dimethylallyl pyrophosphate/diphosphate (DMAPP)- molecule used in the synthesis of

terpenes

diploid- having two copies of each chromosome

electroporation- process where Agrobacterium is induced to take up foreign DNA using

an electric shock

! )*!

endosymbiosis- an even that occurred early in the evolution of life and led to eukaryotic

organisms

enzyme- a protein that acts as a catalyst to speed up a reaction

epidermis- the outermost layer of plant tissue

ethylene- a small gaseous molecule that is also a plant hormone that speeds fruit ripening

eukaryote- an organisms that has double-membrane structures and a nucleus

explant- term used for the bits of plant stem that are placed onto the culture media

family- a classification groups that many plant taxonomists are familiar with

flower- the reproductive structure of angiosperms

funiculus- the small stalk that connects the seed to the pericarp

gene- sequence on DNA that can code for a protein

gene gun- device used to transfer foreign DNA into cells using high velocity microbeads

gene stacking- transferring many foreign genes simultaneously

genome- the complete set of genes an organism posses

gibberellins- plant hormones that can increase height of a plant

glucose- a carbohydrate monomer that is used for energy or in biosynthesis to create

larger polymers

green fluorescent protein (GFP)- a barrel-shaped protein

haploid- having a single copy of a gene

heat shock- process of briefly heating a bacterium to make it take up foreign DNA

hemp- a low THC-containing Cannabis plant known for its tough fibers

homology- having similar sequence or structure in two different species

indole-3-acetic acid (IAA)- an auxin plant hormone that stimulates root production and

cell division

isopentenyl pyrophosphate/diphsphate (IPP)- a carbon building block used in terpene

! )"!

biosynthesis

isoprene- a five carbon molecule, which is often the product of terpene degradation

kanamycin- antibiotic used to select for transgenic calluses

kilobase (kb)- a thousand bases

kingdom- one of the highest ranks of classification, which includes plants, fungi, animals

and protists

laminar flow hood- an enclosed chamber that uses a negative air pressure to maintain

sterile working conditions

Leguminosae- plant family of beans

lignification- the process of laying down lignin in the cell wall

lignin- a polysaccharide that gives strength and rigidity to the plant cell

lipid- one of the four macromolecules of life that are the main constituents of cell

membranes

meristematic region- location of actively dividing cells

messenger RNA (mRNA)- the molecule synthesized from the DNA template used to

make a protein

mevalonate- the end product of the mevalonate terpene pathway that occurs in the

cytoplasm

microbe- a microscopic organism, usually refers to either bacteria or fungus

molecule- a compound made up of multiple elements, e.g. a water molecule

morphology- the overall appearance or shape

morph- abbreviation for morphology

Musharige-Skoog (MS) media- the most commonly used plant tissue culture media for

developing calluses into plants

nanometer (nm)- a billionth of a meter

northern blot- technique used to confirm expression of a gene

! )#!

nucleotide base- component of nucleic acids that can be either adenine, guanine, cytosine,

thymine, or uracil

nucleus- the area of a eukaryotic cell where chromosomal material is stored

organogenesis- the process by which totipotent cells develop into shoots and roots

perennial- a plant that lives more than one year

pericarp- the outer layer of the fruit

petal- floral whorl in plants often colored to act as an attractant

Petri dish- plastic or glass plate used to culture or keep cells

phenolic ring- a circularized six carbon molecule

photoperiod- the length of daylight that is one method plants use to detect seasonality

photosynthesis- the process of converting radiant energy into chemical energy

plasmid- an extra chromosomal piece of DNA, often circular in shape

plastid- a plant organelle in the cytoplasm that can make or store food

polymerase chain reaction (PCR)- a series of heating and cooling that results in

amplification of a gene product

polysaccharide- a polymer of sugar subunits

prokaryote- a single celled organism that lacks a nucleus; a bacteria

promoter- region of a gene that helps dictate the rate at which mRNA is made

protein- a polymer of amino acids that is often an enzyme

reporter gene- a gene used in biotechnology to confirm transformation

resin- a complex mixture of plant secondary metabolites in a liquid matrix

reverse transcription- process where an mRNA molecule is made back into DNA

root hairs- often microscopic protrusions of the roots that increase surface area

secondary xylem- wood

sepal- a subunit of the calyx; the floral bract at the base of most flowers

! )$!

southern blot- molecular biology tool that allows detection of a gene

species- the classifying unit in biology that falls under genus

spore- a microscopic asexual unit capable of generating an entire organism

stamen- the male reproductive part of a flower

terpene- a large class of plant secondary metabolites

tetrahydrocannabinol (THC)- the main psychoactive component of Cannabis

THCA synthase- the enzyme responsible for converting cannabigerolic acid to THCA

tissue- similar cells working together

tissue culture- technique where plants can be grown in vitro

totipotency- having the capability to turn into any type of cell

transcription- conversion of DNA to mRNA

transcription factor- small protein that helps regulate transcription

transfer DNA (T-DNA)- part of the DNA that is transferred from Agrobacterium to a

plant cell

transfer RNA (tRNA)- small RNA molecule that carries the amino acid to the site of

protein synthesis

transgenic- term used for an organism that has been genetically modified

transpiration- process where water moves from roots and through the xylem and out of

the stomata

trichomes- modified epidermal cells that can help in water retention

tween20- a mild detergent used to wash freshly cut stems

up-regulation- process where a gene is expressed at a higher rate

western blot- method used in molecular biology to study proteins

xylem- part of the vasculature of plant that conducts water

! )%!

I hope you enjoyed this scientific-based book on the exciting field of plant biotechnology

with a special focus on its relationship with Cannabis sativa, commonly known as

marijuana. This world-renowned herb has captured the interest of nearly every culture on

every continent for hundreds, and in some instances, thousands of years. Although, now

in the twenty first century, crop plants are being genetically modified to better suit the

needs of society, marijuana has not received the same level of attention.

This book describes the merging of two important subjects, marijuana and plant

biotechnology. Marijuana’s role in the biotechnology age is outlined and described in this

book with the equal hopes of encouraging research to improve this plant and to inspire

young people to pursue a lifetime of learning.

About the Author:

Sam is a graduate student studying plant biotechnology at the University of Northern

Colorado. Although his research focuses on plant terpenoids, he has secondary interests

that include astronomy, music, and the role of science in society.