TECHNOLOGIES FOR HIGH THROUGHPUT SINGLE MOLECULE DNA SEQUENCING A DISSERTATION SUBMITTED TO THE DEPARTMENT OF BIOENGINEERING AND THE COMMITTEE ON GRADUATE STUDIES OF STANFORD UNIVERSITY IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Jerrod Joseph Schwartz May 2009
213
Embed
TECHNOLOGIES FOR HIGH THROUGHPUT SINGLE MOLECULE …web.stanford.edu/group/foundry/services/papers... · technologies for high throughput single molecule dna sequencing a dissertation
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
TECHNOLOGIES FOR HIGH THROUGHPUT
SINGLE MOLECULE DNA SEQUENCING
A DISSERTATION
SUBMITTED TO THE DEPARTMENT OF BIOENGINEERING
AND THE COMMITTEE ON GRADUATE STUDIES
OF STANFORD UNIVERSITY
IN PARTIAL FULFILLMENT OF THE REQUIREMENTS
FOR THE DEGREE OF
DOCTOR OF PHILOSOPHY
Jerrod Joseph Schwartz
May 2009
UMI Number: 3364456
INFORMATION TO USERS
The quality of this reproduction is dependent upon the quality of the copy
submitted. Broken or indistinct print, colored or poor quality illustrations
and photographs, print bleed-through, substandard margins, and improper
alignment can adversely affect reproduction.
In the unlikely event that the author did not send a complete manuscript
and there are missing pages, these will be noted. Also, if unauthorized
copyright material had to be removed, a note will indicate the deletion.
®
UMI UMI Microform 3364456
Copyright 2009 by ProQuest LLC All rights reserved. This microform edition is protected against
unauthorized copying under Title 17, United States Code.
4.11 DNA replication exhibited heterogenous pausing 74
4.12 Pause frequency as a function of polymerase position 76
4.13 Histograms of S/N ratios for pauses and extensions 78
4.14 Sequence-dependent pause lifetimes for Pol I(KF) and 029 79
4.15 "Speed limit" replication rates for Pol I(KF) and 029 82
4.16 Average trajectories for polymerase molecules that did not pause . . . 84
4.17 Pause durations and intensities locations during hairpin refolding . . 85
4.18 The observable energy landscape of cruciform transitions 86
4.19 Structure of the DNA cruciform intermediates 88
xiv
5.1 Colloidal lenses for single fluorophore detection 93
5.2 Power calculated with the FDTD method 97
5.3 Colloidal lenses as rotational probes 100
5.4 Static imaging of single quantum dots 101
5.5 Enhanced fluorescence effects of Ti02 colloids 103
5.6 Static imaging of single fluorophores with colloidal lenses 106
5.7 Colloidal lensing of DNA polymerase activity I l l
5.8 Replication rates measured with colloidal lenses 117
6.1 Au-coated surfaces are substrates for SAMs 122
6.2 XPS spectra of an Au-coated surface 124
6.3 XPS spectra of 11-amino-undecanethiol on an Au-coated surface . . . 125
6.4 Cy3-dUTP quenching on Au-coated surfaces 126
6.5 Pol I(KF) incorporated Cy3-dCTP on a SAM-Au surface 126
7.1 2D structures for R6G-dGTP and Cy5-dCTP 136
7.2 Crystal structure of Taq polymerase 137
7.3 Crystal structure of the active site of Taq and T7 138
7.4 The active site of T7 polymerase 139
7.5 Crystal structure of HIV-1 reverse transcriptase 141
7.6 Tgo and Vent polymerases 142
7.7 Pol I(KF) with Cy5-dCTP bound 144
7.8 dUTP-17-E-Cy5 with an internal ester 148
7.9 Primer and template sequences used for nucleotide screening 149
7.10 Validation of dUTP-10-Cy5, Part I 150
7.11 Validation of dUTP-10-Cy5, Part II 150
xv
7.12 Cy5 nucleotides can be incorporated by Pol I(KF) 151
7.13 Nucleotides with ester-containing linkers can be cleaved 152
xvi
Chapter 1
Introduction
1.1 Background
The ability to isolate and detect the behavior of a single molecule represents the ul
timate limit of spectroscopy. Bulk measurements use ensemble averaging to provide
general insight into the dynamics of complex systems, but important details are often
lost due to subtle sample heterogeneity. The first single molecule detection experi
ments were reported two decades ago in crystals at near absolute zero temperatures
[1, 2, 3]. Since then the field has expanded to include room temperature measure
ments, making it is possible to explore single molecule dynamics of a wide variety of
systems [4, 5, 6, 7, 8, 9, 10].
Among the wide variety of applications for single molecule techniques, single
molecule DNA sequencing has caught the attention of both academia and indus
try [11, 12, 13, 14, 15, 16, 17]. Scientists are interested in using high throughput, low
cost sequencing technology for a wide range of applications including unlocking the
1
CHAPTER 1. INTRODUCTION 2
cancer genome [18], building an atlas of genetic variation for humans, gaining a bet
ter understanding of the immune system and disease susceptibility, gene expression,
and epigenetics. Pharmaceutical companies are interested in the technology for many
of the same reasons, as they believe that this wealth of information will help them
develop better preventions and treatments for disease. As the cost of whole human
genome sequencing and targeted sequencing continues to drop, more individuals will
be inclined and able to learn about their genetic makeup. This will eventually lead
to personalized medicine, which represents a major departure from the traditional
"one-size-fits-all" pharmaceutical model of producing one drug to treat a common
disease in otherwise diverse patients.
Reagent cost has traditionally been a limiting factor for large scale sequencing
projects, but the ability to sequence individual molecules would reduce reagent con
sumption and require smaller initial quantities of precious DNA samples. Further
more, single molecule sequencing potentially offers an unprecedented degree of paral
lelism with millions of DNA templates being interrogated simultaneously. Dephasing
is another important issue that ensemble sequencing approaches have to worry about:
because not every reaction is 100% efficient, some molecules fall out of phase at each
step and contribute spurious signals in subsequent steps. Sample preparation for cur
rent sequencers is also cumbersome and often requires DNA amplification steps to
generate sufficient signal for detection. This point is particularly important as ampli
fication has a tendency to introduce sequence-dependent bias into a sample, whereby
some regions are over-represented compared to others.
The unifying theme of this thesis is the development of new technologies to improve
the throughput single molecule DNA sequencing platforms. However, much of the
CHAPTER 1. INTRODUCTION 3
work can potentially be applied to other areas of biology, nanofabrication, and single
molecule spectroscopy as well. The thesis covers five broad areas: strategic surface
deposition techniques, measuring DNA polymerase kinetics, single molecule colloidal
lensing, surface chemistries for enhanced single molecule signals, and novel nucleotides
for sequencing-by-synthesis.
1.2 Thesis Organization
This thesis is organized as follows. Chapter 2 gives a brief overview of the current
and future single molecule DNA sequencing platforms being developed, along with
some discussion on the advantages and disadvantages of each. The remaining chap
ters describe various technologies designed to improve a particular aspect of single
molecule DNA sequencing.
Chapter 3 provides an in-depth look at the importance of strategic single molecule
surface patterning in high throughput applications. Two new approaches for pattern
ing single molecules on surfaces are presented, both of which offer improved resolvable
densities compared to random deposition. Chapter 4 discusses an approach for the
precision measurement of single DNA polymerase kinetics as a function of template
structure and sequence. DNA replication was followed in real-time through a hair
pin and a a form of sequence-specific pausing was characterized that was previously
thought to exist based on bulk experiments. Heterogeneous cruciform extrusion fol
lowing replication was also observed and the kinetics of this process were measured.
Chapter 5 presents the idea of using high index colloids as lenses to detect single flu-
orophores with long working distance, low NA microscope objectives. Having single
molecule sensitivity with a long working distance enabled high temperature single
CHAPTER 1. INTRODUCTION 4
molecule spectroscopy and the ability to measure the kinetics of a thermophilic DNA
polymerase. Chapter 6 describes preliminary work using thin metal films on surfaces
to improve the signal from nearby single fluorophores detected using through-the-
objective total internal reflection fluorescence microscopy. Single molecule sequencing
platforms often employ DNA polymerases to perform sequencing-by-synthesis reac
tions, and so Chapter 7 gives an overview of solved polymerase crystal structures and
discusses why they are able to incorporate unnatural substrates such as dye-labeled
nucleotides. In this Chapter a novel fluorescently-labeled nucleotide with a longer
and cleavable linker is also characterized. Appendices at the end of thesis provide
examples of some of the code used for image analysis, Monte Carlo simulations, and
finite difference time domain simulations.
1.3 Scientific Contributions
The work described in this thesis represents contributions in several fields. First, I
developed two new scalable approaches for patterning single molecules at densities up
to 6-fold higher than that achievable with random deposition (Chapter 3). This work
has been published [19] and one patent application is pending review [20], while a
second manuscript is in preparation [21] and a second provisional patent application
has been filed [22]. I also measured, for the first time, the intrinsic speed limit of DNA
polymerase by separating sequence-specific pausing from burst synthesis (Chapter 4).
This work has been submitted for publication [23]. Finally, I used colloidal lenses to
enable the first observation of single molecules at high temperature along with the
first real-time single molecule measurement of a thermophilic enzyme (Chapter 5).
This work is in preparation for submission [24].
Chapter 2
Single Molecule DNA Sequencing
2.1 Introduction
In 1977 Fred Sanger and colleagues reported using 2',3'-dideoxy nucleotides as chain
terminating inhibitors of DNA polymerase to perform DNA sequencing [25]. He was
awarded his second Nobel Prize in 1980 for his efforts, a fitting sequel to the Nobel
Prize he won in 1959 for determining the amino acid sequence of the protein insulin.
It wasn't until 1986 that this method was partially automated with fluorescent labels
[26], motivated in large part due to the increasing importance of sequence information
in molecular biology. Further streamlining of Sanger sequencing by Applied Biosys-
tems and Amersham Biosciences (now Life Technologies and General Electric Health
care, respectively) contributed to the release of the first draft of the human genome
in 2001 [27, 28]. Although this sequence was based on DNA from multiple anony
mous individuals, advances in sequencing technology over the last few years have
allowed people to have their own personal genomes sequenced [29, 30, 31, 32, 33].
Next-generation DNA sequencing will continue to accelerate biological research by
5
CHAPTER 2. SINGLE MOLECULE DNA SEQUENCING 6
enabling the routine and widespread analysis of genomes, transcriptomes, and inter-
actomes. Such endeavors used to only be attempted by production-sized teams of
researchers, but now it is possible for individual investigators to achieve this level of
throughput for reasonable cost.
The ability to quickly and rapidly resequence an individual human genome has
generated a lot of interest in both the scientific community and the general public.
The "1000 Genomes Project" is aiming to sequence the genomes of approximately
1200 people from around the world to develop a new map of the human genome. It
should provide a view of biologically relevant DNA variation unmatched by current
resources. This information will help us better understand cancer, genetic variation,
basic human biology, and disease, while setting the foundation for the development
of genome-based therapeutics and medicines. Consumer genetics companies are now
offering to genotype ^500,000 of an individual's single nucleotide polymorphisms
(SNPs) for a few hundred dollars, yet the challenge remains of how to correctly
interpret and act on the information.
Although the first draft of the human genome cost in excess of $100 million, the
personal genomes sequenced in the last few years have cost considerably less, in the
range of $250,000 to $1,000,000 [31, 32, 33]. One individual recently had his genome
sequenced using one of the platforms discussed in the next section for only $42,000. In
order to truly be affordable for the masses, however, further cost reductions are neces
sary. Single molecule DNA sequencing approaches have the potential of achieving the
NHGPJ's goal of a $1000 genome and are currently in various stages of development.
The leading contenders are discussed in the next section.
CHAPTER 2. SINGLE MOLECULE DNA SEQUENCING 7
2.2 Single Molecule D N A Sequencing
The leading proposed and demonstrated single molecule sequencing technologies are
discussed below followed by a comparison of their demonstrated throughput and cost.
2.2.1 Sequencing-by-Synthesis via Stepwise
Base Incorporation
The ability to obtain sequence information from single DNA molecules was first
demonstrated by Stephen Quake's group in 2003 [12]. The approach was simple
in design and elegant in execution. Biotinylated DNA templates of known sequence
were annealed to a Cy3-labeled primer and attached to a streptavidin-coated glass
coverslip. The location of each Cy3-fluorophore, and therefore each primer/template,
was identified using a prism-based total internal reflection microscope. Next, the
Cy3 fluorophores were photobleached. Pol I(KF) and dUTP-Cy3 were then added
to the flowcell and single nucleotide incorporation took place on templates that had
a template adenine immediately adjacent to the primer (Figure 2.1). After washing
away unincorporated nucleotides, dark nucleotides (dATP and dGTP) were added to
extend the primer to the next template adenine or guanosine. The flowcell was again
washed, and dCTP-Cy5 was added and allowed to incorporate. Templates that incor
porated dCTP-Cy5 were identified using FRET between Cy3-Cy5. Cy5 fluorophores
were photobleached and this process was repeated to identify the order of appearance
of A and G in the template sequence.
Helicos Biosciences has since further developed this basic concept to allow for
consecutive identification of all four bases, read lengths over 30 bp, vastly improved
CHAPTER 2. SINGLE MOLECULE DNA SEQUENCING 8
s Color of the illumination
, Incorporation events
-C»3
• C * 5
—?m v$i 3«i m mmwi c « 3 :
) 3 ' •
l I 1
i uu u
Figure 2.1: Sequence information obtained from single DNA molecules with FRET. The intensity trace from a single template is shown as a function of the presented nucleotides in (b), and the FRET efficiency is shown in (c). Adapted from [12].
parallelism, and phred quality scores up to 30 (99.9% accuracy). This platform has
been used to resequence the entire M13 genome [15] and is now available commercially.
The instrument is capable of generating up to 20-30 gigabases of sequence information
per run at a cost of « $14,000 per run. This instrument should help enable the routine
resequencing of human genomes and genomic changes in tumor samples.
2.2.2 Sequencing with Nanopores
Nanopore-based devices are capable of providing single molecule detection by elec-
trophoretically driving molecules in solution through a nano-scale pore [34]. The orig
inal hope for nanopore sequencing involved threading a single stranded DNA molecule
CHAPTER 2. SINGLE MOLECULE DNA SEQUENCING 9
through the Staphylococcus aureus cn-haemolysin membrane protein pore under an ap
plied voltage. The ionic current passing through the pore can be recorded and, ideally,
each base would be serially identified by a characteristic decrease in current ampli
tude [35, 36, 37]. Individual bases can be identified on a static DNA molecule in a
nanopore [38] but the rate of DNA translocation is too fast for the required current
resolution unless the bases are chemically modified [39]. Recent work has focused
on using enzymes to reduce the rate of translocation [40, 41] or on the detection of
individual nucleoside monophosphates [17]. The latter approach might enable single
molecule sequencing by covalently coupling an exonuclease enzyme to the periphery
of the pore; as nucleotides are cleaved off a single strand of DNA, their identity can
be detected as they translocate through the pore. Although nanopore approaches
offer potentially the longest read lengths of all the single molecule methods, scaling
up the technology to sequence many strands in parallel remains a challenge.
2.2.3 Transmission Electron Microscopy for
DNA Sequencing
Directly "imaging" the sequence of DNA using transmission electron microscopy
(TEM) has been proposed by ZS Genetics Inc. [42] and others. The basic idea
is to synthesize DNA complementary to the target sequence using nucleotides labeled
with heavy elements with sufficient nuclear charge (e.g. iodine, bromine, osmium).
The labeled DNA can then be stretched on a substrate and the spatial locations of
the heavy elements can be identified via TEM. The potential for long read lengths
(5000-7000 bp) make this approach an exciting one to keep an eye on in the near
future.
CHAPTER 2. SINGLE MOLECULE DNA SEQUENCING 10
2.2.4 Sequencing-by-Synthesis in Real Time
Many DNA polymerases are naturally highly processive enzymes with the ability to
synthesize hundreds or thousands of bases before dissociation. This has led some
groups to try to monitor DNA synthesis such that as each base is incorporated, its
identity can be read out optically in real-time. This requires that each dNTP is labeled
with a different fluorophore and that the nucleotides are present in solution at high
enough concentration so that synthesis proceeds at a reasonable rate. This can result
in significant background even with reduced excitation volume techniques like total
internal reflection (TIR). To overcome this limitation, zero-mode waveguides (ZMWs)
have been proposed a technology that will allow single molecule sensitivity even in the
presence of nanomolar or even micromolar concentrations of labeled dNTPs [13, 43].
Pacific Biosciences reported using 4>29 polymerase immobilized at the bottom of
ZMWs to sequence a 150 bp template with a raw error rate of 20% [16]. The com
pany places fluorophores on the 7-phosphate of the dNTPs so that incorporation by
polymerase naturally releases the dye. They plan to launch a commercial instrument
in the near future. Major challenges of this technology include improving the raw
error rate, improving the number of ZMWs containing single polymerase molecules,
and developing large and sensitive detectors to enable the monitoring of more ZMWs
simultaneously.
2.2.5 Sequencing-by-Synthesis with Force Spectroscopy
In 2006 Greenleaf and Block [44] demonstrated motion-based single molecule DNA
sequencing using force spectroscopy. A pair of optical traps was used to control
two polystyrene beads: one of the beads was tethered to a single RNA polymerase
CHAPTER 2. SINGLE MOLECULE DNA SEQUENCING 11
molecule while the other was attached to the distal end of a primed DNA template.
As the RNA polymerase underwent transcriptional motion along the template, the
distance between the two beads increased and was measured with single base resolu
tion. Sequencing proceeded by adding a dNTP solution to the chamber with one of
the four dNTPs present at a very low concentration. When the polymerase encoun
tered a template base that was complementary to the limiting dNTP, a pause was
recorded. This process was repeated four times with a different limiting dNTP in
each case. Trajectories for RNAP for each mix were then superimposed and sequence
information was extrapolated on the temporal basis of pause locations.
While this is an interesting approach for single molecule sequencing, a number of
hurdles remain before it can be implemented on a large scale. Polymerase pausing
due to sequence-specific pausing [45] or misincorporation may result in significant
errors. The same template must also be sequenced four times, requiring that the
synthesized strand be melted off and a new primer annealed after each experiment.
Finally, the use of optical traps limits the number of molecules that can be observed
simultaneously to a range of 1-10.
2.3 Progress of Single Molecule Sequencing
Table 2.1 shows some of the key metrics for published single molecule sequencing
approaches. Over the last six years, single molecule DNA sequencing has shown
remarkable progress with over six orders of magnitude improvement in parallelism.
Longer read lengths remain an important area for improvement for all of the methods,
which will be necessary before they can be used for de novo whole genome sequenc
ing. The real-time sequencing approaches ([41] and [16]) currently offer the greatest
CHAPTER 2. SINGLE MOLECULE DNA SEQUENCING 12
Table 2.1: Demonstrated single molecule sequencing metrics. Reference
[12] [44] [15] [16] [41] [46]
Year
2003 2006 2008 2008 2008 2009
Parallelism
100 1
280,000 449
1 500,000,000
Read Length
4 32 30 150 8
33
Throughput
0.5 bp/min 10 bp/min 25 bp/sec 500 bp/sec
2 bp/hr 25,000 bp/sec
Error Rate
4% 6%
0.5% 20% ??% 3.5%
potential for 1000+ bp reads. Chemistry improvements may lead to better raw error
rates, although these approaches make up for it with deep coverage. It will be exciting
to see if the parallelism and throughput of single molecule DNA sequencing platforms
can continue to advance at the current pace in the coming years. In the following
chapters, a number of new technologies are presented that might help further improve
the throughput of some of these platforms.
Chapter 3
High Density Single Molecule
Surface Patterning
3.1 Introduction
With the application of spectroscopy to studies that require the interrogation of many
molecules in parallel, there is growing interest in developing methods for strategically
patterning different molecules on surfaces at small fixed length scales. A number
of approaches have been developed to control the deposition of DNA molecules on
surfaces, including molecular combing by capillary flow [47, 48], casting solutions on
a surface pre-patterned with polydimethylsiloxane (PDMS) [49, 50], spin stretching
[51], and using a PDMS stamp inked with DNA for printing on mica [52]. Ordered
DNA arrays have been generated by drop projection [53, 54], microcontact printing
[55], deposition on surfaces pre-patterned by e-beam lithography [56], and dip-pen
nanolithography [57, 58]. These approaches typically either yield high densities over
small areas or low densities over large areas and are not well suited for single molecule
13
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 14
Figure 3.1: The Rayleigh criterion for two adjacent Airy disks is met when the center of one Airy disk is exactly aligned with the first minimum of the other. At this point, the two molecules are said to just be resolvable.
deposition. Nanopatterning of DNA has been demonstrated on large surfaces of
anodic porous alumina [59] and through the use of micron-sized beads to deposit
nanoscale DNA spots [60], but neither of these approaches has yet been demonstrated
for single molecule deposition. Optical traps have been used to deposit single colloidal
particles in a designed pattern [61] but this approach has not yet scaled to deposit
millions of features in a dense ordered array.
In order to pattern single molecules at the highest possible resolvable density, the
approach employed has to take into account the optical setup and the fluorophore be
ing imaged. The spatial resolution of a diffraction-limited microscope is traditionally
determined by the Rayleigh criterion [62]. The Rayleigh criterion is satisfied when
the center of the Airy disk of one point spread function (PSF) is superimposed on the
first minimum of the other (see Figure 3.1 and Equation 3.1). The diffraction-limited
resolution d,R depends on the numerical aperture (NA) of the microscope objective:
1.22A 2ra sin 9
(3.1)
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 15
where A is the wavelength of collected photons. The NA is a measure of how good
the objective is at collecting light and is defined as NA = nsin#, where n is the
refractive index of the interface and 6 is the half-collection angle. Due to limitations
on the values of 6, A, and n, the resolution limit of a light microscope using visible
light is on the order of RS 250 nm.
Another important consideration for wide-field single molecule imaging has to do
with the digital sampling of an analog signal, as in the case of detecting a collection
of point spread functions on a charge-coupled device (CCD). To address this funda
mental issue, Harold Nyquist developed a theorem in 1928 that states that in order
to reproduce an analog signal, the digital sampling rate must be at least twice the
frequency of the original signal [63]. This means that the detector should sample
each PSF with at least 2.5-3 pixels. The tradeoff of sampling over more pixels is a
decrease in the signal-to-noise per pixel and few PSFs can be detected simultaneously.
The majority of the images described in this chapter were collected with a 60X 1.45
NA objective on a CCD with 85 nm square pixels. For Cy3 fluorophores with peak
emission at A = 570 nm, the diffraction-limited resolution of the optical setup was
d,R = 240 nm, and it is therefore within the sampling limits of the Nyquist criterion.
The imaging throughput of any wide-field single molecule technique can be gen
erally described by Equation 3.2:
bp/sec - 0 f i m a g i n g area\ ( 1 ^ /3 2) \ L Or a r e a J y tmove i ''image /
In this equation 9 is the surface "fill factor", or the number of resolvable single
molecules per diffraction limited region (DLR), imaging area is the physical size of
the field of view, PSF area is the area occupied by a single molecule, tmove is the time
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 16
required to move the stage to a new field, and timage is the time required to take an
image. Any of these parameters can be optimized to improve throughput, and the
stage/image times have already been optimized by to some extent. However, there is
a need for easy, scalable approaches to maximize 6. The theoretical density limit for
this problem is the circle packing density limit whereby « 91% of the surface area
is occupied with resolvable molecules. While achieving this density over large areas
remains the holy grail of single molecule surface patterning, there is still much room
for improvement over simple random deposition. The following sections compare
random single molecule deposition to viable alternatives with improved fill factors.
3.2 Random Molecular Deposition
3.2.1 Nearest-Neighbor Analysis
Random single molecule deposition is typically achieved by incubating a solution of
target molecules over a reactive surface for some time to allow the molecules to bind
at random spatial locations. This is followed by a washing step to remove unbound
species. Molecules are free to bind to the surface wherever there are reactive groups
and the surface density is only limited by the incubation time, the binding affinity,
the target concentration, and possibly molecule-molecule interactions on the surface.
Nearest-neighbor (NN) analysis can be used to describe the distance from a point
to its closest neighbor for a random distribution of points. Consider a point population
of size N randomly situated in a region of area S. The NN distances for the population
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 17
follows a Weibull distribution [64]:
0 t = 0 / ( * , * ) = < (3-3)
2nSte-n5t2 t > 0
where / is the fraction of points with a nearest-neighbor distance t and 5 = N/S
is the point density. Figure 3.2a shows this distribution for a variety of different
S. For simplicity, the diffraction-limited resolution is defined to be at t = 1. Note
that throughout this chapter, equations and parameters will be defined unitless to
maintain broad applicability. The "resolvable density" is therefore given by point
density multiplied by the fraction of points with NN distances > 1, or
rt=oo I
S / /(<$, t)dt = 6 -e-*6*
= Se'wS
t=oo^
t = l
To find the maximum resolvable density, take the derivative with respect to 5:
i-A*'-*6) = s7*(r°)+*-*'
= e-*d(l-n5)
This function goes to zero when 5 = 7r_1, SO the maximum resolvable density occurs
when 8 = 7r_1 = 0.3183. For a surface at this density, the NN distribution can
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 18
therefore be written as:
/(*) = 2te-'2 (3.4)
To find the fraction of points with a NN distance > 1, we have to find the total area
under the curve and the area under the curve to the right of t = 1 (see Figure 3.2b).
/ •OO /-OO
/ f(t)dt = / 2te" Jo Jo
dt
= -€-*
= 1
/
oo />oo
f{t)dt = I 2te
tZdt
oo
= —e
1
This result states that e _ 1 = 0.3679 = 36.8% of the points have NN distances > 1
and that (1 — e_1) = 0.6321 = 63.2% of the points have NN distances < 1. One can
therefore expect that at the ideal density of 5 = n"1, only 9 = (7re)~ = 11.7% of the
available surface area will contain points with the closest NN > 1 unit away.
3.2.2 Monte Carlo Simulation
Monte Carlo simulations were run to confirm the distribution of NN distances for
a random set of points on a surface. Using custom software written in C++ (see
Appendix A for example code), a random XY coordinate was assigned to each of
(a) Weibull distribution for various 6. (b) Weibull distribution for 5 = TT~1.
Figure 3.2: (a) As the point density increases, the distribution shifts towards smaller NN values as intuitively expected, (b) For the 8 = n~l case, only the fraction of the population with t > 1 are resolvable.
N different molecules in a region containing S diffraction limited regions (DLRs)
at a density of 8 = N/S. The distance between each point and every other point
was calculated and points with a NN distance < 1 were flagged as unresolvable. To
eliminate boundary effects, points located within 2 units of any edge were not scored.
Of the remaining points, those with a NN distance > 1 were counted to give m. The
'fill factor" 9 is then defined as the fraction of the available DLRs containing points
with a NN distance > 1, so 9 = m/S. Simulations were run in a 75 x 75 unit area
with a point population ranging from 1 to 10000 at intervals of 100. The values of 9
and 8 were calculated for each simulation and the results are shown in Figure 3.3. A
sample field of view at the peak of from Figure 3.3 is shown in Figure 3.4.
As expected, the simulations show that the relationship between 9 and 8 approx
imates a Weibull distribution. The maximum value of 6 — 0.119 « (7re)~ when 8 =
0.32 « 7T_1, in good agreement with the theoretical predictions. Fitting the Weibull
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 20
0.14
0.12
0.10
0.06
0.04
0.02
0 0.2 0.4 0.6 0.8 1 1.2 1.4 1.6 1.8
6
Figure 3.3: Monte Carlo simulation for random deposition. Blue x's are the result of individual simulations for random deposition at a given 8. The red curve shows is the Weibull distribution fit from Equation 3.5
0 10 20 30 40
Figure 3.4: Monte Carlo simulation of randomly deposited molecules on a surface at a density of 6 = 7r_1. Red colored circles represent unresolvable molecules; green circles are resolvable molecules; white space is wasted space.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 21
equation to this data gives Equation 3.5 which is plotted in red in Figure 3.3.
9RND(S) = Se'*6 (3.5)
With only « 12% of the available surface area containing resolvable molecules, and
nearly twice that containing unresolvable molecules, a random deposition approach
clearly leaves much room for improvement.
3.3 Fitting the PSF
There has been considerable effort spent to devise novel approaches of resolving more
than one molecule per DLR using various super-resolution techniques [65, 66, 67, 68,
69, 70, 71, 72, 73]. Being able to break the diffraction limit would clearly increase the
amount of useable surface area for single molecule arrays, and some of the approaches
are capable of resolving two molecules separated by as few as 10-20nm [68, 73, 72]. The
main drawbacks of these approaches are increased image acquisition and processing
time, and this is discussed in detail in section 3.7. Assuming time isn't an issue,
the potential 6 for being able to resolve up to 2 molecules per DLR was determined
by Monte Carlo simulations. This method was termed "Fitting the PSF" after the
groups who pioneered the idea [70, 68].
3.3.1 Monte Carlo Simulation
An algorithm was implemented in silico to determine the resolvable density improve
ment potentially achievable by fitting the PSF. The Monte Carlo simulations for
random deposition were repeated with a single modification: each point can have at
Figure 3.5: Monte Carlo simulations for fitting the PSF. Blue x's show the fraction of points resolvable without the need for PSF fitting; red circles show the fraction of points only resolvable with PSF fitting, and green circles are the sum of the two.
most one NN with the property 0.03 < t < 1. A lower limit was imposed because two
molecules within «10 nm of each other cannot be resolved even with super-resolution
techniques. For these simulations, two molecules can therefore be resolved within
a single DLR while all other neighbors must be at least 1 unit away. Any DLRs
containing three or more points resulted in all responsible molecules being flagged as
unresolvable. The results of this simulation are shown in Figure 3.5. A least-squares
fit of the points only resolvable with PSF fitting to a Weibull distribution gives:
BP8F{S) = 0.40 (-£-) ' e ( - ( ^ ) 1 0 1 ) (3.6)
D 0.2 0.6 1 1.4 1.8
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 23
The fraction of resolvable molecules as a function of surface density is simply the sum
of equations 3.6 and 3.5:
0RDN+PSF(S) = 6e~*s + 0.40 C^j eH^)1 '"1) (3.7)
With this approach, the optimal "fill factor" improves to 6RDN+PSF ~ 0.27 when
S ~ 0.5. While this is more than double the resolvable density of random deposition,
it would likely be difficult to reliably implement over a large surface area due to the
large image acquisition times.
3.4 Pat terned Nanoparticle Arrays
Instead of using a super-resolution technique to improve the resolvable density, one
obvious alternative is to pre-pattern the surface with small reactive features spaced
out by at least a diffraction limit. Each feature is capable of binding more than one
molecule but single molecules bound to two adjacent features are resolvable. Ordered
arrays for single molecule imaging have been fabricated using e-beam lithography [74],
albeit not at a diffraction-limited pitch. Furthermore, e-beam and cleanroom steps
remain expensive and time consuming to manufacture surfaces in large numbers. In
this section ordered arrays are discussed and a novel method for fabricating a semi-
ordered array without the need for e-beam lithography is presented.
3.4.1 The Poisson Limit
Consider a surface with one small feature capable of specifically binding a molecule of
interest. If there are n molecules each with a probability p of binding, the probability
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 24
of getting exactly k molecules bound follows a binomial distribution:
Pr{K = k) = m^Wpt(1 -"rt (3'8)
The probability of getting exactly 1 molecule (k = 1) is given by equation 3.8:
Pr(K = 1) = np(l - p)"-1 (3.9)
Now consider the case where there are m squares and the probability of binding
p = 1/m. If S(n, m) is the expected number of squares containing exactly 1 molecule,
then:
S{n, m) = mnp{\ - p ) n - 1 (3.10)
Simplifying and taking the natural logarithm:
log(S) = log(n) + (n - 1) log(l - p) (3.11)
Approximating the second term using a Taylor series gives:
log(S) w log(n) - np (3.12)
S = ne-np = ne-n/m (3.13)
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 25
Figure 3.6: Simulated image of a patterned array. Monte Carlo simulation of single molecules deposited on a patterned array at a density of 1 molecule per DLR. White spots are features without a molecule; red spots are features with more than one molecule; and green spots are features with exactly one molecule.
To find the case where S reaches a maximum value for fixed m, take the derivative
of Equation 3.13 with respect to n:
— = e~nP _ —e-nlm
dn m
= e~np(l--) m
The derivative goes to zero when n = m, ie. when the number of deposited molecules
exactly equals the number of features. At this point, Smax = iVe-1. A simulated
surface at this density is shown in Figure 3.6.
The binomial distribution (Equation 3.8) approaches the Poisson distribution as
the number of molecules n is large while p is small. The fraction of squares containing
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 26
0
0.5 1 1.5 2 2.5
Figure 3.7: Monte Carlo simulations of single molecule deposition on a patterned surface. Blue squares show the results of individual trials for various 8. The red curve is a fit to a Poisson distribution.
k molecules is given by:
9[5, k) = 6ke
k\ (3.14)
The fraction of squares containing exactly one molecule is thus given by:
0(6) = Se -S (3.15)
To find the conditions with the highest fraction of squares containing k = 1 one
molecule, take the derivative of Equation 3.15 with respect to 6 and set it equal to
zero: d0 dS
e-s(l - S2) = 0. (3.16)
The only non-negative solution to this equation occurs when 6 = 1. At this point
the fill factor 9array = e_ 1 w 0.37. Monte Carlo simulations were run to confirm
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 27
this result. Points were randomly assigned to integer coordinates on a square array.
Points deposited at different coordinates were resolvable from each other; two or more
points with the same coordinates were unresolvable. The results of this simulation
are shown in Figure 3.7. From this figure it is apparent that 6max « 0.36 at 5 = 1, in
agreement with our theoretical predictions.
3.4.2 Methods
Instead of fabricating an ordered array with e-beam lithography, a novel approach
has been developed that is completely scalable over a large area and involves simple
solution processing. The method involves creating chemically modifiable nanoparticle
arrays, such as Au, AI2O3 or TiC"2 (1-5 nm in diameter), on surfaces with interparticle
distances of « 280 nm.
The ability of blockcopolymers (BCPs) to self-assemble on the nanometer scale
makes them attractive templates for patterning dense nanostructures. BCPs allow
simultaneous control over interparticle spacing and nanoparticle size. Moreover, this
process can be performed on transparent glass substrates compatible with fluores
cence microscopy. The key advantages of this BCP templating method are the low
cost and high throughput of semi-ordered nanoparticle arrays when compared to tra
ditional lithographic patterning techniques. Not only have BCPs been used as a mask
material to form such structures in a subtractive fashion, but the amphiphilic ver
sions are capable of additive patterning by localizing inorganic precursors within their
hydrophilic regions. A variety of metal [75] and metal oxide [76] nanoparticles have
been formed by the latter method. Whereas most BCP patterning studies focus on
highly ordered and dense features, little work has been done studying the low density
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 28
patterning capability of BCPs. To this end, a method was developed for forming thin
micellar films of BCP from solution as templates for ordered gold nanoparticle arrays
with interparticle spacings > 200 nm.
Surface patterning proceeded via spin coating of a block copolymer solution that
was infused with inorganic precursors (HAuCL4, TiCL4, or A1C13). The precursors
selectively load in the cores of the spherical micelles formed by the block copolymers
in solution. The physical dimensions of these micelles cause them to pack in well-
defined geometry on a surface when a solution is spin cast, resulting in each micelle
core having a specific minimum distance with its nearest neighbors. This minimum
spacing is controlled by the molecular weight of the block copolymer, the concen
tration of the block copolymer micelle solution, and the spin speed. Removal of the
polymer matrix from the surface by oxygen plasma cleaning causes the inorganic
precursors in the micelle cores to coalesce and form nanometer sized particles (Au,
TiC>2, AI2O3 respectively) where the micelle cores once stood. The soft pattern gen
erated by self-assembly of the micelle solution on the surface during spin coating is
thereby transferred into a hard pattern consisting of metal or metal-oxide nanoparti-
cles. These particles can then modified to enable attachment of fluorescently labeled
molecules. For Au nanoparticles, a gold-thiol interaction may be employed for direct
attachment; the metal oxide particles can be modified with aminated phosphonic
acids to enable amide coupling reactions.
The following BCPs were purchased from Polymer Source Inc. and used as re
ceived: Poly(styrene-b-2-vinyl pyridine) (PSP2VP)172k-42k, PS-P2VP 464k-24k, and
PS-P4VP 557k-75k. Anhydrous toluene (99.8%) was purchased from Acros Organ-
ics and hydrogen tetrachloroaurate (III) hydrate (99.999%) was purchased from Alfa
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 29
Aesar. BCP solutions were filtered through 25 mm, 0.45 fxm pore Whatman PFPE
with GMF syringe filters. Silicon substrates were cleaved from silicon wafers (Silicon
Quest International) and cleaned by exposure to UV/O3. Stock solutions (4 mg/mL)
of each polymer were prepared by dissolving the solid polymer as received in anhy
drous toluene and stirring with a magnetic stir bar for 1 hour. After being loaded
with HAuCl4, the solutions were diluted to their final concentration for film forma
tion. In a glovebox, solid HAuCU was added in a 0.5 mol ratio (mole Au3+:mole
pyridine units) to each of the solutions. The solutions were stirred with magnetic
stirring until all of the solid was dissolved (usually 1 hour or more). Each solution
was filtered through a 0.45 (xm PTFE filter before use. Films were spin cast in an
N2 environment at 6000 RPM for 40 sec on clean silicon substrates. For nanoparticle
formation, these films were exposed to 0 2 plasma for 5 minutes (50W, 0.4 mbar O2).
Films were characterized by AFM (DI Nanoscope III) and nanoparticle arrays by
SEM (Sirion FEI XL30).
3.4.3 Experimental Results
Micelle films were characterized by measuring the nearest neighbor distances with
AFM (Figure 3.8). BCP solutions from 2 mg/mL down to 0.2 mg/mL gave semi-
ordered micelle films for all three BCPs tested. Above 2 mg/mL, the films tended to
have multilayers and order could not be discerned. Below 0.2 mg/mL, the observed
films were not continuous, and the micelles were no longer well-ordered. Attempts
were made to prevent film breakage by diluting the original BCP solution with 1
mg/mL polystyrene in toluene [77], but order was still degraded at lower BCP con
centrations. The largest interparticle distance shown in literature to date is 170 nm
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 30
Micelles Nanoparticles Nanoparticles
Center'of.sditie Center of sl ide After. UV'O.
Figure 3.8: AFM height images of a BCP (557k-75k PS-P4PV) film loaded with HA11CI4 (0.5 mole ratio) at sequential steps in surface modification. Height scale bars are shown in nanometers and each image is 5 x 5 //m. White areas correspond to micelle cores where HAuCU resides.
[75]; this approach consistently produced micellar films with nearest neighbor dis
tances > 200 nm, although there was some variation from the center of the slide
to the edge. Micelle density was observed to decrease linearly with decreasing BCP
concentration (Figure 3.9). Nanoparticle arrays formed from HAuCL4-loaded BCP
micelle films showed short range order comparable to that seen in the micelle films
by AFM. Nanoparticle diameter varied from 5-15 nm indicating either heterogeneous
loading of the micelles or material ablation during the plasma process. XPS analysis
confirmed that even after exposure to O2 plasma, the nanoparticles were composed
of elemental gold, as other groups have reported previously [78]. These results show
that BCPs with Mw > 200,000 are capable of patterning gold nanoparticle arrays
at distances > 200 nm. A typical particle nearest-neighbor distribution is shown in
Figure 3.10. Here, the mean NN distance is « 280 nm with a standard deviation of ~
Figure 3.9: Micelle density, measured by AFM, was linearly related to the concentration of BCP solution.
15%. There is a performance hit to the fill factor due to the width of this distribution
when compared to an ordered array, as seen in Figure 3.11.
To demonstrate that these nanoparticle arrays can act as substrates for single
molecule deposition, attempts have been made to passivate the region between the
nanoparticles with a low molecular weight PEG-silane and then coupling 5'-thiolated
and 3'-Cy3 labeled DNA through a thiol-gold linkage. There has been some success
with this approach but the single molecule surface densities are still below the theo
retical limit. Further work to optimize the surface passivation and coupling chemistry
is required to achieve the desirable density and single DNA attachment. There have
been recent reports of fabricating regular C6o arrays by fullerene absorption onto gold
dots [79], which is one chemistry attachment scheme that might be explored.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 32
150
v 100
I 50
iTT-y-q-0.2 0.25 0.3 0.35 0.4
NN distance / /xm
0.45 0.5
Figure 3.10: Nearest-neighbor distances for Au nanoparticles deposited via block co-polymer lithography. The mean NN distance is « 280 nm with a = 15%.
Figure 3.11: The fill-factor for semi-ordered arrays depends on the width of the NN distribution. (A) A plot showing the fraction of resolvable particles (left axis) and the particle density per DLR as a function of particle NN distance (right axis). Curves for an ordered array (step function) and a semi-ordered array (sigmoidal function) are shown. (B) The fill factor of a semi-ordered array as a function of mean NN distance, assuming a = 15%.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 33
3.5 Single Molecule Colloidal Epitaxy
The main drawback of pre-patterned arrays is that it is difficult to prevent two
molecules from coupling to the same feature. As seen in Figure 3.6, this results
in a large fraction of the features being unresolvable. If this limitation could be
overcome, the resolvable density of a prepatterned array would approach the circle
packing limit. This motivates a search for a deposition technique with a single rule:
once a molecule is bound to a random location on a surface, somehow prevent any
other molecules from binding within one diffraction limit of that molecule. Colloidal
epitaxy, described in the following section, uses steric hindrance as the means of
prevention.
The basic idea behind the approach is as follows. Colloids with a mean diameter
> the diffraction limit are functionalized with a fluorescently-labeled biomolecule of
interest. The decorated colloids are then self-assembled to form a monolayer on a
surface using the biomolecule as the tether to the surface. Through enzymatic or
chemical cleavage, the colloids are cleaved from the biomolecule to leave behind a
semi-ordered array of single biomolecules. If the length of the tether between the
colloid and the surface is small in comparison to the colloid diameter, this deposition
strategy will theoretically allow every deposited single molecule to be spaced by at
least a colloid diameter and be resolvable. A cartoon outlining the colloidal epitaxy
process is shown in Figure 3.12.
3.5.1 Monte Carlo Simulation
Monte Carlo simulations of single molecule colloidal epitaxy were implemented in
silico by only permitting a molecule to be immobilized if its NN was at least 1
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 34
300nm
(c)
biotin
P 0° 300nm
Figure 3.12: Illustration of single molecule colloidal epitaxy (not to scale). (1) Animated silica beads are coupled to thiolated double-stranded DNA decorated with Cy3 and biotin. (2) The DNA-bead conjugates are tethered to the surface through a biotin-neutravidin binding interaction. (3) Unoccupied neutravidin sites are filled with free biotin and the surface is incubated with a type II restriction enzyme to cleave the double-stranded DNA. (4) The beads are washed from the surface leaving behind an array of single molecules with a minimum pitch approximately equal to the colloid diameter.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 35
diffraction limit away. Instead of using the surface density 6 as the metric that
determines fill factor, here the deposition attempt rate per unit area 6A is used. The
results of this simulation are shown in Figure 3.13. The data from the Monte Carlo
simulations was fit to a Langmuir isotherm giving the following relationship:
™ = i+nes ( 3 J 7 >
This equation gives a fairly good fit for small values of 6A', at larger values the fit
begins to underestimate the simulation predictions. Figure 3.13 shows that at high
6A, the "fill factor" 9epitaxy asymptotically levels off and reaches a maximum of «
0.70. This resolvable density exceeds all other methods by nearly a factor of two
and is approximately six times higher than can be achieved with random deposition.
Colloidal epitaxy is also nearing the hexagonal circle packing fill factor of « 0.907.
A simulated image of molecules deposited with this approach at a surface density of
59% is shown in Figure 3.14b.
3.5.2 Mass Transport Considerations
One can estimate the deposition time for colloidal epitaxy with the rate equation for
the association/dissociation of DNA-colloid constructs, which takes the form
dC ~K7~ = kon\Cs0 — CS)CW — K0ffCs (3.18)
where Cw is the concentration of the colloids in solution at time t, Co is the initial
concentration of colloids before reaction, Cs is the concentration of sites occupied,
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 36
Figure 3.13: Monte Carlo simulation of colloidal epitaxy. The x-axis, deposition attempts per DLR, is plotted on a linear scale (left) and a log scale (right). The blue circles show the simulation data; the red curves are fits using the Langmuir isotherm in equation 3.17.
CSQ is the total concentration of binding sites, and km and k0ff are the rate con
stants for the association/dissociation events with units M_ 1 sec -1 and sec -1. Using
the dimensionless parameters e = Dt/ti2 as the normalized diffusion time with h
as the height of the fluidic chamber and D as the diffusion coefficient of the col
loid, e = Co/Cgo as the relative adsorption capacity of the surface with respect to
the solution, Da = k^Cs^h?/D as the Damkohler number, and Kp = fc0///fconCo
as the dissociation constant with concentrations Cw = CW/CQ and Cs = Cs/Cso, in
dimensionless form is
dr = eDa{9w(l - 6S) - KD9S) (3.19)
Solving this differential equation subject to the initial condition that 6(T = 0) = 0,
and neglecting any time dependence of 6W, gives the solution
0S(T) = 9W + KD (1
-eDa(6w+KD)T ) (3.20)
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 37
0 10 20 30 40 50 0 10 20 30 40 SO
(a) Colloidal epitaxy at 38% surface density, (b) Colloidal epitaxy at 59% surface density.
Figure 3.14: Simulated images of colloidal epitaxy. Monte Carlo simulation of single molecules deposited on a surface via colloidal epitaxy at two different densities. Green spots are resolvable molecules, red spots are unresolvable molecules, and white area is unoccupied space.
Assuming that KD is small for a biotin-streptavidin binding interaction, Equation
3.20 simplifies to
es(r) = 1 - e-eDaewT (3.21)
The kon rate constant for streptavidin binding to biotinylated bovine serum albumin
has been reported to be 1.2 x 105 M~x sec -1 [80]. Since this constant is directly
proportional to the diffusion coefficients of the reacting species, biotin coupled to a
300 nm bead is expected to reduce the rate constant by two orders of magnitude
to « 103 M - 1 sec -1 . Using experimental values, one can then estimate that the
time constant for deposition in Equation 3.21 is 3 x 10~6 sec -1. This is in reasonable
agreement with our experimental observations of 38% coverage after 40 hrs of binding.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 38
3.5.3 Methods
Double stranded DNA was coupled to 300 nm and 640 nm aminated silica colloids
(Corpuscular) as described elsewhere [81] with stoichiometrics experimentally deter
mined such that the average number of DNA molecules per colloid was near unity
(Figure 3.12a). The DNA sequence was designed to contain a Cy3 fluorophore, a
BsaH I restriction site, a 5'-biotin, and a 3'-thiol (Integrated DNA Technologies, se
quences 5'-Bio-CGC TCT ATC CTC CCT CCA TTC CAA CCA GAC GCC ACC
BsaH . .-5 ' - 2 B i o - CGCTCTATCCTCXCTX:aVTTCCAACCAGftEGCCACCCTC*GTCATTTGTA
C y 3 - GCGAGATAGGAGGGAGGTAAGGTTGGTCTG3KTGGGAGTCAGTAAACAT - 5
4 31 bp >
Figure 3.15: Restriction enzyme cleavage sites for colloidal epitaxy. Shown are the Hgal and BsaHI recognition sites (highlighted in green) and the restriction enzyme cut sites (vertical black lines).
steric interactions between the enzyme and the surface, thereby preventing activity.
Remarkably, a spatial difference of one helical turn (10 bp) was enough space for
cleavage with BsaHI.
Micron-sized colloids were capable of forming much more ordered arrays than
smaller colloids, as evidenced by the regular pattern in the power spectrum (Fig
ure 3.17b). Sub-micron sized colloids were capable of higher densities but less order
(Figure 3.17d,f). Figure 3.18 shows brightfield, SEM, and TIRF images of colloidal
epitaxy using 300 nm silica colloids pre- and post-enzymatic cleavage. Restriction en
zyme treatment and washing was > 90% successful at removing the tethered colloids.
Control experiments with non-biotinylated or non-thiolated DNA showed little non
specific binding and DNA without Cy3 showed no sign of fluorescence. Images were
processed using a custom script in MATLAB (see Appendix B) and single molecules
were identified based on their fluorescent intensities and observing step-wise photo-
bleaching in their trajectories. Figure 3.18a shows histograms of nearest-neighbor
distances for Cy3 labeled DNA patterned with two colloid sizes, 300 nm and 640 nm,
with peaks at 346 nm (a — 48 nm), and 641 nm (a = 101 nm), respectively. The
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 41
Figure 3.16: Restriction enzymes are sensitive to colloid proximity. Gel A, lane 1-dsDNA alone; lane 2- Cy3-ssDNA; lane 3- dsDNA coated beads treated with Hgal; lane 4- untreated dsDNA coated beads; lane 5- dsDNA treated with Hgal; lane 6-LIZ120 size standard. Gel B, lane 1- supernatant after coupling dsDNA to beads; lane 2- supernatant from first wash; lane 3- supernatant from second wash, lane 4-supernatant from third wash; lane 5- supernatant from fourth wash; lane 6- dsDNA coated beads treated with BsaHI; lane 7- untreated dsDNA beads; lane 8- LIZ120 size standard.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 42
Figure 3.17: Brightfield images and power spectrum of colloidal epitaxy prepared surfaces. Colloid sizes are: (A,B) 2 //m, (C,D) 640 nm, and (E,F) 300 nm.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 43
Figure 3.18: Colloidal epitaxy experimental results, (a) Bright field image of 300 nm beads immobilized on a neutravidin-coated glass coverslip through a biotinylated DNA tether. The image was taken in air after the colloid solution was removed with the surface still slightly wet. Drying was avoided primarily over concern that it would have undesirable effects on the DNA tether, (b) Scanning electron microscope image of 300 nm colloids tethered to the surface, (c) Bright field image of the surface following restriction enzymatic cleavage of the DNA tether and extensive washing, (d) Total internal reflection fluorescence image of Cy3-labeled DNA patterned on the surface after colloid removal. Scale bars are the same as in (a).
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 44
(a) 6
9 4
u c ai
<v
(b)
0.2 0.4 0.6 0.8 1 distance (urn)
§ 20
a*
o ft 10
.Q
£ 3
n rf n - i
density (features / urn2)
Figure 3.19: (a) Nearest-neighbor intensity histogram for fluorophores deposited via colloidal epitaxy with 300 nm colloids (white) and 640 nm colloids (grey). The cen-troid of each single molecule feature was identified with single pixel precision and the linear distance to the next nearest feature was calculated in pixels. Pixel distances were then converted to nanometers based on known pixel dimensions, (b) Histogram of single molecule densities produced by 300 nm colloidal epitaxy observed in different fields of view over a 1 mm2 area.
average feature density of a 1 mm2 field of view is shown in Figure 3.18b. The mean
experimental density was found to be 4.2 [xm~2 (a = 0.3 /xm~2), giving a fill factor
6S « 0.38. Colloidal epitaxy thus allows for over a three fold improvement over ran
dom deposition but the density is slightly lower than the 9.9 /zm-2 our simulations
predicted possible.
The colloid constructs were observed to form quasi-hexagonal islands on the sur
face in the SEM images (Figure 3.18b) and, to a lesser extent, in the fluorescence
images (Figure 3.18d). The presence of these islands in both wet and dry states sug
gests that the colloids are likely forming these structures during convective assembly.
This may be due to favorable colloid-colloid interactions during deposition or the non
uniform surface patterning of neutravidin, a phenomenon that has been previously
observed. In an attempt to improve deposition rates and densities, magnetic colloids
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 45
were used in conjunction with a weak magnetic field but there was limited success.
Colloids tended to either stack in multilayers or be held against the surface in random
orientations that did not favor binding, resulting in only a small fraction of colloids
remaining tethered to the surface.
3.6 Future Work for Colloidal Epitaxy
Colloidal epitaxy has demonstrated achieving « 38% surface coverage in practice,
but there is still much room for improvement in this approach. Longer incubation
times (up to one week) may further improve the surface density. Applications of
colloidal epitaxy may also be explored to pattern surfaces for many different single
molecule studies. For example, DNA fragments with appropriate sticky ends may be
ligated to the overhang created by the restriction digest for high throughput sequenc
ing [12], SNP genotyping, or enzymatic assays. Instead of using a restriction enzyme
to remove the beads, the DNA tether could also be broken through heat, chemical
treatment, or activation of a photocleavable or chemical-labile linker. This approach
is also not limited to depositing DNA on a surface: any molecule that can be hetero-
functionalized with a reversible linker may be deposited, including small molecules,
proteins, antibodies, viruses, or nanoparticles. Colloidal epitaxy relies on cheap and
easily accessible reagents and does not require any expensive instruments, and the
minimum spacing between molecules can easily be controlled by changing the colloid
diameter. This gain in throughput may be of benefit to any study where many single
molecules need to be interrogated in a massively parallel fashion.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 46
3.7 Super-Resolution: Breaking the Diffraction Limit
There have been efforts to surpass the optical resolution limit using near-field scan
ning optical microscopy (NSOM) [83, 84], apertureless near-field scanning optical
microscopy [85], local enhancement using bowtie nano-antennas [86], structured illu
mination [65, 66], stimulated emission-depletion [67], and by fitting the point spread
function [68, 69, 70]. There are also two similar techniques called photo-activated
localization microscopy (PALM) [71, 72] and stochastic optical reconstruction mi
croscopy (STORM) [73] that improve spatial resolution by taking advantage of the
abundance of temporal resolution. Each of the aforementioned approaches is capable
of resolving more than one molecule within a single diffraction limited region (DLR),
although this is typically at the cost of increased image collection time and/or image
processing time.
Monte Carlo simulations were run to see if super resolution techniques could of
fer an advantage over standard microscopy techniques for imaging large-area single
molecule arrays. These simulations modeled a simple PALM/STORM imaging ses
sion where only a stochastic subset of the total fluorophores in a field of view are
excited and imaged during each imaging cycle. By cycling many times, virtually all
of the molecules can be switched on at least once to allow for the reconstruction of a
super-resolution image.
Figure 3.20 shows the fraction of molecules resolvable vs. cycle number for four
surfaces at different molecular densities. The simulations assume a microscope diffrac
tion limit of 250 nm, a super-resolution limit of 20 nm, and a probability p that any
given molecule be switched on during each cycle. There appears to be an important
trade-off between working at higher densities and the number of excitation/imaging
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 47
100 200 300 400 500 600 700 800
B ^ ^
r
— w
,
_
100 200 300 400 500 600 700 800
o c o V* u
r ^ ~ ^ ^
»-«,
•
•
100 200 300 400 500 600 700 800
. . . . .
fT V p = 5% p = 2% p=1% p = 0.5%
•
100 200 300 400 500 600 700 800
excitation/imaging cycle
Figure 3.20: Super-resolution Monte Carlo simulations. The fraction of molecules resolvable vs. cycle number for surfaces at four different densities (molecules per diffraction limited region) of (A) TT"1 = 0.32, (B) 0.20, (C) 0.10, (D) 0.01. Curves for different values of p are shown.
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 48
cycles required to image all (> 99%) of the molecules on a surface. Being able to
finely tune the fraction of molecules that switch on during each excitation cycle is
also important for optimization.
For the ideal density of 7r_1 = 0.32 molecules per super-resolution diffraction
limited region, over 800 cycles are required to image all of the molecules. For a
sub-optimal density (0.10) as few as 400 cycles are required. In this case, cutting
the number of cycles in half reduces the number of resolvable molecules by less than
half, which suggests that working at a sub-optimal density would likely give the
highest throughput. The requirement that > 99% of the molecules are imaged after
each dNTP incorporation necessitates more cycles than would typically be needed for
standard PALM/STORM image reconstruction. For example, if each cycle takes 0.1
sec, a surface with a density of 0.10 (318 molecules//um2) could have a throughput of
5 molecules/(/im2 sec). This assumes that the stage is capable of repeatedly returning
to the same position with a high degree of accuracy.
Table 3.1 illustrates how throughput scales with image acquisition and stage
move times. Here it becomes clear that a super-resolution approach will only offer a
throughput advantage if the imaging time is faster than stage moving time. Currently
image and stage moving times are around 100 msec, meaning that super-resolution
techniques would have to be able to excite, image, and switch off fluorophores in
10-50 msec to offer any real advantage. Signal/noise is probably the main limitation
on imaging speed right now. Imaging time improvements might be had in developing
brighter fluorophores, tweaking the fluor's local environment to maximize the absorp
tion cross section and quantum yield (solvent polarity, viscosity, metal enhancement,
CHAPTER 3. SINGLE MOLECULE SURFACE PATTERNING 49
Table 3.1: Theoretical throughput (molecules/(/Ltm2 sec)) of a super-resolution approach with an effective resolution of 20 nm. The image acquisition time (timg) and stage move time (£mow)are shown in seconds. These calculations assume randomly deposited single molecule arrays at five different surface densities (32% to 1%). For comparison, the throughput of a standard diffraction-limited microscope is shown in the right-most column.
Table 3.2: Summary of the parameters that govern the total bandwidth of single molecule imaging. We assume a diffraction limit of 250 nm except for the super-resolution approaches, where we estimate a diffraction limit of 20 nm. 9 is the maximum obtainable "fill factor".
Method
Circle packing Colloidal epitaxy Ordered arrays
Semi-ordered arrays Random deposition
Super-resolution
PSFarea(f,m2)
TT(0.125)2
TT(0.125)2
TT(0.125)2
TT(0.125)2
TT(0.125)2
TT(O.OIO)2
9
|TT\/3 « 0.907 « 0.6-0.7
e-1 « 0.368 w0.21
(Tre)"1 « 0.117 (Tre)"1 » 0.117
Hmage \SGC)
0.1 0.1 0.1 0.1 0.1 120
''move V.S6CJ
0.1 0.1 0.1 0.1 0.1 0.1
temperature), further reducing the excitation volume to minimize scattering, and de
veloping faster, more sensitive detectors. In summary, super-resolution techniques
therefore offer slightly lower imaging bandwidth with the additional requirements of
accurate stage movement and post-acquisition image processing.
3.8 Throughput Comparison
Table 3.2 shows the key parameters that govern the bandwidth for each of these
methods. Here, 9 represents the maximum obtainable "fill factor" as determined
above by theory or Monte Carlo simulation. With this data, Equation 3.2 was used
to calculate the imaging bandwidth for each method. A summary of the imaging
bandwidths of these approaches is shown in Figure 3.21. The benefits of shrinking
the size of the PSF using super-resolution techniques are comparatively lost due to the
lengthy imaging times required. Ordered arrays that have higher fill factors and short
imaging times currently offer higher bandwidths, but if super-resolution techniques
can reduce the required imaging times, they may eventually surpass them. Overall,
Figure 3.21: Bandwidth comparison of single molecule deposition methods. The imaging bandwidth of each method was calculated using Equation 3.2 and the parameters shown in Table 3.2.
colloidal epitaxy is currently far and above the fastest and easiest approach with a
throughput nearing that of circle packing.
Chapter 4
A Single Molecule Measurement of
the "Speed Limit" of DNA
Polymerase
4.1 Introduction
Fast and accurate DNA replication is required to ensure the faithful transfer of genetic
information to daughter cells. A number of endogenous and exogenous factors can
threaten genome integrity by obstructing the progression, stability, and restart of
replication forks during cell division. Although most paused forks are stable and
capable of resuming DNA synthesis, some pause sites are thought to be hotspots for
misinsertion, deletion, and recombination. Replication forks can be slowed or paused
Figure 4.1: Sequence of the primer and template used for single base incorporation experiments. The primer contained an internal Alexa647 fluorophore to act as a FRET acceptor for the single base incorporation of a Cy3-labeled FRET donor (dCTP).
polymerase kinetics, and none of them have been performed with single base resolu
tion. As a first step, real-time single nucleotide incorporation events were observed
on surface-immobilized templates.
4.2.1 Methods and Results
Synthetic oligonucleotides were obtained from Integrated DNA Techologies and the
primer-template sequences used in the first set of experiments are shown in Figure
4.1. The primer contained an internal Alexa647 fluorophore so that immediately
upon Cy3-dCTP incorporation, excitation of Cy3 results in FRET to Alexa647 and
a corresponding increase in emission at 647 nm.
Bulk experiments were first performed to verify that the system works as planned.
. Primer and template were annealed in IX PBS (1 fjM final DNA concentration) and
Cy3-dCTP was added to a final concentration of 100 nM. When excited at 532 nm,
the emission spectra of 50 ixL of this solution was monitored in a spectrophotometer
before and after the addition of 5 units of Pol I(KF) (New England Biolabs) (Figure
4.2). Before the addition of polymerase, there was a large emission peak at « 570
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 55
600
500
400
3
16 -̂ £• 300 'l/l c <v 4-»
.- 200
100
0
500 550 600 650 700 750
wavelength / nm
Figure 4.2: Single nucleotide incorporation experiment monitored in a bulk experiment. A solution containing annealed primer/template and Cy3-dCTP was excited at 532 nm before (blue) and after (red) addition of Pol I(KF).
nm corresponding to the direct excitation and emission from Cy3. Five minutes after
polymerase addition, however, the 570 nm peak dropped significantly in intensity and
a new peak at 650 nm appeared. As expected, incorporation of Cy3-dCTP against
the template guanosine placed the two fluorophores in close proximity and resulted
in efficient FRET.
The biotinylated DNA duplex was immobilized and imaged on neutravidin-coated
coverslips as described in Chapter 5. A split-field microimager (Photometries) was
placed in the detection path with a 610 nm dichroic mirror to split the emission
light into Cy3 / Alexa647 channels. Template locations were identified by excitation
with a 633 nm laser (Meshtel) while blocking the Cy3 emission channel. Pol I(KF),
Cy3-dCTP (GE Healthcare), and oxygen scavenging solution [70] were added to the
flowcell and images were acquired at 2 Hz on a Photometries Cascade II EM-CCD.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 56
Figure 4.3: Sample split-field image of Cy3/Alexa647 single primer/templates. The left half shows Cy3 emission; the right half shows Alexa647 emission.
Cy3 excitation was achieved with a 532 nm laser (Meshtel) and the fluorescence emis
sion from both channels was monitored simultaneously (Figure 4.3). Single molecule
trajectories were analyzed using custom software written in MATLAB (for example
code, see Appendix).
A sample single molecule trajectory showing real-time single nucleotide incorpo
ration is shown in Figure 4.4. The red trace shows the intensity of a molecule in the
Alexa647 (FRET acceptor) channel; the green trace shows the intensity of that same
molecule in the Cy3 (FRET donor) channel. At time « 30 sec, there was a sudden
increase in FRET signal which indicated the incorporation of a Cy3-dCTP nucleotide.
A few seconds later, the Alexa647 fluorophore photobleached, resulting in a recovery
of Cy3 signal at the same position in the Cy3 channel. The anti-correlation of the
Alexa647 signal going off and the Cy3 signal going is strong evidence that these two
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 57
3000
2500
. 2000
| 1500
I 1000 c.
500
0
-500 0 20 40 60 80 100
time / sec
Figure 4.4: Sample two-color trajectory showing real-time single nucleotide incorporation by Pol I(KF). The red trace shows the integrated intensity of a feature in the Alexa647 channel; the green trace shows the corresponding intensity in the Cy3 channel.
fluorophores were coming from the same template.
While this shows that real-time single nucleotide incorporations can be detected,
the approach suffers from a few drawbacks. First, it requires a high concentration of
Cy3-dCTP nucleotides in solution. Even with TIRF excitation, this inevitably results
in a high background in both channels and makes detecting individual molecules diffi
cult. Second, and more importantly, it is impossible to actually measure a processive
synthesis rate with only a single nucleotide incorporation.
To address the latter of these two issues, another template sequence was designed
to first incorporate a Cy3-labeled dUTP, then six dark nucleotides, followed by an
Alexa647-labeled nucleotide (Figure 4.5). Under 532 nm laser excitation, one would
expect to see a signal come on in the Cy3 channel when the first nucleotide is in
corporated, and then some time later the Cy3 fluor would undergo FRET when the
Figure 4.5: "Race track" template for polymerase kinetics with modified nucleotides. Cy3-dUTP is first incorporated, followed by six dark nucleotides, and Alexa647-dCTP. The time difference between these two events (t2 —1\) gives the time required by the polymerase to incorporate six dark and one labeled nucleotides.
Alexa647-labeled nucleotide is incorporated. The length of time between Cy3 signal
going on (ti) and Alexa647 signal going on (i2) would be a direct measurement of the
time required to incorporate the six dark nucleotides and Alexa647-dCTP. Similar
to the previous experiments, the primer/templates shown in Figure 4.5 were immo
bilized on a neutravidin-coated coverslip. Movies were taken as before following the
addition of Pol I(KF), # 2 buffer, oxygen scavenger, and 100 nM fluorescently-labeled
dNTPs.
Initial attempts to do this experiment with two labeled nucleotides in solution
were met with significant obstacles. The main problem stemmed from the use of the
split-field microimager as it was impossible to obtain a high enough FRET signal due
to the high background fluorescence in the donor channel. Removing the microimager
and imaging just the Alexa647 channel showed numerous incorporation events (Figure
4.6, but without the microimager the start times could not be calibrated. Running
this type of experiment at lower nucleotide concentrations (10-30 nM) has been done
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 59
=i IB
>* ns
c
1000
800
600
200
-200
-400
0 50 tOO 150 200 250 300 0 50 100 150 200 250 300
time /sec
Figure 4.6: Sample single-color single molecule FRET trajectory showing real-time nucleotide incorporation using the template shown in Figure 4.5. This trajectory was detected in the Alexa647 channel without a microimager present. Generation of FRET signal can be interpreted as Alexa647-dCTP being incorporated into a primer that already contained Cy3-dCTP.
with some success (Braslavsky et al, unpublished data), but the resulting kinetic
rates are not physiological. The Km of Pol I(KF) is on the order of 5 /xM [106]
so rates obtained at low dNTP concentrations are likely possible but are slow and
uninteresting.
Due to these issues, there was a need to design a new assay to measure real
time single molecule DNA polymerase kinetics. Ideally the assay would operate at
saturating concentrations of dNTPs, without the need for fluorescent nucleotides in
solution, and without the need to use force spectroscopy to apply tension to the
enzyme or template.
4.3 Strand Displacement Synthesis Through a DNA
Hairpin
In order to investigate what role sequence and secondary structure have in strand-
displacement synthesis rates, a FRET-based approach was developed to study single
polymerase molecules replicating through a DNA hairpin of known sequence. This
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 60
assay allowed for the measurement of polymerase activity in real-time with near sin
gle base resolution without the need to apply tension to the DNA molecule, which
has been shown to affect polymerase behavior [98, 99, 100]. Furthermore, with this
method the polymerase incorporates natural nucleotide triphosphates and does not
require fluorescently-labeled nucleotide analogs in solution, thereby enabling the mea
surement of the polymerase kinetics at saturating nucleotide concentrations.
4.3.1 Hairpin Design
A 259 nucleotide (nt) single-stranded DNA molecule was designed and synthesized
containing an internal double-stranded 33 base pair (bp) hairpin flanked by 94 nt
single-stranded tails, one of which had a 3'-biotin group (Figure 4.9A). The 3' base of
the hairpin contained an internal Cy3 FRET donor and the 5' base contained an in
ternal non-fluorescent FRET acceptor (Black Hole Quencher-2, BHQ-2) so that when
the hairpin was fully folded, quenching of Cy3 by BHQ-2 prevented any fluorescence
emission (Figure 4.9B). The length of the hairpin was chosen to make full use of the
dynamic range for this FRET pair: when the last base pair of the hairpin was broken
due to strand displacement replication, the distance between fluorophores was just
over twice the Forster radius (R0 = 5.02 nm, 33 bp of dsDNA =11.2 nm).
The effect of moving the position of the Cy3 fluorophore away from the base of the
hairpin stem was examined (Figure 4.7A). As the fluorophore was moved from position
-1 to -3 to -5, the quenched fluorescence of the folded hairpin increased (Figure 4.7B.
After primer extension, Cy3 emission increased for all positions (Figure 4.7B, but to
different levels. The reason for this discrepancy is unknown but it may be due to dye-
dye orientation differences. It is therefore fruitful to examine the relative improvement
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 61
5' S T ? *CTCTGCTGCGCCATCCGCGGTCTATACGCTAGGTT
T
jJfciGAGACGACGCGGTAGGCGCCAGATATGCGATCC T T
+15 +30
IK 500 540 580 620 660 700 500 550
wavelength / nm
600 650 700 750
Figure 4.7: The internal Cy3 position influenced the FRET efficiency. (A) Three different positions were examined for the Cy3 fluorophore at the -1 , -3, and -5 template positions. (B) Residual fluorescence of the fully quenched hairpin and the fully extended primer were measured in bulk on a spectrophotometer via excitation at 532 nm. (C) The relative fold improvement between pre- and post- extension was calculated for each fluorophore position.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 62
in Cy3 recovery by normalizing to the original quenched fluorescence level (Figure
4.7C. Here the greatest enhancement factors are seen with the fmorophore in closest
initial proximity to BHQ-2. Therefore for the following experiments, templates with
Cy3 in the -1 position were used to minimize the residual fluorescence and maximize
the difference between the pre- and post- extension states.
Olig
o A
B
B'
Z
C
C
D
Y
Tab
le 4
.1:
DN
A o
ligon
ucle
otid
e se
quen
ces
for
hair
pin
ligat
ion.
Sequ
ence
5'-Phos-TCA TAG CCA GAT GCC CAG AGA TTA GAG CGC ATG ACA AGT AAA
GGA CGG TT-3'-Biotin
5'-P
hos-
CG
G A
TG
GC
G C
AG
CA
G A
G[iC
y3]C
AG
T T
CA
GT
C C
CA
CC
G A
CG
TT
T
GG
T C
AG
TT
-3'
5'-Phos-AGG ATC TTA CCA GAG AC/ iCy3/C AGT TCA GTC CCA CCG ACG TTT
surface quality) were RCA cleaned and a plastic hybriwell (Grace Biolabs) was placed
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 65
Figure 4.8: Gel purification of the ligated hairpin. The ligation reactions were gel purified on a 15% TBE urea polyacrylamide gel run at 60°C for 1 hour at 174V. Red staining indicates SYBR-Green, blue indicates Cy3, and green indicates the LIZ-500 size standard. (A) Lanes 1-7 show 0.5 /JL, 1.0 yuL, 2 /xL, 4 //L, and 8 fjL of ligation reaction products. Lanes 8-11 are the products of a ligation reaction missing oligo C. Lane 12 contains the LIZ-500 size standard. (B) The top band on gel (A) corresponding to the 259 nt product was cut out and purified as described in the text. Lanes 1-2 contain 0.5 fiL of the purified product loaded on to a gel to assess purity and yield. Lane 3 contains the LIZ-500 size standard.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 66
BHQ-2
Cy3
B 5' s T
_ACTCTGCTGCGCCATCCGCGGTCTATACGCTAGGT TT
^^GAGACGACGCGGTAGGCGCCAGATATGCGATCC T T
• 6 _ A C
G +1 +15 +30 3' T , GC 5 GC 5 §£ Tj. f BHQ-2
r51 , ^^iTCT^lGflHATCCHGGTCTATlCH^GG7 T 5' 3'
I^UU
. 1000 Z3
£ 800 >* OT 600 CD
c 400
200
n
c
'/^* '
*
•
'
5 10 15 20 25 30
position / bp
GACPAG.
35 #0x3
35
D 30
£-25
"c 20 .O % 15 o tt10
?CCHGGTCTAT|CJHAI LGGHCCAGATA|G^BT< ITCC T ,
a ^
200 400 600 800 1000 1200
intensity / a.u.
Figure 4.9: FRET can be used to identify the real-time position of single DNA polymerase molecules. (A) Cartoon of the DNA template used to measure real-time polymerase kinetics. Primed 259 nt DNA molecules containing internal 33-bp hairpins and flanking 94 bp tails were immobilized on a glass surface through a biotin-streptavidin linker. DNA replication through the hairpin resulted in a reduction in FRET efficiency between Cy3 and BHQ-2, giving rise to an increase in Cy3 fluorescence. (B) Sequence and structure of the two DNA templates used in these experiments. The pink boxes highlight the differences in sequence between the sample (top) and the control (bottom) hairpins. Sequence numbering refers to the template position awaiting nucleotide addition. (C) Cy3 fluorescence recovery data for the primer extension calibration experiments is shown in red. The position along the x-axis refers to the polymerase position along the template, the blue curve is the least-squares fit, and the dashed lines are 95% confidence intervals. The error bars on the data points are the standard error of the mean. (D) Intensity-to-position curve based on (C) to convert an arbitrary intensity to a template position. Each rectangle represents the 95% confidence interval for the expected intensity at each polymerase position along the template.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 67
on the surface to create a fluidic chamber. The surface was incubated with 0.2 mg/mL
biotinylated-BSA in IX PBS for 20 minutes, washed extensively with IX PBS, and
then incubated with 0.5 mg/mL neutravidin in IX PBS for 20 minutes. Purified
DNA hairpin was annealed with a 5' biotinylated primer (oligo Z) as described above,
diluted to 10 pM in IX PBS, and incubated on the neutravidin surface for 20 minutes.
Surfaces were imaged on an inverted Nikon TE2000S microscope with a 60X 1.45
NA PlanApo TIR objective, a low-fluorescence immersion oil (n = 1.515), and an
automated XY stage (Mad City Labs). A Nikon TIRF attachment in conjunction
with a 532 nm diode-pumped sold-state laser (Meshtel) and a custom laser-launch
system (Thor Labs) was used for illumination. A Cy3 filter set (HQ535/50, Q565LP,
HQ610/75, Chroma) and a Photometries Cascade II EMCCD were used for filtering
and image acquisition, respectively.
Immediately prior to enzyme addition, surfaces were imaged to ensure the hairpin
was properly folded as evidenced by few or no Cy3 molecules detected in the field
of view. For the FRET calibration experiments, an enzyme mixture consisting of
IX polymerase # 2 reaction buffer (New England Biolabs), 100 /xM of dATP, dTTP,
dCTP, 10 units of DNA polymerase (Klenow exo~, New England Biolabs), 0.1 mg/ml
glucose oxidase, 0.2 mg/mL catalase, 10% w/w glucose, and 1 mM Trolox was flowed
into the chamber. After 5 minutes of incubation at room temperature, the surface was
washed extensively with IX PBS and 20 different fields of view were quickly imaged to
minimize photobleaching. Fluorescent intensities represented a polymerase position
at -6 bp with respect to the hairpin (ie. the polymerase active site is 6 bp away from
the first bp of the hairpin stem, see Figure 4.9). This process was repeated with the
dNTP mixes shown in Table 4.2 to partially extend the primer to a series of known
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 68
Table 4.2: Nucleotide combinations used for stepping through the hairpin.
and 1 mM Trolox was flowed into the chamber. Images were immediately acquired
every 200 msec for approximately 20 minutes. Freshly prepared 1 M betaine was
added to the above mixture for the betaine experiments. For the temperature ex
periments, a commercial flow cell with internal heating elements (CFCS2, Bioptechs)
was used in conjunction with an external temperature controller to hold the sample
temperature at 37°C. Reaction mixtures were pre-heated to 37°C prior to addition.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 69
5' S
position: -6
500 1000
position:+21
1500
*CTCTGCTGCGCCATCCGCGGTCTATACGCTAGGTTT "ZACIGAGACGACGCGGTAGGCGCCAGATATGCGATCC T ™
G 3' T GC GC GC TA
+1 +15 +30
position: -2 position:+13
0 500 1000 1500
position: +28
0 500 1000 1500
position: +30
500 1000 1500 0 500 1000 1500 0
intensity/a.u.
500 1000 1500
position:+17
0 500 1000 1500
position: full extension
0.2
0.1
J11IL 0 400 800 1200 1600
Figure 4.10: Partially extended primers permit FRET distance calibration. (Top) Primed DNA hairpins were partially extended to known positions on the template by adding polymerase and only three of the four dNTPs. Template stop positions (highlighted in red) refer to the adjacent position awaiting nucleotide addition. The dNTP sets and the corresponding stop positions are shown in Table 4.2. (Bottom) Each set of intensities was fit to a Gaussian distribution to determine the mean intensities and the s.e.m. for the FRET calibration curve.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 70
Image analysis
Custom software was written in MATLAB to automatically identify and track the
XY coordinates of single molecules using a previously published particle tracking
algorithm [107]. A 3x3 pixel grid surrounding each molecule was integrated and the
5x5 pixel perimeter was used to calculate the background. Raw and smoothed net
intensity counts for each trajectory were then plotted and manually analyzed. Steps
were identified and distinguished from gradual non-stepped growth using a custom
step-fitting algorithm [108]. This algorithm generates 'S-values' which are a measure
for the quality of a step-fit for a given number of steps over an entire trajectory, and
the maximum value of S should correspond to the best fit. For noisy trajectories,
step trains containing a slight excess of steps were chosen to ensure that all true steps
were included. Some trajectories like were scored as having multiple distinct pauses
using this algorithm. A few others showing slow extension were not scored because
there was no clear maximum S value; any S chosen yielded steps that were within
the RMS noise. Dwell times were calculated as the time between steps. Synthesis
rates were calculated by measuring the trajectory slope between the mean intensities
of two consecutive pauses or a pause and full extension.
4.3.4 Discussion and Results
In order to correlate the FRET signal with template position, a series of primer ex
tension experiments were done by adding DNA polymerase and only three of the four
deoxynucleotide triphosphates (dNTPs). After the first extension step, the flow cell
was thoroughly washed to remove any unincorporated nucleotides, and the process
was repeated multiple times with a different set of three dNTPs (see Methods section
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 71
above). This enabled primer extension to known positions on the template and al
lowed for the observation of the corresponding reduction in FRET signal as the donor
and acceptor were forced apart. Before extension began, the distance R between the
two dyes was small and the FRET efficiency was calculated as
EFRET = TTogF (41)
As the primer was extended and the hairpin unwound, R increased and EFRET de
creased, leading to recovery of Cy3 signal. The observed Cy3 intensity was thus given
by
Icvs = IMAX ( 1 - ( , , / J L V 3 ) 1 (4.2) 1
}+T£Y where IMAX was the maximum Cy3 intensity achievable when the dyes were as far
apart as possible (assuming 0.34 nm per base pair, the maximum dsDNA separation
was 2 x 33 bp + 5 bp loop = 71 bp « 24 nm). A weighted least-squares fit of the data
to Equation 4.2 gave IMAX — 987 and R0 = 15.3 bp « 5.2 nm, which is consistent with
the vendor's reported Forster radius for Cy3 and BHQ-2. There was some width to
the distributions of Cy3 intensities at each position which may be due to dephasing,
signal to noise variation, or Cy3-BHQ-2 orientation effects (Figure 4.10). However,
by performing this alignment procedure on an ensemble of records at each position,
a calibration curve was generated to relate the observed fluorescent intensity and the
polymerase position along the template (Figure 4.9C). Using this calibration curve
and its 95% confidence limits, an algorithm was developed to convert any arbitrary
fluorescent intensity into a corresponding polymerase location along the template
(Figure 4.9D).
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 72
Using an unconventional FRET configuration comprised of a non-fluorescent quencher
instead of a traditional fluorescent acceptor offers a number of key advantages. First,
there is no need to monitor two emission wavelengths simultaneously. This reduces
both the number of optical elements in the detection path and the background fluo
rescence, thereby improving signal-to-noise and spatial precision. In a single detector
setup, this also allows one to monitor twice as many molecules and generate twice
as much data per experiment compared to a donor/acceptor split-field setup. Using
a quencher also greatly simplifies the data analysis: there is no need to track and
correlate features between two movies because the net intensity of each feature can
be directly converted into a FRET efficiency (Figure 4.9D).
The real-time kinetics of DNA replication was examined in the presence of all
four dNTPs with two different DNA polymerases: the Klenow fragment of DNA
Polymerase I (exo-) from Escherichia coli (Pol I(KF)) and the replicative polymerase
from the Bacillus subtilis bacteriophage 029. The trajectories for both polymerases
exhibited heterogeneous behaviors that could be classified into four categories: fast
replication without pausing (Figure 4.11A), fast replication with a single pause (Fig
ure 4.1 IB), fast replication with multiple pauses (Figure 4.11C), and slow replication
(Figure 4.1 ID). Slow replication occurred in only a small portion of the traces and
while its origin is unclear, it could stem from the template sticking to the surface or
unfavorable polymerase-surface interactions. Approximately two thirds of the DNA
polymerases extended the entire template without a pause, while about a third of
the polymerases paused at least once. The pauses occurred at highly stereotyped
positions and we took advantage of the single molecule approach to measure both the
distribution between pausing and non-pausing enzymes and the relationship between
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 73
the pauses and the burst synthesis speeds of the polymerase. This data that would
be impossible to obtain with conventional bulk techniques.
One potential drawback of this approach is that blinking fiuorophores may in
correctly be interpreted as real extension events. If a Cy3-Cy5 FRET pair were
used this would certainly be a concern as Cy5 is known to exhibit frequent blinking
[109, 110]. In this FRET system a false positive extension could be caused by one
of two events: either BHQ-2's quenching ability switches off before extension begins
or a dark Cy3 fluorophore switches on after extension has finished. BHQ-2 blinking
was not significantly observed while imaging folded hairpins in the absence of poly
merase or dNTPs, is not thought to occur by the vendor, and has not been reported
in the literature. Dark Cy3 fiuorophores can make up 12% of a population and have
a dark-state lifetime of «2 sec; the on-blink and off-blink rates are 0.36 and 0.26
times per molecule over 120 sec, respectively [111]. Given the infrequent blinking and
short off times of Cy3, the probability of it being off during any real replication event
is very low. It is therefore not surprising that only 1% of the trajectories exhibited
identifiable blinking after full extension (signal going from on to off and then back
to on). Importantly, for the kinetics experiments intermediate intensity pauses were
observed in approximately 50% of the trajectories, a phenomenon that cannot be
produced by fluorophore blinking. The calibration experiments (Figure 4.9C) with
polymerases stalled on the template did not show any significant deviation from the
expected FRET behavior, so protein-induced quenching is not thought to be a sig
nificant source of error. Taken together, the majority of the signals are believed to
be due to reductions in the Cy3-BHQ-2 FRET efficiency and not blinking or protein
quenching.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 74
1200
800
400
Pol I: 44% ^29 :51%
CO
to c CD
in 50 100 150
Pol I: 2% <p29: 4%
1200
800
400
Pol I: 6% ^29: 7%
150
Pol I: 22% ^29:15%
150
Pol I: 2% <p29: 1%
50 100 150 50 100 150 time / s
50 100 150
Figure 4.11: DNA replication exhibited heterogenous pausing. Single molecule trajectories of extension through the hairpin exhibited four distinct patterns. Molecules exhibited rapid extension without pausing (A), rapid extension with a single pause (B), rapid extension with multiple pauses (C), and slow extension (D) prior to photo-bleaching. A significant fraction of the trajectories showed full extension followed by a single step (E) or multiple step (F) decreases in Cy3 intensity before photobleaching. The grey curves are the raw data, the blue curves are the smoothed data over 5 raw data time points, and the red steps are generated by a custom step-fitting algorithm (see Methods section). The percentages show the fraction of all trajectories for each polymerase that demonstrated that particular pattern at 23°C.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 75
The positional accuracy of individual trajectories depended on both template
location and signal-to-noise, with a maximum attainable resolution of «2 bp. For
example, a well-behaved trajectory that paused with a mean intensity of 562 ± 47
a.u. (s.d.) was called at +15 or +16 bp; a noisier trajectory that paused with a mean
intensity of 447 ± 168 a.u. (s.d.) was called at +14 ± 2 bp. By aligning an ensemble
of trajectories for Pol I(KF) and 029, polymerase pause positions were localized with
near single base accuracy over the template from +8 bp to +18 bp (Figure 4.12A
and B). Outside of this window the overlapping confidence limits of the calibration
curve prevented pause localization accuracy better than ± 3 bp. For Pol I(KF), over
85% of the pauses were located between +13 and +17 bp, a region that is GC-rich
and includes a Pyr-G-C motif at +16 bp. Similarly, over 82% of the 029 pauses were
located between +14 and +18 bp. Pyr-G-C motifs at +8 bp and +26 bp showed
weak pausing for Pol I(KF) and no pausing for 029, but the identification accuracy
of pause events is lower at those locations.
A significant reduction in the frequency of pausing was observed for both enzymes
with the addition of 1 M betaine to the reaction mixture (Figure 4.12A and B).
Betaine is a zwitteronic osmoprotectant that is thought to alter DNA stability such
that GC-rich regions melt at AT-rich temperatures [112], a finding that has led to
its inclusion in PCR formulations for improved amplification of difficult templates
[113, 114]. Betaine has also been used in bulk studies to suppress replication pausing
at certain Pyr-G-C sequences [101], suggesting that these motifs within the hairpin
might cause the pauses.
Increasing the temperature of the Pol I(KF) reaction from 23°C to 37°C also
reduced the frequency of pausing significantly, which is in agreement with previous
Figure 4.12: Pause frequency as a function of polymerase position. Pause frequency was sequence dependent and was suppressed with betaine or elevated temperature. The mean intensity of each pause was mapped to the template sequence and normalized to the frequency of pausing for the given conditions. (A) and (C) show Pol I(KF) data for sample and control sequences; (B) and (D) show the data for 029.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 77
bulk studies by Mytelka et al. [101]. These authors suggested that pauses at Pyr-G-C
sequences might be caused by difficulties in the polymerase fingers-closing conforma
tional change, as at the time this transition was thought to be rate-limiting and the
most sensitive to changes in temperature. However, a recent report [115] showed that
the slow prechemistry step is likely not the fingers-closing transition, raising the pos
sibility that these pauses are associated with an earlier DNA template rearrangement
step that might be sequence dependent.
In order to verify that the observed pausing was sequence dependent and not
due to the hairpin secondary structure, a control DNA molecule was constructed
with the same overall structure and length as the original (Figure 4.9B, top) but
with a different stem sequence (Figure 4.9B, bottom). The control sequence removed
all three occurrences of the Py-G-C motif while maintaining as much similarity to
the original sequence as possible. Importantly, only two bases were changed in the
region where most pausing was found to occur: 5'-TAGGCGCCA-3' was changed
to 5'-TAGGATCCA-3'. Both polymerases showed over a 5-fold reduction in pause
frequency with the control sequence compared to the original sequence (Figure 4.12C
and D). This result confirmed that the secondary structure of the hairpin was not
playing a role in the observed pausing. It also suggested that the central 5'-CG-3'
motif, either by itself or in the context of the surrounding sequence, was responsible
for the pause efficiency. The distribution of pause lifetimes was consistent with single-
step Poisson statistics. At 23°C Pol I(KF) exhibited a mean pause lifetime of 14.5
sec for the sample template (Figure 4.14A). In the reduced population of trajectories
that showed pausing even with the addition of betaine or heat, a 40% decrease in
the mean pause lifetime was observed (Figure 4.14B-C). A similar reduction in pause
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 78
0.25 C <u 3 O" 0.2 <U
<4—
T3 °-15
<D N
^ 0-1
0.05
t_
0.25
0.15
0.05
p. B
— i
iln 8 10 12 0 2 4 6
S/N
8 10 12
Figure 4.13: Histograms of S/N ratios for (A) trajectories during a pause and (B) after full extension. Over 100 individual trajectories were analyzed and the mean S/N ratio for each one was calculated by taking the net signal and dividing it by the RMS noise (standard deviation of the signal). The mean values were calculated to be 2.6 for pause intensities and 5.6 for full intensities.
lifetime was observed for Pol I(KF) acting on the control template (Figure 4.14D).
The mean pause lifetimes for 029 with the sample template were less than for Pol
I(KF) (Figure 4.14E), and a reduction in lifetimes was not observed with betaine
addition (Figure 4F) or on the control sequence (Figure 4.14G). Short time period
pauses are likely undersampled due to limitations on our sampling bandwidth and
signal to noise, which results in some of the pause lifetime distributions to have a
distinct rise and decay. The pause intensities had a mean signal to noise ratio of 2.6
while the full extension intensities had a mean signal to noise ratio of 5.6 (Figure 4.13).
Pause frequencies and lifetimes are impossible to obtain through ensemble studies and
this knowledge may help constrain the biophysical models of the polymerase kinetic
pathway.
The pauses observed in this study are clearly distinct from those observed in pre
vious single molecule DNA polymerase experiments. T7 and Pol I(KF) polymerases
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 79
N O
50%
40%
30%
20%
10%
0%
, / \
7=14.5 s
0 25 50 0 25 50 0 25 50
0 25 50 0 25 50
pause time / s
Figure 4.14: Pause lifetimes for Pol I(KF) and 029 were measured under different conditions for the sample and control sequences. The red curves are normalized single exponential fits given by / = exp(—t/r), where r is the mean pause lifetime. (A) Pol I(KF) at 23°C with the sample template; (B) Pol I(KF) at 23°C with 1 M betaine with the sample template; (C) Pol I(KF) at 37°C with the sample template, (D) Pol I(KF) at 23°C with the control template, (E) 029 at 23°C with the sample template, (F) 029 at 23°C with 1 M betaine with the sample template, and (G) 029 at 23°C with the control template.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 80
have been shown to exhibit long pauses of heterogeneous length under template ten
sion [98, 99]. These pauses were thought to be due to fluctuating hairpins, exogenous
DNA hybridization, or template damage. The entire T7 replisome was also shown
to halt leading-strand synthesis due to primase activity on the lagging strand [103].
Similar experiments with the E. coli replisome identified a relationship between pause
times and core polymerase concentration, suggesting that pauses can be caused by
enzyme dissociation events [104]. A recent study on real-time DNA sequencing with
single 029 polymerase molecules identified pause sites that corresponded to regions
with predicted template secondary structure [16]. However, these experiments were
performed with a rate-limiting dNTP concentration which complicates the discovery
of novel pause sites. Here 029 and Pol I(KF) are shown to be susceptible to sequence-
dependent pausing at saturating dNTP concentrations and the pauses are known not
due to template secondary structure.
DNA synthesis is therefore a combination of high activity rapid synthesis that
reflects the intrinsic "speed limit" of DNA polymerase with low activity pauses; these
single molecule measurements enable us to separate these contributions and measure
their kinetics. DNA synthesis burst rates were calculated by measuring the slopes of
the trajectories between pauses (Figure 4.15A inset). The mean rates for Pol I(KF)
at 23°C without (Figure 4.15A) and with betaine (Figure 4.15B) were similar at 16
± 14 nt/s (s.d.) and 24 ± 20 bp/s (s.d.) respectively. Pol I(KF) had a higher mean
replication rate of 25 ± 20 nt/s (s.d.) at 37°C (Figure 4.15C). Although synthesis
rates are dependent on template sequence, temperature, and buffer conditions, the
rates measuredg are 2-3 fold faster than the only other Pol I(KF) single molecule
measurement in the literature [98], a low tension force spectroscopy study that did
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 81
not have sufficient time resolution to separate pauses from bursts. Assuming that
Pyr-G-C pause sites occur once every 32 base pairs in a random template and given
that the pause motif is 25% efficient, one would expect the net synthesis rate over long
templates to be RS6 nt/s, a rate that is comparable to the previous single molecule
measurement. A recent bulk study of Pol I(KF) reported a strand displacement
synthesis rate over an 18 bp template of 1.2 nt/s [116], but this template contained
three Pyr-G-C pause motifs. Based on the results of our single molecule experiments,
Pol I(KF) would likely have 1.1 sec of synthesis time and (14.5 sec) (26%) (3) = 11.3
sec of pause time over this template, giving an estimated ensemble rate of 1.5 nt/s,
in good agreement with the bulk study. For 029 at 23°C, a wide distribution of
synthesis burst rates were observed ranging from a few nt/s up to 150 nt/s with a
mean rate of 48 ± 32 nt/s (s.d.) (Figure 4.15D). These results are consistent with
reported 029 bulk rates of 38 nt/s at a higher temperature (30°C) that likely included
pausing events [117]. This assay is only limited by its integration time in being able
to measure very fast rates. For example, a 100 nt/sec synthesis event detected at 10
Hz should provide at least three frames of variable intensity.
For Pol I(KF) molecules that paused, the mean replication rate over the template
sequence up until the pause site was 11 ± 1 nt/s (s.e.m.); after the pause site, the
mean rate increased to 18 ± 2 nt/s. Similar to Pol I(KF), 029 molecules that paused
underwent faster replication after arrest (41 ± 3 nt/s (s.e.m.)) than before (24 ±
4 nt/s (s.e.m.)). Accelerating synthesis rates were also observed in trajectories that
did not pause (Figure 4.16). The small difference in rates before and after pausing
may be due to the transition near the end of the hairpin from strand displacement
replication to displacement-free replication. It could also be an artifact related to the
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 82
T3 O
"(5 £
50 100 150
30%
25%
20% j
15%
10%
5%
0% ..
c
-
Tltoi 50 100 150 0
rate / bp/s
Figure 4.15: "Speed limit" replication rates for Pol I(KF) and 029 were measured for single DNA polymerase molecules under different conditions. For trajectories that paused, only data in the intervals between pauses was analyzed; for trajectories that did not pause, data over the entire interval was analyzed. Rates were determined by calculating the average intensities at the start and finish of active replication through the hairpin, converting the intensities to polymerase positions, and then calculating the slope (A, inset). The normalized distribution of rates are shown for (A) Pol I(KF) at 23°C, (B) Pol I(KF) with 1 M betaine at 23°C, (C) Pol I(KF) at 37°C, and (D) 029 at 23°C.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 83
presence of the fluorophore in the template.
4.4 The Energy Landscape and Kinetics of
Hairpin Refolding
Surprisingly, approximately 25% of all complete extensions did not exhibit single
step photobleaching from the peak intensity; instead, either a single step decrease
to a lower intensity (Figure 4. HE) or multiple step decreases (Figure 4.1 IF) were
observed prior to loss of signal. The newly-synthesized double-stranded DNA con
tained an inverted repeat so this may have been due to the stepwise refolding of two
complementary hairpins to form a cruciform structure. The average refolding pause
time was measured to be 7.4 sec with an average intensity of 380 ± 26 a.u. (s.d.)
(Figure 4.17). A previous study measuring Holliday junction branch migration re
ported an average dwell time of 9.7 sec between steps for four different sequences [119].
This is in reasonably good agreement with these measurements, especially given that
photobleaching may systematically reduce the measured dwell times.
The presence of betaine drastically reduced the frequency and duration of pauses
during refolding, which suggests that they arose due to difficulties in melting GC
base pairs. To explore this idea, the theoretical energy landscape of the FRET-
observable refolding transition was calculated using mfold (Figure 4.18) [118]. The
average refolding pause intensity corresponded with a DNA structure containing two
28 bp hairpins (Figure 4.19A); further hairpin growth required overcoming an energy
barrier and breaking additional GC base pairs in the non-hairpin strands. This cal
culation is based on work by Karymov et al. [120] who reported that when Cy3/Cy5
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 84
•<p29
Pol l(KF) 23C
Pol l(KF) 37C
Poll(KF)23C + betaine
(^29 + betaine
Pol l(KF) 23C control sec
0.2 0.4 0.6 0.8 1
time /s
1.2 1.4 1.6
Figure 4.16: Average trajectories for polymerase molecules that did not pause. Trajectory data was interpolated with a cubic spline on a 20X finer mesh to further improve the time resolution. For each experimental condition, over 100 of these interpolated trajectories were sampled to produce the "average" trajectories above. Sampling was done by first identifying the start and finish times for each trajectory during which replication was observable. Each time interval was then divided equally into eight subintervals and the intensity at each time point was recorded. The time and intensity values for each of these subintervals were then averaged to produce the corresponding "average" trajectory.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 85
10 20 30 pause time / s
200 400 600 800 1000 intensity /a.u.
Figure 4.17: Histograms of pause durations and intensities locations during hairpin refolding. The bins were normalized based on the frequency of refolding for all trajectories that reached a fully extended state. (A) Refolding pause times in the absence or presence of 1 M betaine. The red curve is a normalized single exponential fit given by / = e - t / r , where r is the mean pause lifetime. (B) Average intensities of pauses during refolding with and without betaine. The average intensity was measured to be 380 ± 26 a.u.
are separated across a Holliday junction by 10 bp or 12 bp, the FRET efficiencies
are 73% or 54%, respectively. Given that the Forster radius of Cy3/Cy5 is 5.3 nm,
these distances across the Holliday junction work out to be 4.5 nm and 5.2 nm. The
mean refolding intensity for Cy3/BHQ2 was 380 a.u. which corresponds to a FRET
efficiency of 60%. Integrated DNA Technologies reported that the Forster radius of
this pair is 5.02 nm. Using these numbers, the distance between the Cy3/BHQ2 was
calculated to be «4.7 nm, which is more consistent with 10 bp of separation than 12
bp assuming 2 bp steps. The presence of GC-rich sequences at the base of the stem
are consistent with this conclusion, suggesting that most of the refolding pauses are
due to cruciforms trapped in this energy well. Note that the geometry of the system
is significantly different in the absence of DNA polymerase and in the presence of an
extruded cruciform and the construct does not have the same 2 bp spatial resolution
Figure 4.18: The observable energy landscape of cruciform structural transitions. The Gibbs free energies for every hairpin length and the corresponding intermediates were calculated using mfold [118]. The hairpins of integer length have fully paired nucleotides; the hairpins with non-integer lengths contain 4 unpaired nucleotides in the cruciform center (e.g. Figure 4.17B). The structures of the labeled intermediates (A-G) are given in Figure 4.19.
J i i i i i i i i
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 87
in this configuration.
Cruciform extrusion has been well studied and there are considerable kinetic bar
riers that need to be surpassed for it to occur (31), so it is perhaps surprising how
often it was observed immediately following replication. Additional study is required
to identify what factors are facilitating extrusion; one possible explanation is that
DNA polymerase exerts sufficient torsional stress on the template to reduce the en
ergy barrier for extrusion to occur.
4.5 Future work
The real-time single molecule observation of Pol I(KF) revealed that the polymerase's
intrinsic "speed limit" is 2-3 fold faster than reported by previous single molecule
measurements. Replication can be interrupted by heterogeneous sequence-dependent
pauses that are independent of template secondary structure, and knowledge of these
pause frequencies and lifetimes would otherwise be impossible to obtain from ensem
ble studies. The pauses were highly localized to a short GC-rich sequence motif and
were relieved with the addition of heat or betaine, suggesting that they may be asso
ciated with a structural template rearrangement step during the polymerase reaction
pathway. Future single molecule experiments should help fully elucidate the mecha
nism of DNA polymerase sequence-dependent pausing and provide insight into how
other endogenous and exogenous factors act to slow or stall replication forks.
CHAPTER 4. THE "SPEED LIMIT" OF DNA POLYMERASE 88
Figure 4.19: Structure of the DNA cruciform intermediates as shown with mfold. The Gibbs free energy of each structure is shown in Figure 4.18. Structure (A) is the suspected intermediate responsible for the majority of pausing during hairpin refolding.
Chapter 5
High Tempera ture Single Molecule
Imaging with Colloidal Lenses
5.1 Introduction
Although single molecule fluorescence spectroscopy was first demonstrated at liquid
helium temperatures (1.8 K) [2, 3], the field has since grown to include wide-field
room temperature observations [121] largely due to advances in brighter fluorophores,
better objectives, and more sensitive detectors. This has opened the door for many
chemical and biological systems to be studied at native temperatures at the single
molecule level both in vitro [7, 4, 5] and in vivo [10, 8, 9]. However, systems and
phenomena that operate at temperatures above 37°C remain difficult to study at the
single molecule level due to the index matching fluid requirements of most commercial
high NA objective lenses. These fluids act as a thermal conductor between the sample
and the objective and sustained exposure to high temperature can cause the objective
to fail. This has prevented the single molecule study of thermophilic organisms, the
89
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 90
interactions of their protein repertoire, and the temperature dependent unfolding
kinetics of nucleic acids and proteins. This is one reason why there are no published
reports of single molecule fluorescence detection at high temperature. The challenge is
to develop an optical technique that is capable of detecting single fluorescent molecules
with high collection efficiency while operating at a long working distance without an
index matching fluid.
Wenger et al. [122] recently demonstrated that a latex microsphere in conjunction
with a low numerical aperture objective lens can be used for fluorescence-correlation
spectroscopy with near-single molecule sensitivity. Previous work in the field demon
strated the ability of hemispherical solid immersion lenses [123] and spherical colloidal
lenses to construct a rotational sensor [124], to create an optomagnetic dimmer [125],
to generate two-dimensional micropatterns [126, 127] and nanopatterns [128], and to
optically couple one dimensional arrays of colloidal particles [129, 130]. An efficient
nanolens system based on gold nanospheres was also shown to exhibit a strong electro
magnetic surface-enhanced Raman scattering (SERS) enhancement [131]. However,
none of the aforementioned techniques achieved true single molecule sensitivity. In
this chapter, high index of refraction micron-sized colloidal lenses are shown to be
capable of achieving single molecule sensitivity by incorporating a focusing element
in immediate proximity to an emitting molecule or nanoparticle; the optical system is
completed by a low numerical aperture optic which can have a long working distance
and an air interface. The colloid acts as a lens and dramatically improves the photon
collection efficiency of the optical system. To demonstrate the potential applications
of colloidal lenses in single molecule spectroscopy, 2.0 //m Ti0 2 colloids were used with
with a 20X 0.5 NA air objective to image single quantum dot nanoparticles at 23°C,
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 91
single DNA and protein molecules at 23°C and 70°C, and the real-time dynamics of
mesophilic and thermophilic DNA polymerases at 23°C and 70°C, respectively.
5.2 Theory of Colloidal Lensing
5.2.1 Geometric Optics
Geometric optics arguments can be used to estimate how much a micron-sized col
loidal lens increases the amount of light collected from a point source. The configu
ration is illustrated in Figure 5.1 A and has been previously described for the lensing
of a smaller fluorescent microshere [124]. For configurations where the radius of the
colloidal lens is much greater than the distance S from the lens to the photon source,
as is the case for a micron-sized lens and a nanometer-sized chemical linker, the light
ray exit angle from the colloidal lens is given by [124]:
<f/-e" = 2wr1 (— one) -e (5.1)
where n2 is the index of refraction of the colloid, rix is the index of refraction of the
environment, 9 is the angle of incidence, and </>' — 6" is the exit angle. Equation
5.1 is shown with ni = 1.33 for a variety of different values of n2 in Figure 5.IB.
By selecting spherical colloids composed of a very high index of refraction material,
such as amorphous Ti0 2 (n2 ~ 2.0), the absolute value of the exit angle given by
Equation 5.1 in water (ri\ = 1.33) is always less than 25° even for very large angles
of incidence. If 0o is the semi-aperture of the external microscope objective, any exit
ray with 0' — 6" < 0o should therefore be collected. Based on this argument, TiC>2
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 92
colloidal lenses can therefore improve the effective numerical aperture of a low NA
air objective (0.5 NA, 60 = 30°) to NA e / / = (2.0) sin(84°) = 1.99. Higher values of 9
likely cause the light to undergo total internal reflection within the colloid resulting
in some losses.
5.2.2 Maxwell's Equations
Maxwell's Equations describe the interactions of electric (B) and magnetic (H) fields
with one another and with matter and sources. They can be solved analytically for
simple systems but generally requite a numerical solution. The equations for the
evolution of the fields are:
~ = - V x E - J B - ( 7 B B (5.2)
^ = V x H - J - ^ D (5.3)
B = txK (5.4)
D = eE (5.5)
where D is the displacement field, e is the dielectric constant, J is the current density,
JB is the magnetic charge current density, B is the magnetic flux density, pi is the
magnetic permeability, and H is the magnetic field.
Solving Maxwell's Equations for the colloidal lensing system should give a more
accurate prediction for how the system actually behaves. In order to approximate
the solutions to these equations numerically, a finite difference time domain (FDTD)
method was used. FDTD methods divide space and time into a finite rectangular
grid and evolve the equations over time. In the colloidal lensing system, the aim is to
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 93
Figure 5.1: Colloids can be used as lenses for quantum dot nanoparticles and single fluorophores. (A) Light ray tracing of photons emitted from a nearby single fluo-rophore undergoing lensing through a colloid. The diagram defines the angles 9, 9', 9", 4>, $ and the distances r and 5 as previously described [124]. (B) A plot showing the ray exit angle ((f>'-9") vs. the emission angle from the fluorophore (9). The dashed horizontal lines define the ray collection limits for a 0.5 NA objective. Increasing the index of the colloid (n2) improves the light collection efficiency. (C) Scanning electron microscopy image of a single 2.0 (im T i0 2 colloid confirms they are spherical in shape. Scale bar = 1 [im. (D) 3D simulation of a point source (free space A0 = 570 nm) in close proximity to a 2.0 lira spherical dielectric (n2 = 2.0) in an aqueous environment (n! = 1.33). The E2 fields are shown in blue/red in the z = 0 plane.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 94
calculate the power transmitted by a point source at frequency u through the colloid.
This can be written as the integral of the Poynting vector over a plane on the far side
of the colloid:
P(u) = Rn- [E^X)* x H„(x)d2x (5.6)
In order to make sense of a transmission spectrum it should be be normalized and
compared to something else. Simulations were therefore run typically run once with
the colloid present and once with the colloid absent. Each dataset was then normalized
to the total power emitted by the dipole during the same time interval. This was
accomplished by setting up 6 flux planes that completely surrounded the dipole and
summing the total power passing through them all.
5.2.3 FDTD Simulation Methods
Finite difference time domain simulations were performed using a freely available
software package (Meep, http://ab-initio.mit.edu/wiki/index.php/Meep) on an 8-core
server with 16GB of RAM running Debian Linux 2.6. A three dimensional region of
space 13 /im x 13 /im x 13 /zm was discretized so that the mesh size was A = Ao/20 or
smaller to ensure accuracy for near-field effects. The medium was assigned an index
n\ = 1.33 with perfectly-matched layers as boundary conditions to absorb all waves
incident on them, with no reflections. A dielectric sphere of index ri2 and radius
r was placed at the origin and a dipole emitter was positioned a distance S away
from the sphere along the positive y-axis. The dipole was oriented perpendicular to
the x-y plane and began emitting as a continuous Gaussian source centered at the
wavelength A0 with width 0.05Ao. Square flux planes in the x-z plane were positioned
at y = -2.75 fj,m and varied in size according to the collection angle of the objective
being modeled. For example, an objective with a half-collection angle of 60° focused
at the dipole location would have a light collection cone radius of (tan(60°)2.75 fim)
= 4.76 fim at this y-position, so its flux plane was modeled with dimensions of 9.5
//m x 9.5 pLm. Half-collection angles ranging from 1° to 65° were included for all of
the calculations. Simulations were run for at least 50 periods or to the point where
running for additional periods did not change the calculated power through the flux
plane, whichever was longer. Each of the key parameters of the system (AOJ r, ni,
8) was systematically varied to determine the how it affects the calculated power.
Sample Meep code is provided in Appendix C.
5.2.4 FDTD Simulation Results
Simulations were performed with the FDTD method to confirm the geometric optics
predictions and to explore how key parameters of the system affect the collection
efficiency [132]. A point source was positioned next to a spherical colloid and the
total power P{u>) transmitted through a plane on the opposite side of the lens was
calculated (Figure 5.ID). Different plane dimensions were chosen to represent the
semi-aperture light collection of 14 different microscope objectives (1° < 0o < 65°).
While keeping all other parameters constant, simulations were run to determine how
changing 8 affects P (Figure 5.2A). For 8 < 0.1 mm the simulations predicted that
a colloidal lens-aided 0.5 NA air objective (0O = 30°) has at least the same effective
NA as a 1.4 NA oil immersion objective (0O = 65°). This is in good agreement with
the geometric predictions. When the point source was placed very near to the surface
(8 < 10 nm), the colloid was actually able to focus more than 50% of the total power
emitted. This may be due to the colloid being able to support a higher mode density.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 96
The relationship between the index n-i of the colloid and P is shown in Figure
5.2B. High index colloids provide the greatest relative enhancement for objectives with
small semi-apertures, also in agreement with geometric predictions. For example, the
collection efficiency of a n2 = 2.4 colloidal lens-aided 0.3 NA air objective is improved
nearly 8-fold compared to using the objective alone. Even high NA objectives see a
modest 2-fold improvement with the use of n^ — 1.6-1.8 colloids. The radius of the
colloid r plays a critical role on the detected power: for a A0 = 570 nm point source,
only colloids with r > 750 nm showed any appreciable enhancement for 0o > 20° (Fig.
5.2C). The calculated P for different A0 is shown in Figure 5.2D. The presence of the
2.0 [xm colloid gave similar enhancement profiles for A0 = 400 nm and 500 nm, but
the power slightly decreased for shorter or longer wavelengths.
5.3 Single Quantum Dots as Rotational Probes
To test the photon collecting limits of high index colloidal lenses, they were first
coupled to single quantum dot nanoparticles. This coupling process is governed by
Poisson statistics and the concentration of each species can be manipulated so that the
majority of colloidal lenses contain no more than one quantum dot. Carboxylated
titania colloids (2.0 /mi, Corpuscular Inc.) were washed three times in IX MES
buffer (Pierce) and activated with 1 mg/mL EDC and Sulfo-NHS in IX MES for 45
minutes. The colloids were then washed with 100 mM carbonate buffer, pH 8, and
covalently coupled to aminated quantum dots (Qdot 525 ITK amino, Invitrogen) with
stoichiometry such that the majority of colloids had zero quantum dots and only a
fraction had a single dot.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 97
10 20 30 40 50 60 0 10 20 30 40 50 60
D ^ ^ =
/
300 nm
10 20 30 40 50 60 0 10 20 30 40 50 60
collection angle/0
Figure 5.2: 3D finite difference time domain simulations were performed containing a single dipole emitter in an aqueous environment (ni = 1.33) while varying key parameters of the system. Unless otherwise specified, the point source was positioned at y = 0.010 /im (0,0.010,0) and had a free space A0 = 570 nm; the lens had an index ni = 2.0, was centered at (0,-1,0), and had a radius of r = 1.0 /im. The integrated power at the plane y = -2.75 was calculated and used to estimate the amount of light collected by an objective focused at the origin. The size of the plane was varied to model objectives with different semi-apertures. Each dataset was normalized to the total power emitted from the dipole. (A) The point source was moved a distanced 8 away from the surface of the colloid along the positive y-axis. (B) The refractive index of the lens was varied from n2 = 1.33 to 2.40. (C) The radius of the lens was varied from r = 0.010 jttm to r = 1.25 /xrn while keeping the center of the lens at (0,—r, 0). (D) The free space wavelength of the point source was varied from A0 = 450 nm to 700 nm.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 98
Imaging was performed by placing a quantum dot colloid solution on the surface
a 3-aminopropyltriethoxysilane (APTES, Sigma) coated glass coverslip, covering it
with a second coverslip, and sealing the edges with nail polish to prevent evaporation
or fluid flow. The APTES surface is positively charged at neutral pH so it electro
statically and non-specifically immobilizes the colloids. The integrated intensity of
the quantum dot colloid conjugates was measured with both 20X 0.5 NA and 60X
1.45 NA objectives. The total intensity minus the average background for single con
jugates imaged with the 0.5 NA objective was on average within 10% obtained with a
1.45 NA objective, in good agreement with the theoretical predictions. In the absence
of the colloidal lenses it was not possible to observe single quantum dots with a 20X
0.5 NA objective.
Next, the quantum dot colloidal lenses were sandwiched in aqueous solution be
tween two clean RCA coverslips. The colloids undergo constant rotational and trans-
lational diffusion under these conditions (Figure 5.3A). When the quantum dot is
close to being in alignment with the microscope's optical collection axis, the mea
sured fluorescent intensity is significantly greater than when it is out of alignment.
Brightfield and epi-fluorescent images containing thousands of colloidal lenses under
going Brownian motion were taken with a 20X 0.5 NA air objective and a Hamamatsu
ORCA-ER CCD with a 500 msec integration time. While the majority of the lenses
were observed to be free of quantum dots, the fluorescent intensity fluctuations of
approximately 30 colloidal lens quantum dot conjugates were selected based on their
peak intensities being consistent with a single quantum dot emitter. Each conjugate
was traced over a period of 5 minutes to give over 500 different blinking events from
which to generate rotational diffusion statistics.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 99
The probability P(t) that the intensity of a given quantum dot is above a set
threshold at time t given that the intensity was above the threshold at t = 0 can be
estimated from these fluctuations [124]. If a is the azimuthal angle over which the
signal is enhanced, the solution to the one dimensional diffusion equation with initial
condition \6\ < a is:
where Dr is the rotational diffusion constant of a sphere:
Here r\ is defined as the viscosity and a is the sphere's radius. By summing over all
multiples of 2n, Equation 5.7 can be made periodic in 9. The probability density
function for the distribution in angles is given by
n=oo
P ( M ) = Y, Pinf(d + 2rnr,t) (5.9)
n=—oo
with a total probability distribution of
/•a/2
P(t)= / p(9,t)dd (5.10) J-a/2
This integral was approximated numerically as previously described [124]. Figure
5.3 shows P(t) for quantum dot conjugates in three different glycerol-water solutions
of varying viscosities (3.4 cP, 6 cP, 12 cP). For each experiment, measured data was
least-squares fit to the theoretical solution to the one-dimensional diffusion equation
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 100
QD 7\v
enhanced dim signal signals
0.8
2 ' Q.
0.2
2 3 4 time / s
Figure 5.3: Colloidal lenses enable imaging of single quantum dot nanoparticles. (A) Quantum dot-colloid conjugates are free to rotate and translate in aqueous solution. When the pair aligns with the optical collection axis, the observed fluorescent intensity is enhanced. (B) Probability correlation functions for the fluorescent intensity of colloidal lens-quantum dot conjugates in three different glycerol-water solutions. The circles represent the observed rotational statistics of approximately 30 conjugates and 500 blinking events over 5 minutes. An fixed intensity cutoff was chosen for all three experiments to define when lensing was taking place. Error bars represent the standard error of all conjugates for each solution. The solid lines represent least-square fits to the experimental data with a = 0.3 rad to represent the set intensity cutoff. The rotational diffusion coefficient was the single free parameter. Rotational diffusion coefficients were found to be D^cP = 0.0146 sec -1, D6cp = 0.0247 sec -1, and DZACP = 0.0501 sec -1. The inset shows typical intensity data from a single lens-quantum dot conjugate (77 = 3.4 cP) observed over 1 minute.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 101
1500
D ^ 1000
+^ 'w C $i 500 c
"0 10 20 30 40 50 0 5 0 1 00 150
time / sec
Figure 5.4: Static imaging of single quantum dots without and with colloidal lenses. Grey trajectories show the raw data; red show the raw data smoothed over 5 time points. (A) Quantum dot blinking was observed with a 60X 1.45 NA objective, but was not significantly observed when coupled to TiC>2 colloids and imaged with a 20X 0.5 NA objective (B).
[124]. Experimentally determined rotational diffusion constants were found to be
within 10% of the predicted values based on glycerol-water viscosities [133]. Signal
to noise ratios (S/N) were calculated by integrating the intensity of a 3 x 3 box
of pixels around fluorescent features, subtracting the average background per pixel,
and dividing by the root-mean-square variation in the signal. Peak S/N for single
quantum dots in the absence of colloidal lensing with a 60X 1.45 NA objective was
«10; with a 20X 0.5 NA objective with colloidal lensing it
One potential source of error in this experiment is quantum dot blinking. When
the quantum dots were immobilized on the APTES surfaces at low concentrations,
intermittent blinking behavior was observed on timescales ranging from 1-10 sec (Fig
ure 5.4A). However, this behavior was not observed in the presence of the colloidal
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 102
lenses with a low NA objective (Figure 5.4B). One possible explanation is that quan
tum dot blinking is suppressed by electromagnetic interactions with the nearby metal
or metal oxide, a phenomena also reported by others [134, 135]. There should also be
zero correlation between quantum dot blinking "on-time" and the solution viscosity.
5.4 Enhanced Fluorescence Effects
There has been recent interest in exploring the fluorescence spectral properties of or
ganic fluorophores near metal films [136, 137] and nanoparticles [138, 139, 140]. Much
of this work has been focused on Au and Ag nanoparticles and island films, where an
increase in photostability, brightness, and radiative decay rates of fluorophores has
been reported. There have also been reports of enhanced fluorescence near metal-
oxide surfaces [141] and nanoparticles [142]. To see if TiC>2 colloids give similar ef
fects, the following experiment was performed. A dilute solution of Cy3-streptavidin
(1 ng/mL, Invitrogen) was incubated on a biotin-BSA coated glass coverslip (see
Chapter 3) for 20 minutes. Surfaces were then imaged on a microscope with epi-
fluorescence excitation with a 60X 1.45 NA objective (Figure 5.5A) and fluorescence
intensities (Table 5.1 and lifetimes were recorded (Figure 5.5C).
The surface was then incubated with a 1.3% solution of biotinylated 2.0 fxm. TiC*2
colloids overnight, unbound colloids were washed away, and the surface was imaged
again under the same illumination conditions (Figure 5.5B). In this configuration
the colloids were not in the light collection path of the microscope. However, Cy3
fluorophores showed a «45% increase in fluorescence lifetime (Figure 5.5D) and a
wl5% increase in photons/sec emitted (Table 5.1) when they were near TiC*2 colloids
compared to when they were absent. An increase in the Cy3 radiative decay rate
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 103
>-u c
a-
N
£
0.40
0.30
0.20
0.10
20 40 60 80 0 20 40 60
Cy3 photobleaching lifetime / sec
Figure 5.5: Enhanced fluorescence effects of Ti0 2 colloids. Cy3-streptavidin was imaged using a 60X 1.45 NA objective in an epi-fluorescence configuration without (A) and with (B) biotinylated-Ti02 colloids coupled to the protein. Note that in this configuration the lensing effects of the colloid are not used. The distribution of measured Cy3 fluorescence lifetimes for each configuration are shown in (C) and (D), respectively. Red curves are single exponential fits to the distributions.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 104
Table 5.1: Photon statistics for colloidal Ti02-enhanced fluorescence.
Objective
60X 0.5 NA epi 60X 0.5 NA epi
colloids
N Y
dry/wet
dry dry
photons/sec
3.1 x 104
3.6 x 104
< r > /sec
11.2 16.3
total photons
3.5 x 105
5.9 x 105
from the excited state is one possible explanation for this effect. Decreasing the time
molecules spend in the excited state reduces the time they are able to react with singlet
molecular oxygen, thereby reducing the window of opportunity for photobleaching.
This may also increase the number of excitation-emission cycles each fluorophore is
capable of going through prior to photobleaching, possibly leading to the observed
increase in fluorescent intensity.
5.5 Single Molecule Imaging with Colloidal Lenses
The ray optics arguments and FDTD simulations predict that high index colloids
should enable the same light collection ability as the highest NA objectives currently
available. To test this hypothesis, colloids were coupled to single molecules of Cy3-
labeled streptavidin as previously described. RCA clean glass coverslips were coated
with biotinylated bovine serum albumin (Pierce) and functionalized with a sparse
population Cy3-streptavidin (Invitrogen). The optical setup for the epi-fluorescence
configuration was based on a Nikon TE-2000S inverted microscope equipped with
a Nikon Plan Fluor 20X 0.5 NA air objective. Sample illumination was provided
by a mercury arc lamp and filtered with a Cy3 filter cube (HQ535/50x, Q565LP,
HQ610/75m, Chroma Technology Corp). Fluorescence emission was collected by the
60X 1.45 NA oil immersion objective and detected by a high sensitivity 512x512
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 105
pixel Photometries Cascade II EM-CCD. After verifying that the molecule density-
was « 1 molecule / 100 /xm2, biotin-decorated 2.0 yum Ti02 colloids were coupled to
the surface-bound protein. Following a 4 hour incubation, unbound colloids were
washed away, the surface was dried, and the colloids were imaged using brightfield
and epifluorescence excitation with a 20X 0.5 NA air objective (Figure 5.6A and
B). Signals were only detected where colloids were immobilized. Each signal showed
a stepwise decrease to background which was indicative of the presence of a single
fluorophore (Figure 5.6B). The surface was heated from 23°C to 70°C using resistor
heaters and single step photobleaching was still observed even at high temperature
(Figure 5.6C). In the absence of colloids no signal was detected with a 20X 0.5 NA
objective.
The light collection efficiency was similar in each of these experiments («7 x 103
photons /sec). This was slightly less than the collection efficiency of a 60X 1.45 NA
objective in the absence of colloidal lenses («3 x 104 photons/sec), possibly because
the fluorophores were never perfectly aligned with the optical axis of the lensing
system. Interestingly, the photostability of the fluorophores when excited through
the colloid with a 20X 0.5 NA objective at 23°C increased by over 4-fold (r =16.3
sec to 70.9 sec). This may be due to the colloid increasing the local incident incident
field on the fluorophore through a "Lightning Rod" effect [143, 144].
Raman scattering by water molecules prevented single fluorophore detection in
aqueous solution with colloidal lenses and epifluorescence excitation. However, re
ducing the excitation volume with prism TIR to minimize the background did allow
for single fluorophore detection. Cy3-labeled dsDNA was coupled to TiC*2 colloids to
empirically give « 1 molecule per colloid; the constructs were then allowed to bind
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 106
Cy3-streptavidin 23t 2000 epifluorescence in air
=3
CO 15001
.-^lOOO CO
c <D 500
4-J
c
Cy3-streptavidin 23t Cy3-streptavidin 70t Cy3-DNA 23°C Cy3-DNA 70t epifluorescence in air epifluorescence in air TIR in water TIR in water
50 100
23C, dry sample
20 40 60 80 0 20 40 60 80 0 20 40 60
t ime / sec 70C, dry sample 23C, wet sample 70C, wet sample
Figure 5.6: Static imaging of single fiuorophores with colloidal lenses. Raw data is shown in grey and 5-point smoothed data is shown in red. (A) Brightfield fluorescent images of a 2.0 ^m Ti02 colloid coupled to a surface through a fluorescently-labeled tether. Using a tether of Cy3-streptavidin and epifluorescence excitation of a dry sample, single step photobleaching was observed at (B) 23°C and at (C) 70°C. With a tether of Cy3-labeled dsDNA in aqueous solution excited via prism TIR, stepwise photobleaching was also observed (D) 23°C and (E) 70°C. Photobleaching lifetimes of Cy3 varied between dry (F-G) and wet (H-I) samples and decreased with temperature for both configurations.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 107
Table 5.2: Photon statistics for Ti02 colloidal lensing.
Objective
20X 0.5 NA epi 20X 0.5 NA epi
20X 0.5 NA TIR 20X 0.5 NA TIR
T / ° C
23 70 23 70
dry/wet dry dry wet wet
photons/sec
8.2 x 103
7.8 x 103
6.1 x 103
5.4 x 103
< r > /sec
70.9 39.1 31.0 15.0
total photons
5.8 x 105
3.0 x 105
1.9 x 105
0.8 x 105
S/N
3.2 2.5 2.0 1.9
non-specifically to an aminated glass surface. Unbound colloids were washed away
and the Cy3-labeled DNA was imaged in a custom flow cell. At 23°C, signals were
only detected where colloids were immobilized and each signal showed stepwise pho-
tobleaching (Figure 3D). Stepwise photobleaching was also observed at 70°C after
taking careful precautions to minimize evaporation in custom made high tempera
ture flow cell. Cy3 fluorescence lifetimes were measured for hundreds of trajectories
from each of these experiments (Figure 5.6E-H). A «2-fold reduction in lifetimes was
observed at higher temperatures for both the dry and wet samples, which might be
explained by an increase in the reaction rates of molecules in excited or triplet states
with singlet molecular oxygen.
Single molecule imaging at high temperatures requires careful attention to the
details of the flowcell and the optical setup. For prism-TIR excitation, the viscosity
and index of the immersion oil between the prism and the top coverslip can change
with temperature. This can result in the prism actually moving during the course of
an experiment. Another challenging issue to overcome is sample loss due to evapo
ration. The flowcell has to be sealed extremely well to withstand the vapor pressure
that builds up within the chamber. Sealing the flowcell with epoxy prevents reagent
exchanges, which makes more complicated assays difficult to execute.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 108
5.6 Measuring Polymerase Kinetics with Colloidal
Lenses
To demonstrate that colloidal lenses can enable a biological experiment that was
previously impossible due to the temperature limitations of high NA objectives, the
real-time single molecule kinetics of a thermophilic DNA polymerase were measured
at 70°C (Therminator from Thermococcus 9°N). First, however, the kinetic assay was
verified with a mesophilic polymerase in the presence of a TiC>2 colloid.
5.6.1 Escherichia coli Pol I(KF) Activity
Hairpin Synthesis
Virtually the same 259 nt DNA molecule containing an internal double-stranded 33
base pair (bp) hairpin was used as described in Chapter 5. The 3' base of the hairpin
contained an internal Cy3 FRET donor and the 5' base contained an internal non-
fluorescent FRET acceptor (Black Hole Quencher-2, BHQ-2) so that when the hairpin
was fully folded, quenching of Cy3 by BHQ-2 prevented any fluorescence emission.
The 5' tail of the construct was modified with an anti-digoxigenin group for coupling
to the surface and a 3' biotin group for coupling to the colloid.
Colloid Functionalization
Ti02-COOH colloids (2.0 fj,m, Corpuscular) were washed three times in water and
twice with a crosslinking buffer (0.025 M MES, pH 5.0). The carboxylated beads
were activated with 40 mg EDC (l-ethyl-3-[3-dimethylaminopropyl]carbodiimide hy
drochloride, Thermo Scientific) and 20 mg sulfo-NHS (N-hydroxysulfosuccinimide,
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 109
Thermo Scientific) in 400 /zL of MES buffer (0.025 M MES, pH 5.0). The colloids
were placed slowly on a rotating mixer at room temperature for 60 min to allow the
EDC and sulfo-NHS to form NHS esters. Following this reaction, the colloids were
washed twice with MES buffer and with 200 fiL of coupling buffer (0.1 M sodium
bicarbonate, 0.25 M sodium chloride, pH 8.0). The colloids were then functionalized
with a biotin-PEG layer through the addition of 20 mM amine-PEG2-Biotin (EZ-
Link Amine-PEG2-biotin, Thermo Scientific) in coupling buffer. This reaction was
left overnight to allow the primary amine groups of the biotin-PEG linker to react
with the NHS esters on the colloid surface. Excess amine-PEG2-biotin was removed
by washing twice with PBS. Neutravidin (0.5 mg/ml, Thermo Scientific) in IX PBS
buffer was added to the biotinylated colloids and allowed to react for at least 5 hrs.
The colloids were then washed twice with IX PBS and resuspended in 400 /J,L of
storage buffer (0.05 M sodium phosphate, 0.25 M NaCl, 0.1% Tween-20, pH 7.4).
Surface Functionalization
To immobilize the hairpin duplex on the surface, an anti-digoxigenin coating was
created by incubation of a solution of 0.2 mg/mL anti-digoxigenin (Fab fragments
from sheep, Roche Applied Science, Mannheim, Germany) for 5 hrs. Unbound anti-
digoxigenin was washed away with 3 mL IX PBS. Hairpin functionalized colloids were
introduced to the flowcell and incubated overnight. The flow cell was then washed
with 2 mL of IX PBS buffer.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 110
Prism TIR Microscope
The single-molecule fluorescence experiments were performed by using a total internal
reflection (TIR) wide-field microscope built around an inverted Nikon TE-2000 with
a 20X 0.5 NA air objective (Nikon Plan Fluor). A diode-pumped 532 nm green laser
(CrystaLaser) was used as the excitation light source. Using a beam expander, the
beam diameter was increased and guided to a 20 cm focusing lens. By adjusting this
lens, the excitation beam was directed to a fused silica prism optically coupled to
the top coverslip surface through a refractive index matching oil (Nikon Type NF).
With the incident angle of the laser beam adjusted to (=369°, total internal reflection
was achieved at the interface between the coverslip and the sample solution. The
emission signal was collected with the air objective lens, passed through a 550 nm long-
pass filter (E550LP, Chroma Technology), and a bandpass emission filter (HQ580/60,
Chroma Technology) before entering the EM-CCD camera (Cascade II 512B, Roper
Scientific, Trenton, NJ). The exposure time was 500 ms for the room temperature
and 350 ms for the high temperature experiments. The laser power at the prism was
adjusted to 300 W/cm2.
Mesophilic Polymerase Assay
The extension mixture was comprised of 5 units of DNA Pol I(KF) from Escherichia
coli, 100 fiM of each dNTP, 0.1 mg/ml glucose oxidase, 0.2 mg/mL catalase, 10%
w/w glucose, 1 mM Trolox, in buffer # 2 from New England Biolabs. As described
in Chapter 4, control experiments taken with a 60X 1.45 NA oil objective without
colloidal lenses showed fast replication (Figure 5.7B), fast replication with a single
pause (Figure 5.7C), fast replication with multiple pauses (not shown), and stepwise
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 111
7 < <BHQ-2
SCy3
Pol l(KF) 23C 60X 1.45 NA
B
50 100 150
Pol l(KF) 23C 20X 0.50 NA
Therminator 70C 20X 0.50 NA
0 50 100 150
time/s
H
fi I •• .h,..u.1 liit
0 50 100
Figure 5.7: Single molecule DNA polymerase activity observed with colloidal lenses and a 20X 0.5 NA air objective. (A) Cartoon of the DNA template used to measure real-time polymerase kinetics. Primed 259 nt DNA molecules containing internal 33-bp hairpins and flanking 94 nt tails were immobilized on a glass surface. DNA replication through the hairpin resulted in a reduction in FRET efficiency between Cy3 and BHQ-2, giving rise to an increase in Cy3 fluorescence. Trajectories of this process imaged with a 60X 1.45 NA oil-immersion objective without colloidal lenses show different behaviors, including (B) fast extension, (C) pausing during fast extension, and (D) refolding of the hairpin into a cruciform structure. Trajectories exhibiting similar behaviors were observed with a 20X 0.5 NA air objective with colloidal lenses at 23°C with Pol I(KF) (E-G) and at 70°C with Therminator (H-J).
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 112
refolding of the hairpin after replication (Figure 5.7D).
It was not possible to see any single molecules on the surface after switching to
a 20X 0.5 NA air objective under these conditions. With colloidal lenses, however,
addition of the extension mixture to the flowcell generated signal and replication
through the hairpin was observed. Single molecule trajectories taken with the colloidal
lenses and a 20X 0.5 NA air objective showed fast replication (Figure 5.7E), fast
replication with a single pause (Figure 5.7F), fast replication with multiple pauses
(not shown), and stepwise refolding of the hairpin after replication (Figure 5.7G).
The fact that it is possible to detect strand displacement synthesis events similar to
those observed with a high NA objective illustrates the sensitivity and capability of
colloidal lensing for biological assays. The pause efficiency was slightly reduced (25%
to 10%) with the colloid present; this may be due to increased template tension. If Pol
I(KF) or the dNTPs were omitted from the extension mixture there was no recovery
of Cy3 signal.
5.6.2 Thermococcus 9PN-7 Therminator Activity
The assay was slightly modified to accommodate operating at high temperature.
Surface functionalization
Amine-reactive glass surfaces were prepared as follows. Circular coverslips (D-263T,
Precision Glass and Optics) were RCA cleaned and then rinsed in water and ace
tone. The acetone was replaced with a 2% solution of 3-aminopropyl triethoxysilane
(APTES, Sigma-Aldrich) in acetone and the surfaces were incubated for 60 min at
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 113
room temperature. The aminosilylated surfaces were washed thoroughly with ace
tone and dried under a steam of air. The slides were then baked for 30 min at 120°C.
The silanization procedure leaves the surface covered with positively charged amine
groups. Next, the surfaces were reacted with a solution of 20 mg/mL epoxy-PEG-
epoxy (MW 5,000, Laysan) in 100 mM sodium bicarbonate buffer (pH 8.3) with 0.3
M K2SO4. This reaction was carried out by dropping 100 \iL of the PEG solution
on to the surface and immediately covering it with a second surface. Surfaces were
incubated for 4 hrs, followed by carefully rinsing with deionized water and drying
with nitrogen gas. These surfaces were stable for several months when stored under
argon atmosphere.
Colloid Functionalization
TiCVCOOH colloids were activated with EDC/Sulfo-NHS as described above. The
washed colloids were treated with 2% poly(ethyleneimine) (50 wt. % in H20, Sigma
Aldrich) in 100 mM carbonate buffer, pH 8, overnight. The colloids were then
washed thoroughly with carbonate buffer and water. The aminated colloids were
then washed three times with DMF followed by incubation in 1,4-phenylene diisoth-
iocyanate (Acros) in DMF with 10% pyridine (CHROMASOL Plus, Sigma-Aldrich)
for 2 hrs. The colloids were washed twice with DMF, twice with methanol, and twice
with acetone. The amine reactive colloids were then coated with the aminated primer
at 20 nM (Oligo Z with a 5'-NH2 group) in 100 mM carbonate buffer, pH 9, overnight.
Next, succinic anhydride (Sigma-Aldrich) in methylpyrrolidinone (Fluka) and borate
buffer was used to passivate the charged surface for 4 hours. After washing with wa
ter, the colloids were passivated again with 1% NH4OH for 10 minutes. The colloids
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 114
were washed three times with IX PBS and were then ready for hybridization.
Initial experiments using non-passivated beads resulted in high background flu
orescence. This was attributed to the unreacted amine groups, present on the PEI
surface, non-specifically binding the hairpin through an electrostatic interaction with
the backbone phosphate groups. It was therefore desirable to block these unreacted
amine groups to remove the positive charge. Reacting the amine groups of the PEI-
treated colloids with succinic anhydride achieved this aim. This was probably due to
the negative charge of the carboxylate group repelling the negatively charged DNA.
Covalent D N A Surface Attachment
A flow cell was created by placing a 2 mm thick polydimethylsilicone (PDMS) chip
on the PEG-epoxy coated surfaces. The PDMS chip contained one 30 /JL circular
chamber, 100 //m thick, that was accessible through inlet and outlet holes. A 3'
TTG CTG CAA CTC TCT CAG GGC-NH2-3') was injected into the flow cell and
incubated overnight in a humid chamber. The oligonucleotide surfaces were washed
twice with 100 mM carbonate buffer and IX PBS buffer to remove unbound DNA.
The surface was passivated with a solution containing 1M phosphate buffer for 3 hrs.
Before hybridization, the surface was rinsed with PBS buffer and 3x SSC. The hairpin
oligo, diluted in 3x SSC, was added to the flow cell and annealed at 55°C for 1 hr.
After incubation, the flow cell was washed with in 3x SSC followed by lx SCC/0.1%
SDS at 30°C. The colloids (decorated with the primer, described above) were diluted
in 2x SCC and added to flow cell. Annealing was achieved by incubation at 55°C for 8
hrs in a specially design hybridization cassette. The flow cell was then rinsed with lx
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 115
SCC/0.1% SDS, followed by two rinses in IX PBS buffer, to remove unbound colloids.
The PDMS flow cell was peeled off and the slide was ready for the experiment.
Thermophilic Polymerase Assay
The extension mixture was comprised of 5 units of Therminator (from Thermococcus
gPN-7, New England Biolabs), 100 (M of each dNTP, 0.1 mg/ml glucose oxidase, 0.2
mg/mL catalase, 10% w/w glucose, 1 mM Trolox, in buffer # 2 from New England
Biolabs. The flowcell and extension mixture were pre-heated in an oven held at 75°
for 30 minutes. The reaction was started by adding 20 piL of mixture to the surface
and immediately sandwiching another coverslip on top. The chamber was sealed
twice with 5-minute epoxy, allowed to dry, and placed in a custom flowcell (CFCS2,
Bioptechs) with a 50 /im thick Teflon gasket for imaging. This flow cell was made
of stainless steel and was capable of holding the sample completely sealed to prevent
evaporation. For reactions performed at 70°C, a thin circular resistor heater was
placed on the bottom of the flow cell using a thermal paste. Heating was achieved by
applying a voltage to the heater with a variable DC power supply. The temperature
of the cell was monitored by placing a thermocouple in close proximity to the imaging
region.
Data collection proceeded as for the mesophilic enzyme experiments. Figure 5.7H-
J shows three sample trajectories measured with the colloidal lenses of Therminator
DNA polymerase activity at 70°C. Heterogeneous behavior was observed with some
trajectories showing fast replication (Figure 5.7H), fast replication with a single pause
(Figure 5.71), and stepwise refolding (Figure 5.7J). However, the frequency of pausing
was drastically reduced with Therminator at 70° to «5% of all trajectories.
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 116
5.6.3 Replication Rates Measured with Colloidal Lenses
Incorporation rates for Pol I(KF) and Therminator were measured by first generating
a calibration curve between Cy3 intensity and DNA polymerase position based on
the location of the known Pyr-G-C pause motif. The intensities along each trajectory
were then converted into positions and the rates were calculated by measuring the
slope of the trajectory between two steady states (see Chapter 4 for more detail).
The measured rate of 12 nt/sec for Pol I(KF) (Figure 5.8A) was slightly slower than
measured in the absence of the colloid with a 60X 1.45 NA objective (17 nt/sec).
This may be because the replicating polymerase follows the helical backbone of the
template and has to rotate the colloid. Therminator's measured rate of 18 nt/sec
(Figure 5.8B) is almost double the reported bulk rate of 10 nt/sec, suggesting that
the pausing behavior we observe with our single molecule experiments are included
in the ensemble studies. This separation of burst synthesis from sequence-specific
pausing can only be realized in a single molecule experiment.
5.7 Future work
Colloidal lenses enable not only single molecule sensitivity with low numerical optics,
but also the whole new field of high temperature single molecule spectroscopy. The
ability to image very large fields of view at high temperatures with single molecule
sensitivity, free of the restraints of index matching fluids and short working distances,
could be of great interest in biology, chemistry, and nanoscience. For example, single
molecule sequencing-by-synthesis technologies currently employ a mesophilic DNA
CHAPTER 5. SINGLE MOLECULE COLLOIDAL LENSING 117
c o
• &
o CO i _
M—
"D
ize
ro £ o c
0.35
0.30
0.25 0.20
0.15
0.10
0.05
0
Pol l(KF) Therminator
0 20 40 60 80 0 20 40 60 80
synthesis rate / nt/sec
Figure 5.8: Replication rates measured with colloidal lenses and a 20X 0.5 NA objective for (A) Pol I(KF) at 23°C and (B) Therminator at 70°C. Rates were measured as described in Chapter 4.
polymerase to sequentially incorporate fluorescently-labeled nucleotides into a grow
ing complementary strand. However, the ability to use a thermophilic polymerase
would offer a number of key advantages: improved enzyme heat stability, better abil
ity to incorporate nucleotide analogs, and the capacity to melt templates that are
GC-rich or have a high degree of secondary structure. The total throughput of single
molecule DNA sequencing methods is also limited by the number of templates visible
in a single field of view, a bottleneck that could also be improved by an order of mag
nitude with the aid of colloidal lenses. Finally, this technology can be used to improve
the sensitivity of miniaturized, hand held microscopes and biological detectors.
Chapter 6
Surface Plasmon Resonance
Enhanced TIRF Microscopy
6.1 Introduction
As introduced in the previous chapter, a fluorescent dye near a metal or metal-oxide
objects can experience changes in both its excitation and emission properties. Planar
metallic systems, however, have been studied for decades largely because they are
easier to prepare with high precision and reproducibility. Single molecule metal-
enhanced fluorescence studies on planar surfaces have used prism-based total internal
reflection microscopy (TIR) [145] or epi-illumination scanning confocal microscopy
[146] to perform excitation and image collection. Theoretical investigations of single
molecule fluorescence detection near a metal layer indicated that the excitation and
emission processes are mediated by surface plasmons [147, 148].
Surface plasmons, or surface plasmon polaritons, are electromagnetic waves that
propagate parallel to a metal or dielectric interface. An electron or light beam can be
118
CHAPTER 6. SPR ENHANCED TIRF MICROSCOPY 119
used to excite surface plasmons in a resonant manner by matching its impulse to the
plasmon. The surface plasmon resonance (SPR) is very sensitive to changes at the
interface boundary, which has led to its use for surface binding detection. Fluores
cence microscopy, however, takes advantage of the fact that the electromagnetic field
generated by the surface plasmons is stronger than that generated by total internal
reflection, giving rise to enhanced fluorescence signals.
While both prism-TIR and scanning confocal approaches demonstrated enhance
ment effects, there are some drawbacks. Prism-TIR limits the amount of fluidic
integration and automation possible on the flowcell, as accessibility is limited on both
sides of the sample. Epi-fluorescence scanning confocal setups can remove this limi
tation but are slow to acquire images. For these reasons, developing a through-the-
objective TIR fluorescence microscopy platform would be ideal. Although it would
necessitate performing both excitation and detection through the thin metal film,
it would allow for integrated fluidics and fast imaging for high throughput single
molecule applications.
The focus of this chapter is to explore the feasibility of using through-the-objective
TIR for single molecule imaging on a metal film. Specifically, the aims are to assess
the surface chemistry, the quenching of non-specifically bound fluorophores, and the
enzymatic activity of a DNA polymerase. The fabrication process begins by coating
a low-autofluorescence coverslip with a thin metal film and functionalizing it with ap
propriate chemistry for the specific attachment of fluorescently labeled biomolecules.
The evanescent field generated by total internal reflection is enhanced by the produc
tion of surface plasmons in the metal film [145, 147, 148]. Surface plasmons tend to
stay longer along the surface and produce a stronger electromagnetic field than that
CHAPTER 6. SPR ENHANCED TIRF MICROSCOPY 120
generated by total internal reflection. As a result, fluorophores within « 20 nm of the
surface exhibit intensity enhancement. This could be of particular benefit for single
molecule DNA sequencing platforms where signal-to-noise ratios are critical for rapid
image acquisition.
There is an additional important benefit of having a thin metal film near the flu
orophores of interest. As mentioned in Chapter 2, single molecule DNA sequencing
approaches can require fluorescently-labeled dNTPs to be washed across a surface
many times throughout the course of a run. This process inevitably results in the
nonspecific binding of fluorescently-labeled dNTPs to the surface, resulting in in
creased background fluorescence and false-positive features. However, the presence of
the thin metal film can quench any excited fluorophores near the surface (within a few
nm) by a mechanism of fluorescent energy transfer into the surface plasmon modes
of the metal [149, 150]. Many alternative surface attachment chemistries have intrin
sic properties designed to enhance specific molecule binding but do little to directly
inhibit or suppress the effects of the nonspecific binding. The corresponding increase
in background fluorescence as labeled molecules are washed across the surface, com
bined with the limited fluorescent intensity and lifetime of any single fluorophore,
imposes restrictions on the overall imaging capabilities of any single molecule surface
face quality) were RCA cleaned and coated with 5-50 nm Au layers using a sputter
CHAPTER 6. SPR ENHANCED TIRF MICROSCOPY 121
coater (Cressington 108). Control slides were coated with a polyelectrolyte mul
tilayer and functionalized with Biotin-PEO-Amine (Pierce) as previously described
[82]. To prepare a self-assembled monolayer (SAM) on the Au film, 10 mg of 11-
amino-undecanethiol (Dojindo Inc.) was dissolved in in 1 mL absolute ethanol to
give a 42 mM solution. This stock solution was then diluted in ethanol to give a 0.5
mM working solution. Au-coated surfaces were completely immersed in the solution
in a vertical chamber for 18-24 hrs. The surfaces were then rinsed with ethanol,
ultrapure water, and dried with N2.
NH
2 N
H2
NH
2 N
H2
> N
H2
t«
NH
2 .>
* N
H2
NH
2
Fig
ure
6.1:
Au-
coat
ed s
urfa
ces
are
subs
trat
es f
or s
elf-
asse
mbl
ed
mon
olay
ers
(SA
Ms)
. (1
) R
CA
cle
an c
over
slip
s w
ere
drie
d an
d a
thin
lay
er o
f A
u w
as s
putt
er-c
oate
d on
one
sid
e.
(2)
A s
elf-
asse
mbl
ed
mon
olay
er o
f 11
-am
ino-
unde
cane
thio
l w
as f
orm
ed o
n th
e su
rfac
e th
roug
h a
thio
l-A
u bo
nd,
(3)
follo
wed
by
trea
tmen
t w
ith
SMC
C t
o cr
eate
a
thio
l-re
acti
ve s
urfa
ce.
(4)
Thi
ol-f
unct
iona
lize
d D
NA
was
the
n be
rea
cted
wit
h th
e su
rfac
e to
for
m a
cov
alen
t bo
nd (
5).
S3
pi I I 3 o
Co O
h->
to
to
CHAPTER 6. SPR ENHANCED TIRF MICROSCOPY 123
To prepare the surfaces for DNA attachment, 2.18 mg of sulfo-SMCC (436.37 g
mol -1 , Pierce) was dissolved in 5 mL of 0.1 M triethanolamine (TEA), pH 7.0, to
create a 1 mM sulfo-SMCC solution. Hybriwells (Grace Biolabs) were placed on the
surfaces and the SMCC solution was incubated at room temperature for 45 minutes.
Surfaces were then washed in with IX PBS buffer, pH 7.4.
Synthetic DNA was obtained from Integrated DNA Technologies (template 5'-SH-
(CTG CTA)5 CTG CTA CTA c cca caa ace aaa age cca gac-3' and primer 5'-Cy3-
GAC TGG GCT TTT GGT TTG TGG G-3'). Oligos were resuspended to 100 /zM
final concentration in ultrapure water. To prepare DNA duplexes for single molecule
incorporation experiments, 1.0 fih primer and 1.0 fjL thiolated template were diluted
to a 10 iih final volume in 10 mM Tris, 100 mM NaCl, pH 7.5. The solution was
tip mixed and annealed on an MJ Thermal Cycler by heating to 96°C and slowly
cooling to 4°C at 0.1°C per second. Thiolated DNA was then reduced using bond-
breaker TCEP as instructed by the manufacturer (Pierce) and diluted to 10-100 pM
for incubation on the SMCC-treated surfaces. The DNA was allowed to react for
«30 min, after which the surfaces were washed extensively with Tris buffer. Surfaces
were then imaged on a custom-built free space total internal reflection fluorescence
microscope with a 60X 1.45 NA Olympus objective and a Hamamatsu ORCA-ER
CCD. Oxygen-scavenging solution was prepared as previously described [70].
6.3 Results
Au coated and 11-amino-undecanethiol/Au surfaces were characterized using x-ray
photoelectron spectroscopy (XPS). The spectra for the Au surfaces showed Auger
peaks primarily due to Au, as expected (Figure 6.2). There was a small amount of
CHAPTER 6. SPR ENHANCED TIRF MICROSCOPY 124
Binding Energy (eV)
Figure 6.2: XPS spectra of Au-coated surfaces.
carbon contamination likely coming from reaction with the atmosphere. The SAM-
treated Au surface showed a substantial increase in carbon content and a small amount
of nitrogen (Figure 6.3). Angle-resolved XPS was also used to measure the depth of
each layer (data not shown), and it was found that the nitrogen layer was « 1.4 Aand
the carbon layer 19.9 A.
To characterize the ability of the Au film to quench fluorophores in close prox
imity, 10 nM Cy3-dCTP (Amersham Biosciences, now GE) in IX TE was incubated
for 5 minutes on three different surfaces (Au, 11-amino-undecanethiol SAM on Au,
and polyelectrolyte multilayer (PEM)). The nucleotides were then washed away and
the surface was imaged. This process Cy3-dCTP incubation, surface washing, and
imaging was repeated two more times. The Au coated surfaces showed no sign of
any Cy3 fluorophores, either due to zero non-specific binding or absolute quenching,
similar to that of a RCA clean surface. PEM surfaces showed a significant amount
of clearly-resolvable non-specifically bound nucleotides over the course of the experi
ment (Figure 6.4A-C). The alkanethiol-coated Au surface did not contain any clearly
CHAPTER 6. SPR ENHANCED TIRF MICROSCOPY 125
Binding Energy (eV!
Figure 6.3: XPS spectra of an 11-amino-undecanethiol SAM on an Au-coated surface.
resolvable fluorophores, but the background fluorescence increased by « 20% (Figure
6.4D-F).
Next, a single base incorporation experiment was attempted on the Au-SAM sur
faces. Primed DNA templates were covalently attached to the SAM through a cova-
lent thiol bond (see Methods section above). Primer-template locations were imaged
and the Cy3 fluorophores on the primer were photobleached. Pol I(KF) and Cy3-
dCTP were then added to the flowcell and allowed to react for 15 minutes at room
temperature. The surface was then washed with Tris buffer and an oxygen-scavenging
solution was added for post-incorporation imaging (Figure 6.5). Although polymerase
was active on the SAM/Au surfaces and it was possible to observe single nucleotide
incorporation events, it only occured on »10% of the initial templates. This may have
been due to the template orientation with respect to the surface: if they were mostly
lying flat on the SAM, DNA polymerase binding would have been largely hindered.
The through-the-objective TIRF configuration required that the emitted light
had to pass through the Au film for detection. This inevitably resulted in some
CHAPTER 6. SPR ENHANCED TIRF MICROSCOPY 126
Figure 6.4: Cy3-dUTP was quenched on Au-coated surfaces. 10 nM Cy3-dCTP in T50 buffer was incubated in a hybriwell on a surface for 5 minutes, the chamber was rinsed with buffer, and the process was repeated three times. The surfaces were then imaged and sample fields of view are shown after each washing cycle on a PEM surface (A-C) and 50 nm Au-coated surface with a SAM of 11-amino-undecanethiol (D-F).
Figure 6.5: Pol I(KF) incorporates Cy3-dCTP on a SAM-Au surface. Green features show the location of each primer-template complex and red features show the location of Cy3-dCTP incorporation. In this field of view, three different templates showed incorporation events (circled).
CHAPTER 6. SPR ENHANCED TIRF MICROSCOPY 127
signal loss and reduced sensitivity. It remains unclear whether the metal-enhancement
fluorescence is great enough to offset the losses and make the effort worthwhile; further
experiments are required to quantify each of these contributions. Even with the
reduced amount of light available to detect, it was still possible to observe the stepwise
photobleaching of single molecules. There was also a significant background present
on the SAM-Au surfaces that appeared similar to Newton's rings. A confocal setup
might be able to filter out these reflections [146], but additional work could be done
to reduce this background for wide-field SPR-TIRF.
6.4 Future work
Using metal surfaces for single molecule imaging is a relatively simple and inexpensive
way to simultaneously quench non-specifically bound species and enhance fluorescent
signals further from the surface. There is also an important trade-off between having
a thick enough Au film for enhancement to be significant versus the corresponding
reduction in light collection efficiency of having to image through a thicker metal
film. Additional work needs to be done to quantify the observed metal-enhanced
fluorescence as a function of the film thickness.
Chapter 7
DNA Polymerases and Nucleotide
Analogs
7.1 Introduction
DNA polymerases are classified into seven general families based on evolutionary ori
gin and structural similarity: families A (pol I), B (pol a, 8, e, £), C (pol III), D (from
Archaea), X (pol /?,/z, cr, A), Y (pol IV, V, 77,6, K), and RT (reverse transcriptases).
All of these enzymes share some degree of sequence homology and general struc
tural similarity, including a right-hand shaped DNA binding cleft that features palm,
thumb, and finger subdomains [151]. Although each family has a distinct secondary
structure, all polymerases appear to make use of a common catalytic mechanism for
template directed DNA synthesis.
Polymerases are widely exploited in modern molecular biology as common tools
for polymerase chain reaction (PCR), single nucleotide polymorphism (SNP) geno-
typing, gene expression studies, and DNA sequencing. A particularly useful feature
128
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 129
of certain polymerases is their ability to incorporate modified nucleotides even in the
presence of their natural counterparts. The ability of being able to maintain incor
poration fidelity while tolerating fluorescent labels has become a critically important
process for a wide variety of applications. Most notably, the rapid completion of the
draft sequence of the human genome [28, 27] was largely due to advances both in
capillary electrophoresis technology and Sanger dideoxy sequencing chemistry [25].
The data generated from this project has increased the interested in comparative
genomics research, with a desire to learn about the relationships between disease,
genetic variability, and pharmaceutical response. However, the amount of sequence
data needed for this requires cheaper, faster, and higher throughput technologies to
be developed.
As described in Chapter 2, single molecule sequencing approaches potentially offer
the highest levels of throughput for the lowest cost [12, 16, 15]. These approaches use
DNA polymerase to incorporate a fluorescently-labeled nucleotide at every position
during replication. The identity of the incorporated base is read out either in real-time
or by stopping the reaction after each step. If a biophysical model for how polymerases
behave while incorporating modified nucleotides can be developed, it may allow for
the rational design of better enzymes for single molecule DNA sequencing and other
applications.
7.2 Polymerase Structures
Here the structural basis for polymerase promiscuity is examined by looking at the
crystal structures of six common polymerases: Taq from Thermus aquaticus (1QSS,
1QSM, 1QTM), Pol I (Klenow Fragment) from Escherichia coli (1D8Y), Tgo from
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 130
Thermococcus gorgonarius (1TGO), Vent from Thermococcus sp. 9°N-7 (1QHT), T7
from T7 bacteriophage (1T7P), and reverse transcriptase from HIV-1 (1J50). All
of the protein crystal structures and primary sequences were obtained in PDB or
FASTA file format, respectively, from the RCSB Protein Data Bank1. Structure
selection was based on a three main criteria: the quality of the crystal structure,
the family of the polymerase crystallized, and the biological relevance of the enzyme
in modern molecular biology. Taq and T7, two commonly used B family enzymes,
were selected because they share a common geometry of bound DNA, nucleotide,
and metal ions in their tertiary structures [151], and they both have high resolution
DNA-complexed structures available. Tgo and Vent, two recently discovered B family
enzymes, were selected as they are structurally quite different from the a family
enzymes, yet also have the ability to repeatedly incorporate modified nucleotides at
high rates [152]. HIV-1 RT was chosen to represent a structurally and evolutionary
different family of enzymes for comparison. A DNA-unbound form of Pol I (KF)
was also selected to act as a scaffold for the modeling of Cy5-dCTP at the active
site to explore how the fluorophore group may interact with the enzyme. Although
some of these polymerases have multiple crystal structures available, the most recent,
best data-containing, highest resolution structures complexed with a dsDNA and/or
dNTP in the active site were selected for this analysis.
Pair wise sequence alignment was done using BioEdit Sequence Alignment Editor
v5.0.9 [153] while allowing the ends of the sequences to slide. Figure 7.1 was generated
from Perkin Elmer's technical datasheet for R6G-dGTP and GE's datasheet for Cy5-
dCTP. The protein structure figures in this chapter were created in PyMol v0.932
R/ree(%) r.m.s. bond lenghts (A) r.m.s. bond angles (°)
1QHT
25-3.0 164,954 / 22,290
99.0 / 91.1 8 . 2 / -
25-2.25 55-813
93.5/61.9 23.9 30.8
--
1D8Y
20-2.08
- / -94.6 /-
- / -
20-2.08 44,062
V-21.7 23.3
0.008 1.33
1TGO
15-3.0 136,953 / 21,529
91.1 / -7 . 0 / -
25-2.5 30,451
91.1/86.0 7.1 (26.2)
20.9 (27.1) 0.008
1.5
phases via multiple isomorphous replacement with a number of native and derivative
crystals due to non-isomorphism [163]. Refinement with these multiple structures
gave a 2.25 A resolution structure with questionable completeness (93.5% / 61.9%)
and moderately different R-factors (23.9% / 30.8%). This structure was solved with
DNA-unbound enzyme.
Tgo (1TGO): Data collection for Tgo gave data from 15-3.0 A resolution with
good completeness (91.1%) and reasonable symmetry (Rsym = 7.0%). Phases were
determined by multiple isomorphous replacement and anomalous scattering with data
from low-salt containing crystals [165]. Refinement yielded a 2.5 A structure with
good completeness (91.1% / 86.0%) and similar R^ys and R/r-ee factors in the outer
shell (26.2% / 27.1%). This structure was solved with DNA-unbound enzyme.
Pol I(KF) (1D8Y, 1KFD): Although extensively studied, there are no crystal
structures available for Pol I (KF) that have dsDNA bound within the catalytic
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 134
groove, presumably because it exists in a highly disordered conformation within this
region [157]. Furthermore, the only crystal structure available for Pol I(KF) with
a nucleotide bound in its active site is, unfortunately, at a relatively low resolution
(3.9 A, 1KFD, [157]). To examine the mechanism of dCTP-Cy5 incorporation by Pol
I(KF), the relative positions of the ribose ring and nitrogenous base from the 1KFD
structure were superimposed on to the 2.08 A resolution DNA-unbound structure
1D8Y. Although any substrate-binding induced conformation changes were lost by
doing in this operation, the RMSD between the two structures was relatively low (0.28
A, which is within experimental error). This suggests that the binding of a nucleotide
results in minimal conformational changes, if any. Larger differences would likely be
seen in dsDNA-bound/unbound structures.
By moving to the higher resolution structure, there is the advantage of being
able to reliably look at individual interactions between the fluorophore and nearby
side chains. The 1D8Y structure was solved to 2.08 A resolution with good total data
completeness (94.6%) and very similar R^orfc/R/ree values (21.7% / 23.3%). Deviation
from r.m.s. bond lengths and bond angles were also acceptable (0.008 A and 1.33°,
respectively). Phases were obtained via molecular replacement with the previously
solved, lower resolution structure (1KLN, [157]).
7.2.2 Sequence Alignment
A total sequence alignment was done pair wise between each of the six polymerases,
and the percent identity and similarity for each of these alignments is illustrated
in Table 7.3. As expected, the primary sequence of the B family polymerase from
Thermococcus gorgonarius (1TGO) shares 91% sequence identity with the B family
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 135
Table 7.3: Pair wise sequence alignment identity and similarity between six polymerases. Values shown are (total identity %, total similarity %). For comparison, each polymerase was also aligned to the DNA-binding protein human topoisomerase I (1A31) and carboxypeptidase A (1ARL).
PDB
1D8Y 1TGO 1QHT 1T7P 1HQU 1A31 1ARL
1QSS
27,43 14,34 15,34 18,40 10,24 9,27 5,16
1D8Y
-
12,33 12,32 20,41 11,32 10,29 6,14
1TGO -
-
91,96 15,33 13,29 6,13 7,13
1QHT
-
--
16,34 9,24 11,28 7,17
1T7P -
---
9,18 12,31 7,19
1J50 -
----
11,23 8,27
polymerase from Thermococcus sp. 9°N-7 (1QHT). Taq also shares some degree of
total similarity with Pol I(KF) (27%, 43%), as do Pol I(KF) and T7 (20%, 41%).
Similarities between the other polymerases are on the same low level as those seen
with another DNA binding protein, human topoisomerase I, with approximately 10%
identity and 25% similarity. All of the polymerases showed very low identity when
compared to the protein-binding enzyme carboxypeptidase with « 7% identity and
15% similarity.
These findings are not unexpected as each of these enzyme families is overall
structurally different, and each is derived from a fairly evolutionary distinct source.
As we shall see, however, the polymerase domains of all of these families show some
striking similarities that may play a role in nucleotide analog incorporation.
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 136
Figure 7.1: 2D structures for R6G-dGTP and Cy5-dCTP. Both of these structures are commonly used as nucleotide analogs for fluorescently labeling DNA for a wide variety of molecular biology applications.
7.3 Accomodating Nucleotide Analogs
Nucleotide analogs with fluorophores attached to the nucleobase typically have linkers
on the 5' position in purine rings or at the 7' position in pyrimidine rings (Figure 7.1).
As a result, the flurophores extend into the volume surrounding the major groove of
DNA and, depending on the length of the linker between the nitrogenous base and the
flurophore, may extend further. The horizontal distance across the planar conjugated
ring system is approximately 10 A and 16 A for R6G and Cy5, respectively. The alkyl
linker allows Cy5 to adopt multiple conformations, which may increase its ability to
adapt its orientation according to the structure of the enzyme. R6G, however, is
limited to fewer conformations due to the presence of a rigid benzyl-ring in the linker
region (Figure 7.1).
Taq Polymerase (Family A): Figure 7.2 illustrates the closed state of the Taq
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 137
Figure 7.2: Crystal structure of Taq polymerase. (A) dsDNA in the active site of Taq polymerase. The template strand is in pink, the nacent strand is in green, and the incoming dNTP is in yellow. (B) There is a large valley that follows along the major groove of the dsDNA that likely accommodates any bound flurophores. (PDB filename: 1QSS; created with PyMol).
polymerase complex after dNTP binding. The nascent base pair is present in a narrow
pocket surrounded by both protein and DNA with one side formed by the O helix in
the fingers domain and the other side formed by the n+1 incorporated dNMP and
template base (Figure 7.2). The "exquisite" tightness of this pocket is thought to
limit only correct Watson-Crick base pairs from forming within it [159]. This closed
complex is formed after the fingers domain of Taq rotate inwards by 46° towards the
active site when the enzyme binds DNA [151]. There do not appear to be any direct
interactions between the O helix and the D loop in this structure, so the distance
between the fingers and thumb domains could be variable, depending on the size of
the substrate. The opening of the pocket is parallel to the plane of the incoming
nucleotide in the region at the start of the major groove (Figure 7.3). Although R587
and R660 appear to interact with incoming nucleotides, their side chains are flexible
and could likely accommodate a fluorophore during synthesis. These two residues are
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 138
Figure 7.3: Close up of the active site of Taq (left) and T7 (right). The DNA template is shown in pink, the primer in green, the incoming nucleotide in yellow, and the enzyme in white. Hydrogen bonds are shown as dashed green lines. In Taq, R587 and R660 interact with the recently incorporated and incoming nucleotides in the major groove space. T7 protein-DNA interactions at the active site are predominantly in the minor groove space.
well positioned to form hydrogen bonds with the carbonyl group on the fluorophore
linker. The flexibility of the linker itself could allow the fluorophore's charged ring
system to associate with nearby oppositely charged amino acids.
After the first modified nucleotide incorporation, there needs to be sufficient space
along the enzyme catalytic groove for subsequent movement of the dye along the
growing DNA strand. In Taq, the minor groove contains multiple hydrogen bond
ing interactions between the protein and the DNA phosphate backbone (Figure 7.3;
[159]), in contrast to the major groove, which forms the floor of a large valley void
of protein (Figure 7.2b). The valley varies in depth from 15-25 A; at the vertical
entrance to the valley, the width varies from 5-15 A across, while near the bottom of
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 139
Figure 7.4: The active site of T7 polymerase. (A) dsDNA in the active site of T7 polymerase. The template strand is in pink, the nascent strand is in green, and the incoming dNTP is in yellow. The overall similarity between T7 and Taq (Figure 2) is clearly evident from the crystal structures. (B) Similar to Taq, there is a large valley that follows along the major groove of the dsDNA that likely accommodates any bound fluorophores. In T7, however, the valley is partly obstructed by a short loop from the palm domain (red) and an inter-domain hydrogen bonding interaction over the valley between Q539 from the fingers domain and E367 from the thumb domain (A - grey residues) (PDB filename: 1T7P; created with PyMol).
the valley, this distance increases up to 25 A. In their full extended form, the fluo
rophores in Figure 7.1 can only extend vertically out of the major groove by 10-12 A
suggesting that this valley is likely critical for the sequential incorporation of fluores-
cently labeled nucleotides. As nascent DNA migrates away from the active site, any
attached fluorophore groups can travel through the valley to minimize unfavorable
electrostatic and steric interactions (Figure 7.3). Given the largely planar structure
of the conjugated ring system in the fluorophore groups, they may create favorable
aromatic stacking interactions by lining up parallel to the major groove.
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 140
T7 (Family A): Protein-DNA interaction at T7's active site primarily occurs
through the minor groove (Figure 7.4), leaving the major groove relatively open and
able to accommodate a fluorescent dye. As with the other family A polymerase Taq,
T7 bound to dsDNA has the major groove largely devoid of protein intrusion. There
are, however, a few notable exceptions: the palm domain contains a short loop region
comprised of amino acids 113-117 that protrudes into the major groove at a point
10-12 bp downstream of the active site, and there is an inter-domain interaction
containing two hydrogen bonds between Q539 of the fingers domain and E367 of
the thumb domain (Figure 7.4). The effect of the palm domain intrusion on initial
incorporation is likely small, although it may influence the fidelity of subsequent
incorporations. The interaction between the fingers and thumb domain could serve
to stabilize the closed form protein-DNA complex, but it also creates a narrower
active site pocket that may limit the space available for the incorporation of modified
nucleotides.
HIV-1 RT (RT Family): While the structure of HIV-1 RT appears to be signif
icantly different from the A and B family of polymerases, it still contains finger, palm,
and thumb domains that surround the active site (Figure 7.5). Like T7, the major
ity of the interactions at the active site are through the minor groove, leaving the
major groove pocket relatively open and available for fluorophore occupation. One
location within the active site minor groove, position 184, appears to be important in
forming Van der Waals interactions ( 3.7 A; this is somewhat questionable given the
3.5 A resolution of this structure) with the incoming nucleotide. It is thought that a
M184I mutation is responsible for RT resistance to inhibitors with unfavourable steric
interactions, such as 2',3'-dideoxy-3'-thiacytidine (Figure 7.5, [161]). GE's CyScript
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 141
Figure 7.5: Crystal structure of HIV-1 reverse transcriptase. (A) Surface representation of HIV-1 RT bound to duplex DNA. As with the A family polymerases, the major groove of DNA bound to HIV-1 RT is largely void of protein, creating space for fluorophore labels. Domains are coloured as previously described. (B) Cartoon illustration of HIV-1 RT, with 1184 labeled in the active site and R356 identified as protruding into the major groove. (PDB filename: 1J50; both figures were created in PyMol).
Reverse Transcriptase contains a number of point mutations at this and other sites
to improve its ability to integrate cyanine-labeled nucleotides into cDNAs, suggest
ing that minor groove steric hindrance may actually be important in fluorophore
incorporation.
Away from the active site, the majority of the protein-DNA interactions continue
to occur through the minor groove [151], with the major groove relatively free from
protein (Figure 7.5). The fact that an open major groove is conserved in both A-family
polymerases and reverse transcriptases suggests there may have been evolutionary
pressures that selected for this property. What biological function, if any, an open
major groove may have during synthesis is unclear. Like T7, there is a short loop
region in the palm domain approximately one alpha helical turn away from the active
site that protrudes slightly into the major groove, most notably by residue R356
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 142
Figure 7.6: Tgo and Vent polymerases. (A) Cartoon illustration of Tgo DNA polymerase with finger, palm, and thumb domains coloured as previously described. Active site residues are identified and shown in yellow. (B) Cartoon illustration of Vent DNA polymerase. (PDB Filenames: 1TGO, 1QHT. Prepared in PyMol).
(Figure 7.5). Due to the low resolution of this crystal structure, however, it is difficult
to make any predictions about how R356 may interact with specific nucleotides.
Tgo/Vent (Family B): Tgo and Vent are both derived from the Thermococcus
genus and therefore have a high degree of structural similarity (Figure 7.6). The total
improved RMSD (calculated with SwissPDV) of these two structures is only 1.04 A,
which is lower than the resolution of the structures themselves, suggesting that their
structural motifs should be largely analogous. The fingers domain and the thumb
domain are separated by a 15 A cleft that contains the residues critical for polymerase
activity (Figure 7.6). Unlike the enzymes previously discussed, where the fingers and
thumb went from an open to closed conformation, the Tgo/Vent finger and thumb
domains appear to go from a closed to open state in order to accommodate duplex
DNA [163]. The closed state seems to be important for thermal stability, as it is
maintained by two disulfide bridges, shortened loops, and an increase in electrostatic
interactions at subdomain interfaces. Reports by Augustin et al. [152] that Tgo
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 143
and Vent have an improved ability over Taq to synthesize DNA exclusively from Cy5-
labeled nucleotides suggest that this conformational change can create sufficient space
for many fluorescently-labeled nucleotides to be incorporated in series. However,
without DNA-bound structures for Tgo or Vent, it is difficult to offer a structural
explanation for where and how much space is created during the transition.
Pol I(KF) (Family A): The overall structure of the polymerase domains of
Taq, T7, and Pol I(KF) are extremely similar [166]. In this structure (Figure 7.7) Pol
I(KF) only has dCTP bound in the active site. The catalytic groove is approximately
10 A wide, 25 A deep, and 20 A tall, with the critical residues along the surface of the
fingers domain. Pol I(KF)'s thumb and finger domains appear much closer together
than in Taq, forming more of a closed groove through the enzyme instead of a valley
(Figure 7.7a). There do not appear to be any finger-thumb domain interactions
like those seen in T7. In this closed conformation, dsDNA cannot reach the active
site without multiple steric conflicts, suggesting that the fingers and thumb domain
undergo a significant "swelling" conformational change like Tgo and Vent in order
to accommodate the double helix upon binding [167]. This is in contrast with fellow
family members Taq and T7, whose finger domains close inwards when the enzyme is
complexed with DNA [160]. This also suggests that Pol I(KF)'s ability to open wide
enough in order to accommodate a DNA strand, an incoming nucleotide, and a bulky
fluorophore group may be a key limiting factor in its ability to incorporate labeled
nucleotides.
Even though the overall conformation of the catalytic groove is likely different
in the dsDNA-bound form of Pol I(KF), this structure can still be used to make
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 144
Figure 7.7: Pol I(KF) fragment with Cy5-dCTP bound. (A) Surface representation of Pol I(KF) with Cy5-dCTP bound at the active site. The fingers domain (gold), thumb domain (cyan), and palm domain (red) are coloured accordingly. Note that this represents the open, DNA-unbound conformation of Pol I(KF). (B) An energy-minimized Cy5-dCTP (blue) in the active site of Pol I(KF) forms a number of favourable interactions with R682, K635, P680, and the N-terminus of a nearby alpha helix. (PDB filename: 1D8Y used in conjunction with 1KFD.
predictions about how a fluorescently labeled nucleotide may interact with the pro
tein at the active site. As illustrated in Figure 7.7, the energy minimized model of
Cy5-dCTP in the active site shows a number of favorable hydrogen bonding interac
tions between the fluorophore SO 3 - group and K635, and between the linker carbonyl
oxygen and R682. There are also Van der Waals packing interactions between the
conjugated fluorophore ring system and the protein backbone around P680 and be
tween the linker and R682 side chain. The alpha helix from E684 to F693 has its
positively charged dipole moment oriented in a position that lines up directly with
the negatively charged it orbitals of the conjugated ring system.
This model is useful in illustrating the relative sizes of the Cy5-dCTP and the
closed conformation of the active site and in identifying potentially favorable interac
tions between the fluorophore and enzyme. However, this model could be, and likely
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 145
is, entirely incorrect for what happens in reality. In the presence of dsDNA, the con
formation of the active site cleft is different and the entire cleft is more crowded. A
lack of space limits the number of conformations available to the Cy5-group and likely
excludes the minimum energy conformation found here. Without a structure of Pol
I(KF) complexed to dsDNA in the active site, it is difficult to predict how or whether
multiple Cy5 moieties could be packed within the cleft. In the present conformation,
taking into account the size and shape of dsDNA from the Taq crystal structure, it
would appear such packing would be limited to three or four groups. This is consis
tent with previously found experimental data that Pol I(KF) is unable to synthesize
more than f«5 bp of DNA exclusively from Cy5-labeled nucleotides [12, 168, 152] but
is capable of synthesizing DNA exclusively from nucleotides tagged with a smaller
fluorophore [167].
This analysis demonstrates that a number of different polymerase families may
accommodate the incorporation of fluorescently modified nucleotides for three main
reasons. First, the major groove of duplex DNA forms the base of a large valley
void of protein intrusion, thereby providing space to any incorporated fluorescently
labeled nucleotides. Second, the flexibility of the fingers domain, combined with the
localized fidelity of the Watson-Crick base pair active site pocket, may further allow
for nucleotides to be processed. Third, the fluorophore group itself may form favorable
interactions with protein side chains both at the active site, along the catalytic groove
as DNA is synthesized, or with other fluorophores. These findings suggest that in
order to engineer a new polymerase with an improved ability to incorporate modified
nucleotides, non-critical residues that occupy the major groove at the active site or
along the valley should be considered for mutation to smaller amino acids. Selecting
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 146
residues to increase finger or thumb domain flexibility or to improve fluorophore
binding is likely beyond the current capabilities of rational protein design.
It would be extremely useful to have crystal structures for each of these poly
merases complexed with DNA and/or dNTPs that have been fluorescently labeled to
varying degrees at different positions. This would allow for validation or improvement
of these proposed models for how polymerases are able to tolerate the incorporation of
modified nucleotides. It may be difficult to solve such structures, however, as the fluo-
rophores can exist in multiple states due to the flexibility of their linkers. Introducing
structural rigidity into the linkers to improve crystallization may have the undesired
effect of reducing incorporation efficiency. Until these issues can be resolved, we are
limited to developing explanations based on existing crystal structures. However,
even these may not be a good model for predicting how fluorescently labeled DNA
interacts with polymerases. In the structures examined here, B-form DNA becomes
A-form within 2-3 bp from the active site [160], which results in a widened DNA major
groove and a narrowed minor groove. Experimental evidence suggests dsDNA with
one strand completely labeled with a dye will undergo a transition from right-handed
DNA to left-handed Z-DNA [167]. While the major groove in A- and B-DNA appears
to have the ability to accommodate bulky fluorophore groups during synthesis, the
major groove in Z-DNA is very shallow and wide. The transition from right-handed
DNA to Z-DNA while in the catalytic groove could open the possibility for numerous
protein-DNA interactions not seen in these crystal structures.
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 147
7.4 Custom Nucleotide Variants
As discussed in the previous sections, commercially available fluorescently-labeled
nucleotides are capable of being incorporated by wild-type DNA polymerases. How
ever, most sequencing-by-synthesis applications require complete replacement of ev
ery dNTP by a labeled dNTP to avoid the creation of sequence gaps. Incorporating
sequentially-labeled dNTPs limits the total read length due to steric hindrance be
tween the fluorophores and the enzyme, fluorophore-fluorophore interactions, or both.
To overcome this limitation, various groups have proposed moving the fluorophore
from the nucleobase to the 7-phosphate [169, 170, 171]. Since DNA polymerases
naturally induce the cleavage of the a — /?-phosphoryl bond upon nucleotide incorpo
ration, these nucleotides release the pyrophosphate leaving group and the attached
fluorescent label simultaneously. The resulting product is natural, "unscarred" DNA.
An alternative approach is to synthesize fluorescently-labeled nucleotides with ei
ther longer [168] or cleavable nucleobase linkers [172, 173, 174, 33], both of which have
demonstrated success in sequencing applications. Reversible terminating nucleotides
have the property of terminating DNA synthesis after incorporation, and have been
reported using either N6-alkyl [175], 3'-0-allyl [176], 3'-0-azidomethyl [33], or 3'-0-
(2-nitrobenzyl) [177] modifications. Removal of the terminating group either optically
or chemically allows for synthesis to proceed. Being able to incorporate a single base
and terminate synthesis for detection is especially important for sequencing through
homopolymer regions.
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 148
hydroxylamine or esterase
•
Figure 7.8: dUTP-17-E-Cy5 with an internal ester group. The \moa{abs) = 650 nm. Addition of hydroxylamine or an esterase results in cleavage of the linker and the release of the fluorophore.
7.5 Longer Linkers with Internal Esters
A novel nucleotide analog, dUTP-17-E-Cy5 (shown in Figure 7.8), contains an internal
ester in the linker between the nucleobase and the fluorophore. This feature facilitates
the cleavage of the tether by either hydroxylamine or esterase enzyme treatment.
dUTP-17-E-Cy5 was chemically synthesized and characterized by Carolyn Woodroofe
and Brian Stoltz at Caltech using a similar approach as previously described [178].
To test the potential biological applications of nucleotide variant, a simple assay
was designed to examine both the efficiency of incorporation and the ability to cleave
the fluorophore with an esterase. Oligos were commercially synthesized (Integrated
DNA Technologies) and the sequences of the primer and template are shown in Fig
ure 7.9. For the assay, 10 fjM primer and template were annealed in 20 mM Tris
100 mM NaCl pH 7.5 buffer. Extension reactions were prepared containing 1 /xM
annealed primer/template, 2.5 units of Pol I(KF) (New England Biolabs), 100 /JM of
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 149
Figure 7.9: The sequences of the primer and template used for the nucleotide assay are shown. dUTP-17-E-Cy5 should incorporate opposite the template adenine bases shown in red.
each dNTP, in # 2 buffer from NEB. Reactions proceeded at 37°C for 1 hour followed
by purification using a QiaQuick Nucleotide Removal Kit (Qiagen) as per the manu
facturer's instructions. Samples were then loaded on a 15% TBE urea polyacrylamide
gel (Invitrogen) and run for 85 minutes at 174V. Gels were imaged on an GE Typhoon
9410 scanner.
The first set of experiments were designed to validate the assay with unlabeled
nucleotides. Figure 7.10 shows that when only one nucleotide was added, Pol I(KF)
only extended the primer if it was dCTP (Lane 5). Further extension was only pos
sible with the addition of the other unlabeled nucleotides (Figure 7.11 Lanes 2,3,5).
Figure 7.10 Lane 6 shows that when dUTP-17-E-Cy5 was added alone, some misin-
corporation occurred against the template guanosine. If dUTP-17-E-Cy5 and dCTP
or dCTP/dGTP were added (Lanes 7 and 8, respectively), the primer was expected
to be extended +2 and +4 nucleotides, respectively. However, the addition of the
dUTP-17-E-Cy5 resulted in a much larger shift between the primer and these prod
ucts. This made interpreting the band sizes of lanes 6-8 difficult, but the general trend
of longer products with more nucleotides was consistent, including with all three un
labeled nucleotides present (Figure 7.11 Lane 1). It was interesting to see that when
the four unlabeled nucleotides were included alongside dUTP-17-E-Cy5 (Figure 7.11,
Lanes 6 and 8), the full unlabeled extension product was detected (41 bp) along with
slower moving, Cy5-labeled products.
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 150
Figure 7.10: Pol I(KF) fidelity with single base extension reactions containing unlabeled and labeled nucleotides, Part I. Green bands show the location of the Cy3-labeled primer; red bands show the location of primers labeled with Cy5. DNA polymerase and the following nucleotide combinations were added: Lane 1- dATP; Lane 2- dGTP; Lane 3- dTTP; Lane 4- LIZ 120 size standard; dCTP; Lane 6- dUTP-17-E-Cy5; Lane 7- dCTP, dUTP-17-E-Cy5; Lane 8- dCTP, dGTP, dUTP-17-E-Cy5.
Figure 7.11: Pol I(KF) fidelity with multiple base extension reactions containing unlabeled and labeled nucleotides, Part II. Lane 1- dCTP, dGTP, dATP, dUTP-17-E-Cy5; Lane 2-dCTP, dTTP; Lane 3- dCTP, dTTP, dGTP; Lane 4- LIZ 120 size standard; Lane 5-dCTP,dGTP,dATP,dTTP; Lane 6- dCTP, dTTP, dGTP, dATP, dUTP-17-E-Cy5; Lane 7- no dNTPs; Lane 8- dNTP mix,dUTP-17-E-Cy5.
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 151
Figure 7.12: Cy5 nucleotides can be incorporated by Pol I(KF). Top: Primer and template used in the nucleotide incorporation assay. The primer is 22 bp long before extension begins. Lane 1- dUTP-10-Cy5; Lane 2- dUTP-17-E-Cy5; Lane 3- dCTP and dUTP-10-Cy5; Lane 4- LIZ 120 size standard; dCTP and dUTP-17-E-Cy5; Lane 6- dCTP, dGTP, dUTP-17-E-Cy5; Lane 7- dCTP, dGTP, dUTP-17-E-Cy5; Lane 8-dCTP; Lane 9- dTTP.
To determine if this effect was specific for dUTP-17-E-Cy5, commercially available
dUTP-10-Cy5 (Amersham Biosciences, now GE Healthcare) was used as a substrate
against the same template (Figure 7.12). In Lane 1 the polymerase was presented
only with the commercially available Cy5-10-dUTP, a nucleotide that should not
be incorporated opposite the template C, and it indeed showed little incorporation.
This was in contrast to Lane 2 where dUTP-17-E-Cy5 was added alone, where a
higher band suggesting incorrect incorporation was clearly evident. Lanes 3 and 5
show the incorporation of dCTP and dUTP-10-Cy5 or dUTP-17-E-Cy5, respectively.
The polymerase now correctly incorporated the commercial dUTP-10-Cy5 to give
the primer +2 product (Lane 3). Fidelity was lost with dCTP and dUTP-17-E-Cy5
(Lane 5 shows a broad smear of extension products) but seemed to improve with the
addition of more nucleotides (Lanes 6-7).
Each of the extension reactions in Figure 7.12 were subsequently treated with
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 152
Figure 7.13: Nucleotides with ester-containing linkers can be cleaved with an esterase. Lane assignments are as in Figure 7.12.
100 units of esterase from porcine liver (Sigma Aldrich) in 75 ^L 10 mM boric acid
buffer, pH 8.0. At 15 minute intervals, 0.77 /xL of 100 fjM NaOH was added to each
reaction and mixed well. After 1 hour of incubation, the reactions were purified using
the QiaQuick kit and run on a gel as described above. The scanned gel showing the
cleavage products is shown in Figure 7.13. Esterase treatment resulted in decrease of
fluorophore from lanes 2, 4, and 7 as expected, but there was also a general reduction
in signal in all lanes. This may be due to nonspecific nuclease activity resulting in
widespread DNA hydrolysis (Sigma claims that the esterase is at least 95% pure).
In any case, the promiscuity of Pol I(KF) to incorporate this nucleotide opposite the
wrong base under certain nucleotide conditions is cause for concern.
7.6 Prospects
While linkers containing esters and other cleavable groups show promise for sequenc
ing applications, the dUTP-17-E-Cy5 analog examined here requires additional work
to improve its fidelity. Using enzymes to cleave fluorophore linkers is also clearly
CHAPTER 7. DNA POLYMERASES AND NUCLEOTIDE ANALOGS 153
troublesome due to issues associated with purity and specificity. Linkers that can be
cleaved chemically or with light are promising alternatives and are worth exploring
further.
Appendix A
C + + Code for Monte Carlo
Simulations
Listing A.l: Example C + + code for Monte Carlo simulations
i / / a simple program that generates N molecules at random X—Y coordinates
and determines
// the number of resolvable features based on a set diffraction limit.
3 ̂ include <iostream>
#include < c s t d l i b >
5 #include <ctime>
#include <cmath>
7 #include <va la r ray>
#include <fstream>
9
#def ine M 75 / / define the grid length and width
ii #def ine DIFFDIST 1 / / set the diffraction limit to a distance of 1 unit
using namespace std ;
13
154
APPENDIX A. C++ CODE FOR MONTE CARLO SIMULATIONS
i n t ma in ( )
15 {
c o n s t c h a r *FILENAME = " F I L E 0 2 0 4 0 9 - 7 5 . t x t " ; / / filename to
output data
17 u n s i g n e d i n t S1=0;
l ong Nmax=20000;
19 v a l a r r a y < f l o a t > X l (20000) ;
v a l a r r a y < f l o a t > Y l ( 2 0 0 0 0 ) ;
21 v a l a r r a y < i n t > u l ( 2 0 0 0 0 ) ;
//float dist [500][500j;
23 f l o a t d = 0 ;
/ / set evil seed
25 s r a n d ( ( u n s i g n e d ) t i m e ( NULL));
/ / open file to write data to
27 o f s t r e a m fout (FILENAME) ;
for ( i n t N = l ; N<8000; N+=200) / / run the simulation for N=l
N=8000
29 {
s t d :: cout « N « " J ' ;
3i fout « N « " J' ;
for ( i n t c t r = 0 ; c t r < 5; c t r + + ) / / run 5 simulations
each N
33 {
for ( i n t a =0 ; a < N; a++)
35 {
X l [ a ] = 0 ;
37 Y l [ a ] = 0 ;
u l [ a ] = 0 ;
39 }
A. C++ CODE FOR MONTE CARLO SIMULATIONS 156
for ( i n t c = 0; c < N; C++) / / generate random
X—Y positions
{
XI [c]=M*( f l o a t ) r and ()/RANDJVtAX; / /
for random positions
Yl [ c]=M* ( f l o a t ) rand () /RMCLMAX;
/ / XI[c]= int (M*(float)rand()/RANDMAX);
//for binning
// Yl[c]= int (M*(float)rand0/RANDMAX);
// font « Xl[c] « " " « Yl[c] « " ";
// write coordinates to file for debugging
}
for ( i n t i = 0; i < N; i++) / / compare array
against itself
{
for ( i n t j = i + 1 ; j < N; j + + )
{
d = s q r t ( ( X l [ i ] - X l [ j ] ) * ( X l [ i ] - X l [ j
] ) + ( Y l [ i ] - Y l [ j ] ) * ( Y l [ i ] - Y l [ j
] ) ) ;
i f (d < DIFFDIST && i != j )
{
u l [ i ] = l ; / / set the
index for each
molecule to 1
u l [ j ] = l ;
}
APPENDIX A. C++ CODE FOR MONTE CARLO SIMULATIONS 157