-
CLINICAL CANCER RESEARCH | TRANSLATIONAL CANCER MECHANISMS AND
THERAPY
Targeting Super-Enhancer–Associated Oncogenes inOsteosarcoma
with THZ2, a Covalent CDK7 Inhibitor A CJiajun Zhang1, Weihai Liu1,
Changye Zou1, Zhiqiang Zhao1,2, Yuanying Lai3, Zhi Shi4, Xianbiao
Xie1,2,Gang Huang1,2, Yongqian Wang1,2, Xuelin Zhang1, Zepei Fan1,
Qiao Su5, Junqiang Yin1,2, andJingnan Shen1,2
ABSTRACT◥
Purpose: Malignancy of cancer cells depends on the active
tran-scription of tumor-associated genes. Recently, unique clusters
oftranscriptional enhancers, termed super-enhancers, have
beenreported to drive the expression of genes that define cell
identity. Inthis study, we characterized specific
super-enhancer–associated genesof osteosarcoma, and explored their
potential therapeutic value.
Experimental Design: Super-enhancer regions were
characterizedthrough chromatin immunoprecipitation sequencing
(ChIP-seq). RT-qPCR was used to detect the mRNA level of CDK7 in
patient speci-mens and confirm the regulation of sensitive
oncogenes by THZ2. Thephosphorylation of the initiation-associated
sites of RNA polymeraseII (RNAPII) C-terminal repeat domain (CTD)
was measured usingWestern blotting. Microarray expression analysis
was conducted toexplore transcriptional changes after THZ2
treatment. A variety ofin vitro and in vivo assayswere performed to
assess the effects ofCDK7knockdown and THZ2 treatment in
osteosarcoma.
Results: Super-enhancers were associated with
oncogenictranscripts and key genes encoding cell-type–specific
transcrip-tion factors in osteosarcoma. Knockdown of transcription
factorCDK7 reduced phosphorylation of the RNAPII CTD, andsuppressed
the growth and metastasis of osteosarcoma. A newspecific CDK7
inhibitor, THZ2, suppressed cancer biology byinhibition of
transcriptional activity. Compared with typicalenhancers,
osteosarcoma super-enhancer–associated oncogeneswere particular
vulnerable to this transcriptional disruption.THZ2 exhibited a
powerful anti-osteosarcoma effect in vitroand in vivo.
Conclusions: Super-enhancer–associated genes contribute
tothemalignant potential of osteosarcoma, and selectively
targetingsuper-enhancer–associated oncogenes with the specific
CDK7inhibitor THZ2 might be a promising therapeutic strategy
forpatients with osteosarcoma.
IntroductionOsteosarcoma is the most common primary malignant
bone
tumor, and the second leading cause of cancer-related death
inchildren and adolescents (1). Rapid tumor progression and
earlymetastasis account for medical therapy failure and death in
patientswith osteosarcoma. Currently, the 5-year survival rate has
beenincreased to 60% to 70% with the use of neoadjuvant
chemotherapy,but the rate is only 20% for patients with metastatic
disease (2).Therapeutic outcomes remain unsatisfactory mainly
because ofdelayed diagnosis, distant metastasis, and
chemoresistance. Inaddition, standard adjuvant/neoadjuvant
chemotherapy has no
significant antineoplastic effect in a portion of patients with
oste-osarcoma (3). Furthermore, there have been no advances in
over-coming chemoresistance in the past two decades (4). Much of
theproblem is due to a lack of understanding of the mechanisms
whichdrive the malignant properties of osteosarcoma. Thus, it is
impor-tant to elucidate the pathogenesis of osteosarcoma and
developmore effective treatment regimens.
Studies have shown that most cancer cells have a higher
overalltranscriptional output than nonmalignant cells, allowing for
moreopportunities to engage oncogenic pathways (5). The
malignantproperties of tumors such as rapid proliferation,
invasion, and metas-tasis require continually active transcription.
Enhancers, cis-actingregulatory elements localized distal to
promoters and transcriptionstart sites, play important roles in
cell identity by controlling cell-type–specific patterns of gene
expression, and there can be tens of thousandsactive in any one
cell type (6–8). Studies have shown that theupregulated expression
of tumor cell oncogenes is always associatedwith large clusters of
transcriptional enhancers in close genomicproximity, which have
been termed super-enhancers, and that tran-scription of oncogenes
is particularly sensitive to the disruption ofsuper-enhancers
(9–12).
Super-enhancers have been identified in many cell types,
andrelations between super-enhancers, gene regulation, and disease
havebeen identified (13, 14). Studies have shown that the
transcription ofmany oncogenes, including MYC (15), STAT3 (9, 13),
EGFR (10),and TAL1 (16), are related to super-enhancer activity.
Some super-enhancer–associated oncogenes such as PAK4 (12) and
INSM1 (11)have been identified as novel therapeutic targets.
Furthermore, theexpression of most super-enhancer–associated genes
can be blockedby selective inhibition of their super-enhancers.
Because the association between tumorigenesis and
super-enhancers was reported in 2013 (9), studies have shown that
super-
1Department of Musculoskeletal Oncology, The First Affiliated
Hospital of SunYat-sen University, Guangzhou, China. 2Guangdong
Provincial Key Laboratoryof Orthopedics and Traumatology, The First
Affiliated Hospital of Sun Yat-senUniversity, Guangzhou, China.
3Department of Pharmacology, Medical College,Jinan University,
Guangzhou, China. 4Department of Cell Biology & Institute
ofBiomedicine, College of Life Science and Technology, Jinan
University, Guangz-hou, China. 5Department of Animal Experiment
Center, The First AffiliatedHospital of Sun Yat-sen University,
Guangzhou, China.
Note: Supplementary data for this article are available at
Clinical CancerResearch Online
(http://clincancerres.aacrjournals.org/).
J. Zhang, W. Liu, C. Zou, and Z. Zhao contributed equally to
this article.
Corresponding Authors: Jingnan Shen, The First Affiliated
Hospital of Sun Yat-sen University, Zhongshan 2 Road, Guangzhou
510080, China. Phone:86 020 87335039; Fax: 86 20 87332150; E-mail:
[email protected];Junqiang Yin, [email protected]; and
Qiao Su, [email protected]
Clin Cancer Res 2020;XX:XX–XX
doi: 10.1158/1078-0432.CCR-19-1418
�2020 American Association for Cancer Research.
AACRJournals.org | OF1
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-19-1418&domain=pdf&date_stamp=2020-4-1http://crossmark.crossref.org/dialog/?doi=10.1158/1078-0432.CCR-19-1418&domain=pdf&date_stamp=2020-4-1http://clincancerres.aacrjournals.org/
-
enhancers play a role in many cancers, including breast (17,
18),colon (13, 17), lung (9, 11), brain (19), liver (20, 21),
prostate (13), andpancreatic (22) cancer, as well as various types
of leukemia (13, 23–25).However, the role of super-enhancers in
osteosarcoma is largelyunknown.
Super-enhancers are occupied by an unusually large portion of
theenhancer-associated RNA polymerase II (RNAPII), cofactors,
andchromatin regulators. Genes that are dependent on the high
tran-scriptional activity of super-enhancers are exquisitely
susceptible toalterations of transcription (9, 26). CDK7 is a
cyclin-dependent kinase(CDK) and a subunit of the multiprotein
basal transcription factorTFIIH. It has been implicated in the
regulation of cell-cycle progres-sion and regulation of
transcription, where it phosphorylates the C-terminal domain (CTD)
of RNAPII (27, 28). Recent studies haveshown that
super-enhancer–associated genes are particularly sensitiveto small
perturbations in RNAPII-mediated transcription and CDK7kinase
function (29). A newly developed molecular inhibitor, THZ2,can
completely inhibit the phosphorylation of the intracellular
CDK7substrate RNAPII CTD at Ser-2, -5, and -7 through
irreversiblecovalent binding to CDK7 (10). It has been reported
that THZ2 cansuppress the growth of triple-negative breast cancer
(30) and gastriccancer (31). However, the anticancer effect of THZ2
in other cancers isstill unknown.
In this study, we delineated the super-enhancer landscape
inosteosarcoma cells on the basis of H3K27ac signal intensity
bychromatin immunoprecipitation sequencing (ChIP-seq; ref. 13).
Onthe basis of the sensitivity of super-enhancer–associated genes
totranscriptional disruption and the high expression of CDK7 in
oste-osarcoma specimens frompatients, we explored the
anti-osteosarcomaeffects of CDK7 inhibition by short hairpin RNA
(shRNA) and THZ2.Microarray expression analyseswere performed to
detect transcriptionalterations after treatment with THZ2, and it
was found that THZ2selectively suppressed super-enhancer–associated
genes which areenriched in processes important to cancer biology. A
variety ofin vitro and in vivo cellular assay were preformed to
assess theantitumor effects of THZ2.
Materials and MethodsHuman cell lines
Human osteosarcoma cell lines SJSA-1, U2-OS, HOS,
G-292,MNNG/HOS, 143B and MG-63, the osteoblast cell line
hFOB1.19,and HEK-293T cells were obtained fromATCC. U2OS/MTX300
cells,amethotrexate-resistant derivative of theU2-OS human
osteosarcomacell line, were kindly provided by Dr. M. Serra
(Instituti OrtopediciRizzoli, Bologna, Italy). The ZOS and ZOS-M
cell lines, derived from aprimary osteosarcoma tumor and
metastasis, respectively, have beendescribed previously (32). All
of the cells used were authenticatedbefore experiments, and were
cultured according to instructions fromATCC.
Compounds and reagentsTHZ2, a novel covalent inhibitor of CDK7,
was a gift fromProfessor
Zhi Shi (National Engineering Research Center of Genetic
Medicine,Jinan University, Guangzhou, China; 510632). Antibodies
againstH2K27ac (#ab4729), b-actin (#ab8227), Cyclin D1 (#ab134175),
andtotal/cleaved-PARP (#ab191217) were purchased from Abcam.
Anti-bodies against RNAPII (#A300-653A), RNAPII-CTD-SER2
(#A300-654A), and RNAPII-CTD-SER5 (#A304-408A) were purchased
fromBethyl Laboratories. Antibodies against RNAPII-CTD-SER7
(#04-1570-I) were purchased from Millipore. Antibodies against
CDK7(#2916T) and P21 (#2947P) were purchased from Cell
SignalingTechnology.
Chromatin immunoprecipitation and sequencing data analysisThe
ChIP assays were performed according to the manufacturer's
instructions (Millipore). In brief, U2-OS and SJSA-1 cells were
cul-tured at 37�C in 5%CO2, andwere cross-linked with 1%
formaldehydeat room temperature for 10minutes followed by
neutralization withglycine. Cells were resuspended, lysed in lysis
buffer, and sonicated onice to shear most DNA to 200 to 750 bp.
Magnetic beads were boundwith 10 mg of the indicated antibody
(anti-H3K27ac, #ab4729;Abcam). For immunoprecipitation, sonicated
chromatin solutionswere incubated at 4�C overnight with magnetic
beads bound withantibody to enrich for DNA fragments bound by the
indicatedantibody. Beads were washed three times with sonication
buffer, andtwo times with low stringency wash buffer. DNA was
eluted in elutionbuffer. RNA and protein were digested using RNase
A (#70856;Millipore) and Proteinase K, respectively, and DNA was
purified withphenol chloroform extraction and ethanol
precipitation.
Illumina sequencing libraries were generated, and data were
pro-cessed as described by Lin and colleagues (5). In brief,
libraries weregenerated for ChIP samples following
theNEBNextUltraDNALibraryPrep Kit for Illumina protocol. The reads
that passed the prefilteringstep were aligned with Bowtie2 v2.2.5
software to the human genome(hg19). MACS2 was used to identify
enriched regions as enhancerswith a threshold Q-value
-
Microarray sample preparation and analysisTotal RNA was
extracted from U2-OS or SJSA-1 cells treated
with DMSO (control) and different doses of THZ2,
respectively,using TRizol reagent (Invitrogen) according to
manufacturer'sinstructions. An Affymetrix GeneChip PrimeView Human
GeneExpression Array was used for the microarray analysis.
Thehybridization data were analyzed using Affymetrix
GeneChipCommand Console Software. Microarray data were
normalizedusing the robust multiarray average (RMA) method, and
expres-sion values were calculated with the Affy Suite of the
Biocon-ductor Package (http://www.bioconductor.org), using
quantilenormalization of the RMA method (each calculation
performedat the individual probe level). Fold-changes were
calculated bysubtracting average log2 DMSO signal from average log2
THZ2treatment signal. Active transcripts of each cell were defined
asaverage log2(expression) > log2(100) in the corresponding
DMSOsample.
Gene set enrichment analysisGene set enrichment analysis (GSEA)
was performed using GSEA
standalone desktop software (http://www.broadinstitute.org/gsea)
todetermine whether the set of super-enhancer–associated genes
wassensitive to THZ2. All super-enhancer–associated genes of each
cellline were used as gene sets, respectively, and the
correspondingexpression values of the samples treated with
different concentrationsof THZ2 were used as the expression data
set.
Cell transfectionLentiviral shRNAs andmatching scrambled control
constructs were
purchased from Genecopoeia. Four shRNA sequences were
designedfor each gene and cloned into an expression plasmid. The
targetingsequences of the best shRNA (CDK7 shRNA #1:
CATACAAGGCT-TATTCTTA; #2: GGCTTATTCTTATTTAATCCA) were selected
forfurther experiments. The stable cell lines were transfected
withrecombinant lentiviruses in the presence of 8 mg/mL
polybreneaccording to the manufacturer's instructions, and then
selected withpuromycin. Puromycin (1 mg/mL) was used to treat cells
for 2 daysfor selection, which eliminated all cells in an
uninfected controlgroup. Samples of protein were taken for Western
blotting assays at1 week after selection.
Cell viability assayOsteosarcoma cells were plated in 96-well
plates at a density of 2,000
cells/well. A total of 1,000 cells were plated per well for
time–responseassay. They were treated with different concentrations
of THZ2, ortransfected with 100 nmol/L targeting shRNA. After the
indicatedtimes, 20 mL ofMTT (5 mg/mL) was added to each well, and
the plateswere incubated at 37�C for 4 hours. Then, themediumwas
replaced by150mLDMSOandmixed thoroughly. The absorbancewas
determinedat 490 nm using a microplate reader. The assay was
performed intriplicate.
Clone formation assayOsteosarcoma cells or cells transfected
with plasmids were plated in
triplicate at 500 cells/well in six-well plates with 2mLDMEM
contain-ing 10%FBS. In theTHZ2 experiment, plated cells were
incubatedwithDMSO or THZ2 for 48 hours. Colonies containing >50
cells werecounted after 10 days by staining with crystal violet.
Data werepresented as mean � SD from three independent experiments
intriplicate wells.
In vitro migration and invasion assaysCell migration and
invasion assays were performed using Transwell
cell culture chambers with 8-mm microporous filters that
wereprecoated and pre-uncoated with extracellular matrix coating
(BDBiosciences), respectively, according to the manufacturer's
instruc-tions. For the experiments, 200 mL of osteosarcoma cell
suspensions(5 � 104 cells/mL) in serum-free DMEM were seeded in the
upperchambers in 24-well plates and 500 mL of DMEM containing 10%
FBSwas added to the bottom chamber. After 24 hours, the cells in
the upperchamber were removed, and the cells on the lower surface
of the filterwere fixed, stained, and the number in five random
fields was countedunder a light microscope. Data were presented as
mean � SD fromthree independent experiments in triplicate
chambers.
Mouse xenograftAnimal experiments were approved by the
Institutional Review
Board of The First Affiliated Hospital of Sun Yat-sen
University, andwere performed according to established guidelines
for the Use andCare of Laboratory Animals. Female nude mice, 4 to 6
weeks old, werepurchased from Shanghai SLAC Laboratory Animal Co.
Ltd. After themice were anesthetized with isoflurane, wild-type or
plasmids trans-fected SJSA-1 cells were inserted to the proximal
tibia through thecortex of the anterior tuberosity using a 30-gauge
needle. In total, 20mLof the cell suspension was slowly injected in
the upper hole.
For study of THZ2, the mice were randomly separated into
twogroups after about 2 weeks when a tumor volume of
approximately200 mm3 was reached. The mice were treated with 10%
DMSO inD5W (5% dextrose in water) or 10 mg/kg THZ2 in vehicle
twicedaily by intraperitoneal injection. The mice were monitored
every3 days for a total of 3 weeks. As the tumors grew as almost
sphericalellipsoids, the size of tumors was measured in two
perpendiculardimensions (D1, D2). The body weight of the mice was
alsorecorded. The tumor volume was calculated using the formulaV ¼
4/3p [1/4 (D1 þ D2)]2, as described previously (33). Themice were
killed, and the lungs were harvested, fixed in formalin,and stained
with hematoxylin and eosin (H&E). The number ofmetastatic
nodules in the lungs was counted.
Western blottingWestern blotting was performed as described
previously (34). In
brief, cells were lysed in RIPA buffer containing protease
inhibitor andphosphatase inhibitor cocktails (Roche), and the cell
debris wereremoved by centrifugation (12,000 � g, 10 minutes).
Equal amountsof protein were boiled for 10 minutes, resolved by
SDS-PAGE, andtransferred to a polyvinylidene difluoride membrane
(Millipore).Membranes were blocked in 5% nonfat dry milk with TBST
for 1 hourat room temperature, and then incubated with primary
antibodyovernight at 4�C. After washing three times with TBST, the
mem-branes were incubated with corresponding secondary
antibodies.Immunoreactive proteins were then visualized using ECL
detectionreagents (Millipore).
RNA extraction and RT-qPCRTotal cellular RNA was extracted using
TRizol reagent (Invitrogen)
according to the manufacturer's instructions.
Reverse-transcriptionwas performed using a PrimeScript RT Reagent
Kit (Takara). qPCRwas performed using SYBR Premix (Takara) on a
Real-Time PCRSystem (ABIViiATM7Dx). All reactions including the no
RT and notemplate control were carried out in a 20 mL reaction
volume andperformed in triplicate. The protocol included denaturing
for 30
Targeting Super-Enhancer–Associated Genes in Osteosarcoma
AACRJournals.org Clin Cancer Res; 2020 OF3
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://www.bioconductor.orghttp://www.broadinstitute.org/gseahttp://clincancerres.aacrjournals.org/
-
seconds at 95�C, 40 cycles of two-step PCR including denaturing
for5 seconds at 95�C and annealing for 34 seconds at 60�C, with
anadditional 15-second detection step at 95�C, followed by a
meltingprofile from 60�C to 95�C at a rate of 0.5�C per 10 seconds.
Primersequences were provided by PrimerBank
(http://pga.mgh.harvard.edu/primerbank/). The relative amount of
target gene mRNA wasnormalized to that of GAPDH.
The reverse-transcription and qPCR of the miRNA was
performedusing a Mir-X miRNA First-Strand Synthesis Kit (Takara).
Theprotocol included denaturing for 10 seconds at 95�C, 40 cycles
oftwo-step PCR including denaturing for 5 seconds at 95�C and
anneal-ing for 20 seconds at 60�C, with an additional 60-second
detection stepat 95�C, followed by a melting profile from 55�C to
95�C at a rate of0.5�C per 10 seconds. MIR21 primer sequences were
designed andprovided by Generay Co. Ltd. The RT-qPCR primer
sequences usedare shown in Supplementary Table S3. Results of the
validation of thespecificity and efficiency of all primers are
provided in SupplementaryFig. S5.
Patients and clinical databaseTo determine the specific
expressions of the studied genes in
different tissues, 35 pairs of osteosarcoma and para-carcinoma
tissuesfrom 35 patients treated at The First Affiliated Hospital of
Sun Yat-senUniversity, Guangzhou, between March 1, 2003, and
December 31,2018, were retrospectively examined. Histologic type
was confirmedprior to our experiments by pathologists from the
Clinical PathologyDepartment of the hospital. This retrospective
analysis of anonymousdata was approved by the Institutional Review
Board of The FirstAffiliated Hospital of Sun Yat-sen University and
conducted inaccordance with Declaration of Helsinki.
Statistical analysisAll data were derived from at least three
independent experiments,
and the results were expressed asmean� SD. Student t test or
one-wayANOVA was used to analyze differences between groups. A
value ofP < 0.05 was considered to indicate a statistically
significant difference.Statistical analyses were performed with
SPSS version 20.0 software(SPSS Inc.).
Data availabilityChIP-seq and gene expression microarray data
are deposited in
GEO: GSE134605.
ResultsCharacterization of super-enhancers in osteosarcoma
cells
Super-enhancers in osteosarcoma cells were identified
throughChIP-seq against the H3K27ac modification (26). We
identified 308super-enhancer–associated genes in the U2-OS cell
line, and 1,526in the SJSA-1 cell line (Fig. 1A; Supplementary
Table S1). Com-pared with typical enhancers based on the ChIP-seq
data set, super-enhancers were specifically enriched with the
H3K27ac signal indistance and density (Fig. 1B). Interestingly, we
observed a numberof top-ranking super-enhancer–associated genes
that have beenproven to be associated with osteosarcoma oncogenic
transcripts inprevious studies, such as MYC (35), PIM1 (36), TCF7L2
(37), andHMOX1 (38). In addition to coding RNAs, these
super-enhancershave been reported to drive the expression of long
noncoding RNAssuch as MALAT1 (39), and miRNAs such as MIR663B (40)
andMIR21 (41), which have been reported to contribute to
osteosar-coma malignancy. In addition, some genes encoding
lineage-
specific transcription factors which regulate skeletal
development,such as GLI2 (42), LIF (43), MDM2 (44), RUNX2 (45),
andEGFR (46), were found to be associated with super-enhancers(Fig.
1A and C).
Gene ontology (GO) analysis was performed to explore
thefunctional enrichment of the identified
super-enhancer–associatedgenes. We found that many genes were
significantly involved in (i)regulation of RNAPII and
transcriptional factor-related transcrip-tion, (ii) skeletal system
and cell development, and (iii) tumor-related functions including
cell proliferation, apoptotic processes,and cell migration (Fig.
1D; Supplementary Table S1). The super-enhancers were also
associated with genes enriched in skeletaldiseases, cancers, and
related essential signaling pathways (Supple-mentary Figs. S1A and
S1B; Supplementary Table S1). These resultsindicated that the
super-enhancer–associated genes in osteosarcomacells were
hyperactive, and may promote the development andmalignancy of
osteosarcoma.
CDK7was upregulated in osteosarcoma and plays an oncogenicrole
in osteosarcoma cells
Super-enhancers are able to drive high-level expression of
associ-ated transcripts, and are vulnerable to perturbation of
transcriptionalactivity through bound transcription factors and
coactivators (26). Ithas been reported that
super-enhancer–associated genes encode geneproducts involved in
regulation of RNAPII-mediated transcription,and many transcription
factors are important for cancer states andmight represent
candidate oncogenes (11). CDK7 is a component ofthe general
transcription factor IIH, which regulates RNAPII initiationand
elongation (47). Compared with normal tissue, the expression ofCDK7
was significantly higher in tumor tissues from 35 patients
withosteosarcoma (Fig. 2A). We retrieved the expression data of
CDK7from the GEO database (GSE36001), and found that the expression
ofCDK7 in osteosarcoma tissues is higher than in normal bone (Fig.
2B).
To explore the role of CDK7 in osteosarcoma, we depleted
CDK7expression in U2-OS and SJSA-1 cells by shRNA-mediated
knock-down. Decreased phosphorylation of initiation-associated
serine 5(S5) and serine 7 (S7), and of elongation-associated serine
2 (S2) of theRNAPII CTD, which are regulated by CDK7, were observed
in bothcell lines (Fig. 2C). The MTT, colony formation, and
Transwell assaysdemonstrated a significant decrease in osteosarcoma
cell growth,migration, and invasion, respectively, after knockdown
of CDK7(Fig. 2D–F).
To further confirm the antitumor potential of
downregulatingCDK7, we established an osteosarcoma orthotropic
animal model byinjecting stable knockdown SJSA-1 cells or control
in nude mice. Theresults indicated that tumor volume and weight
were dramaticallydecreased in the CDK7 knockdown groups compared
with the controlgroup (Fig. 2G and H; Supplementary Fig. S2A). In
addition, oste-osarcoma xenograft metastasis to the lungs was also
decreased afterCDK7 knockdown (Supplementary Fig. S2B).
These observations indicate that suppressing the
phosphorylationof RNAPII CTD by targeting CDK7 has promising
anti-osteosarcomaeffects.
Selective suppression of super-enhancer–associated genes bythe
specific CDK7 inhibitor, THZ2
On the basis of the biological process enrichments of
super-enhancer–associated genes and the experimental results thus
far,we hypothesized that suppressing CDK7 activity could inhibit
themalignant properties of osteosarcoma through targeting the
super-enhancer–associated genes involved in osteosarcoma
pathogenesis.
Zhang et al.
Clin Cancer Res; 2020 CLINICAL CANCER RESEARCHOF4
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://pga.mgh.harvard.edu/primerbank/http://pga.mgh.harvard.edu/primerbank/http://pga.mgh.harvard.edu/primerbank/http://clincancerres.aacrjournals.org/
-
To explore the correlations between CDK7 and
super-enhancer–associated genes, and find an innovative and
effective drug againstosteosarcoma, we used THZ2, a new CDK7
inhibitor (10, 12), tosuppress the CDK7 activity of osteosarcoma
cells. A dose-
dependent decrease in phosphorylation at S2, S5, and S7
withincreasing THZ2 concentration was observed in U2-OS and
SJSA-1cell lines (Fig. 3A). Gene expression profiling was then
performedto investigate THZ2-induced transcription alterations, and
identify
Figure 1.
Super-enhancers in osteosarcoma cells are associated with
oncogenic and lineage-specific genes. A, Enhancers ranked by
increasing H3K27Ac ChIP-seq signal(length � density, input
normalized) in their stitched regions. B, The mean density of the
H3K27ac signal in typical enhancers and super-enhancers of
theosteosarcoma cell lines.C,ChIP-seq binding profiles at
representative super-enhancer–associated gene loci in both cell
lines.D, Selected GO functional categories ofthe osteosarcoma
super-enhancer–associated genes.
Targeting Super-Enhancer–Associated Genes in Osteosarcoma
AACRJournals.org Clin Cancer Res; 2020 OF5
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://clincancerres.aacrjournals.org/
-
the subsets of sensitive genes in these two osteosarcoma cell
lines.Cells were treated with 25, 100, and 400 nmol/L THZ2 for 6
hours(Fig. 3B; Supplementary Table S2). We observed there were a
smallnumber of sensitive genes that began to be downregulated at
aconcentration of 100 nmol/L in both cell lines (Fig. 3C).
GOanalysis showed many subsets of the sensitive genes were
involvedin transcriptional regulation, cell-cycle regulation,
apoptotic pro-cesses, and other critical cellular functions with
respect to osteosar-coma (Fig. 3D). The sensitive genes identified
are also involved inskeletal diseases, musculoskeletal diseases,
cancers, and a number ofpathways in various cancers, similar to
that of the super-enhancer–associated genes we identified
(Supplementary Figs. S3A and S3B).
We sought to explore whether super-enhancer–associated
genes,including oncogenes, are disproportionately suppressed by
CDK7
inhibition. We observed that an abundance of
super-enhancer–associated transcripts were preferentially
downregulated upon THZ2treatment as compared with that of
typical-enhancers (Fig. 3E). GSEAof all active transcripts after
treatment with 100 nmol/L THZ2 showedthat these THZ2-sensitive
geneswere significantly enriched in the genesets associated with
super-enhancers (Fig. 3F). Notably, many super-enhancer–associated
genes, which have been reported to be involved inthe malignant
potential of osteosarcoma, such as MYC (35),RUNX2 (45),MDM2 (44),
SRSF3 (48), and TCF7L2 (49), were amongthe top 10% sensitive to
THZ2 treatment (Fig. 3G). The downregula-tion of these critical
osteosarcoma-related genes was confirmed on theRNA level by qPCR
(Fig. 3H).
These results suggested that super-enhancer–associated
genes,especially osteosarcoma-related genes, were particularly
vulnerable to
Figure 2.
CDK7 inhibition suppressed growth of osteosarcoma in vitro and
in vivo. A, Comparative quantification of CDK7 mRNA in paired
primary osteosarcoma tissues andno-tumor tissues from 35 patients.
Data represent mean � SD. B, CDK7 mRNA expression of normal bone
and osteosarcoma tissues from data sets GSE36001downloaded from
gene expression omnibus (GEO). Data representmean� SD.C,
Immunoblotting analyses of RNAPII, RNAPII CTDphosphorylation (S2,
S5, and S7),and CDK7 in U2-OS and SJSA-1 cells stably transfected
with shRNA targeting CDK7. D, MTT assay and (E) colony formation
assay were used to evaluate the cellgrowth of U2-OS and SJSA-1. The
suppression of CDK7 dramatically inhibited the growth of
osteosarcoma cells. Data represent mean � SD. F, The suppression
ofCDK7 significantly reduced themigration/invasion ability of the
osteosarcoma cells by Transwell assay.Data representmean�SD.G,Tumor
growth curves ofmice inwhich CDK7 knockdown and control-SJSA-1
cells implanted in the proximal tibia. Data represent mean � SD. H,
Photographs of resected tumors from control andknockdown groups
excised on day 35 (� , P < 0.05; �� , P < 0.01; ���, P <
0.001).
Zhang et al.
Clin Cancer Res; 2020 CLINICAL CANCER RESEARCHOF6
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://clincancerres.aacrjournals.org/
-
inhibition of CDK7, and THZ2 might be a potential
anti-osteosarcoma agent through selective targeting
super-enhancer–associated oncogenes.
THZ2 suppresses proliferation and metastatic potential
inosteosarcoma cells
To investigate the effect of THZ2 on osteosarcoma cells,
dose–response experiments showed that all 10 osteosarcoma cell
lineswere highly sensitive to THZ2, with IC50 values in the range
of 57.6to 719.4 nmol/L, which is much lower than that of a
human
osteoblast cell line (hFOB1.19) of 2210.4 nmol/L (Fig. 4A).
Atconcentrations as low as 25, 50, or 100 nmol/L, THZ2
potentlyreduced cell viability of U2-OS and SJSA-1 in a
time-dependentmanner, but not hFOB 1.19 (Fig. 4B). To further
corroborate theantiproliferative effect of THZ2, a colony-formation
assay wasperformed which showed that THZ2 decreased colony
formationfrom transplanted osteosarcoma cells (Fig. 4C).
Metastasis and invasion are also key processes during
tumordevelopment and progression. Experiments using the
osteosarcomacell lines U2-OS, SJSA-1, 143B, and MG-63 showed that
THZ2
Figure 3.
Super-enhancer–associated genes in osteosarcoma cells are
particularly sensitive to THZ2 treatment. A, Immunoblotting
analyses of RNAPII, RNAPII CTDphosphorylation (S2, S5, and S7), and
CDK7 in U2-OS and SJSA-1 cells treated either with THZ2 or DMSO at
the indicated concentrations for 6 hours. B, Heatmapshowing the
change of global active transcripts in U2-OS and SJSA-1 cells
following treatment with 25, 100, and 400 nmol/L THZ2 for 6 hours.
C, Scatter plotdisplaying the log2-fold change of all active genes
altered by 100 nmol/L THZ2.D, EnrichedGO functional categories of
transcriptswere reduced over two-fold in U2-OS and SJSA-1 cells
following treatment with 100 nmol/L THZ2 for 6 hours. E, Box plots
showing log2-fold changes of transcripts associated with the total
pool of allenhancers (ALL), typical-enhancers (TE), and
super-enhancers (SE) upon treatment with 100 nmol/L THZ2 for 6
hours. Data represent mean� SD. F,GSEA showingthe
super-enhancer–associated transcript signature enriched in 100
nmol/L THZ2-treated cells versus DMSO-treated cells. G, Venn
diagram showing overlapbetween super-enhancer–associated genes
identified with ChIP-seq, and ranking among the top 10% of
THZ2-sensitive active transcripts in two osteosarcoma celllines,
respectively. The genes reported to be involved inmalignant
properties of osteosarcomawere listed.H,qPCR to detect expression
of indicated gene transcriptsin DMSO-treated and 100 nmol/L
THZ2-treated U2-OS and SJSA-1 cells, respectively. Data represent
mean � SD (� , P < 0.05; ��, P < 0.01; ���, P <
0.001).
Targeting Super-Enhancer–Associated Genes in Osteosarcoma
AACRJournals.org Clin Cancer Res; 2020 OF7
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://clincancerres.aacrjournals.org/
-
reduced the migratory and invasive properties of osteosarcoma
cells(Fig. 4D). These results demonstrated that THZ2 has
powerfulinhibitory effects on the growth, migration, and invasion
of osteosar-coma in vitro.
THZ2 inhibits cell-cycle progression and induces apoptosis
inosteosarcoma cells
To examine whether THZ2 affects cell-cycle distribution,
humanosteosarcoma cell lines were treated with THZ2 (100 nmol/L
for24 hours), followed by flow cytometry analysis. G2–M phase
arrestwas observed in U2-OS, SJSA-1, 143B, andMG-63 cells (Fig.
5A). Thepercentage of U2-OS, SJSA-1, 143B, and MG-63 cells in
G2–Mincreased by 10.2%, 20.6%, 8.1%, and 20.1%, respectively, and
thepercentage of cells in G0–G1 decreased by 12.7%, 9.1%, 6.9%,
and12.0%, respectively (Fig. 5A).
Immunoblotting was performed to determine the effects of THZ2on
the expression of Cyclin D1, which is related to G0–G1 to
S-phasetransition, and expression of P21, which is a potent
inhibitor of cell-cycle progression. The results showed that
treatment of U2-OS cellswith THZ2 resulted in a reduction of Cyclin
D1 expression and anincrease of P21 expression in a dose-dependent
and time-dependentmanner (Fig. 5C and D). Annexin V/PI staining
showed thepercentage of apoptotic cells increased markedly in all
tested celllines after THZ2 treatment (Fig. 5B). The number of
apoptotic cellsin the U2-OS, SJSA-1, 143B, and MG-63 cell lines
increased by18.1%, 24.3%, 12.2%, and 3.7%, respectively, with a
THZ2 concen-tration of 100 nmol/L (Fig. 5B).
As a marker of apoptosis, total and cleaved PARP was detected
byWestern blotting and the results showed that protein expression
wasincreased after exposure to THZ2 (Fig. 5C and D). Taken
together,these results indicated that THZ2 can affect cell-cycle
progression andinduce apoptosis.
THZ2 exhibits a powerful antitumor effect againstosteosarcoma
xenografts in nude mice
On the basis of in vitro data, we explored the
anti-osteosarcomaactivity of THZ2 using an osteosarcoma orthotropic
animal model.Mice bearing SJSA-1 cells were randomly separated into
two groups(vehicle and THZ2), and received either vehicle or THZ2
(10 mg/kg)twice daily. The tumor growth curves showed a significant
antitumoreffect of THZ2, as compared with the control (Fig.
6A).
Tumor-bearing mice were killed on day 21. Examination
revealedtumor swelling in the lower legs. Radiographic features
characteristicof human primary osteosarcoma, including central
osteolysis withspecular new bone formation and extension into
surrounding softtissues, were more apparent in the vehicle group
compared with theTHZ2 treatment group (Fig. 6B and C). A lower
tumor weight wasobserved in the THZ2 group (Fig. 6D).
IHC and TUNEL assay examination of tumor samples showed thatTHZ2
dramatically inhibited cell proliferation and promoted
cellapoptosis (Fig. 6E). In addition, the number of observable
lungmetastatic nodules was lower in the THZ2 treatment group(Fig.
6F and G). Importantly, no significant difference in mouse
bodyweight was observed between the vehicle group and the THZ2
group(Fig. 6H), and no obvious pathological changes were observed
in theheart, kidney, liver, lung, and spleen in the THZ2 group as
determinedby H&E staining (Supplementary Fig. S4).
Collectively, these resultsrevealed that THZ2 possesses potent
antitumor properties againsthuman osteosarcoma cells in vivo.
DiscussionDespite advances in the diagnosis and treatment of
osteosarcoma,
the prognosis remains poor (50, 51). The effectiveness of
standardchemotherapy is hampered by the development of
chemoresistance in
Figure 4.
THZ2 impedes the proliferation and metastasis of osteosarcoma in
vitro. A, Dose–response curves of 10 osteosarcoma cell lines and 1
osteoblast cell line (hFOB1.19)after treatment with THZ2 for 48
hours. Cell viability was assessed with the MTT assay. IC50 data
are presented as mean with 95% confidence interval. B,
Time–response curves of U2-OS, SJSA-1, and hFOB 1.19 upon treatment
with THZ2 at concentrations as low as 25, 50, and 100 nmol/L. Data
represent mean� SD. C, THZ2impaired colony formation of
osteosarcomacells. The colony formation ability of osteosarcoma
cells (U2-OS, SJSA-1, 143B, andMG-63)was examinedafter
treatmentwith various concentrations THZ2 for 10 days. The
quantification of cell growth in the right panel is presented as
mean � SD. D, THZ2 inhibits the migrationand invasion ability of
osteosarcoma cells. The indicated cells were treated with THZ2 (100
nmol/L) or vehicle. Data represent mean � SD (� , P < 0.05; �� ,
P < 0.01;��� , P < 0.001).
Zhang et al.
Clin Cancer Res; 2020 CLINICAL CANCER RESEARCHOF8
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://clincancerres.aacrjournals.org/
-
a large portion of patients (4). A limited understanding of
thepathogenesis of osteosarcoma has impeded improvement in the
out-comes of patients in the last four decades.
Super-enhancers, large clusters of enhancers that are enriched
insize and binding of the mediator complex, have been
characterizedin various cancer cells and have been reported to
promote theexpression of genes that define cell identity (9, 14,
52). Recentstudies have suggested that a number of different cancer
cell typesgenerate super-enhancers at oncogenes, and the
acquisition ofspecific super-enhancers near oncogenes contributes
to tumorigen-esis (11, 13, 26). However, there have been no studies
examiningsuper-enhancers in osteosarcoma. In this study, we
characterized
the super-enhancer landscape of osteosarcoma for the first time
andidentified the associated transcripts. We found that
super-enhanc-er–associated transcripts are important for the
regulation ofRNAPII-mediated transcriptional activity, as well as
cellular pro-cesses representing “cancer hallmarks” (53) and
lineage-specificprocesses, such as skeletal system development. A
number ofosteosarcoma oncogenes, including both coding and
non-codingRNAs, such as GLI2 (54), TCF7L2 (37), MYC (35), MDM2
(55),MALAT1 (39), and MIR21 (41) are associated with
super-enhan-cers. On the basis of our findings, we speculate that
super-enhanc-er–associated genes play an important role in the
malignancy andcell identity of osteosarcoma.
Figure 5.
The effect of THZ2 on cell-cycle progression and apoptosis in
osteosarcoma cells. A, Flow cytometry was used to detect and
analyze cell-cycle distribution ofosteosarcoma cells treated with
vehicle or 100 nmol/L THZ2 for 24 hours. The length of each
cell-cycle phase was calculated. Data represent mean� SD.
B,AnnexinV/PI staining assay were used to detect the apoptosis rate
of osteosarcoma cells treated with vehicle or 100 nmol/L THZ2 for
24 hours. The proportion of apoptoticcells was calculated. Data
represent mean� SD. C and D,Western blot analyses were performed
using the indicated antibodies, including total/cleaved PARP,
P21,and Cyclin D1. THZ2 affects the protein levels of the apoptosis
marker cleaved PARP and cell-cycle–related genes P21 and Cyclin D1
in dose/time-dependent manner(� , P < 0.05; �� , P < 0.01;
��� , P < 0.001).
Targeting Super-Enhancer–Associated Genes in Osteosarcoma
AACRJournals.org Clin Cancer Res; 2020 OF9
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://clincancerres.aacrjournals.org/
-
Super-enhancers are occupied by a large portion of the
RNAPII,cofactors, and chromatin regulators, which can explain how
theycontribute to high-level transcription of associated genes
(13).Recent studies have found that super-enhancers are sensitive
toperturbations of transcriptional activity through certain
boundtranscription factors and coactivators, as well as
associatedgenes (9, 26). CDK7 is a CDK and a subunit of the
multiproteinbasal transcription factor TFIIH, which regulates
transcriptioninitiation and elongation by phosphorylating the CTD
of the largestsubunit (RPB1) of RNAPII (56). On the basis of the
high expressionof CDK7 in human osteosarcoma tissues, and
suppression of themalignant properties of osteosarcoma cells after
CDK7 knockdown,we reasoned that targeting CDK7 might be a potential
treatment
strategy for osteosarcoma through suppressing
super-enhancer–associated oncogenes.
THZ1 is a selective CDK7 inhibitor that covalently binds to
CDK7and suppresses its kinase activity, and has a very high level
of selectivitybecause of modification of a unique cysteine residue
(29). Althoughrecent studies have showed that THZ1 has the
potential of promisinganticancer activity in various malignancies,
its translational signifi-cance and application are limited to the
short half-life (30). THZ2 is anewly developed analog of THZ1 with
a five-fold increase of half-life,and has been reported to suppress
the growth of triple-negative breastcancer and gastric cancer (29,
31). However, the effect of THZ2 inother cancers, including
osteosarcoma, is still unknown. To identify apotential drug against
osteosarcoma and confirm the relations between
Figure 6.
THZ2 suppress the growth and lung metastatic potential in
orthotopic mice model. A, Tumor growth curves of mice treated with
either vehicle or THZ2 for 21 days(twice daily, 10mg/kg, i.p.).
Data representmean� SD.B, Themice bearing induced tibial
osteosarcomaupon vehicle (top) or THZ2 (bottom) treatment are shown
inthe RGB images and the X-ray images of the whole body. C,
Photographs and (D) weights of resected tumors from both vehicle
and THZ2 treatment groups. Datarepresentmean� SD.E,H&E and IHC
staining of Ki67, and TUNEL assay in tumor tissue sections. Each
imagewas taken at amagnification of 400�.F,Representativeimages of
lung sections after H&E staining. Each image was taken at
amagnification of 40� and 100�.G, Statistical results for the
number of visible lungmetastaticnodules. Data represent mean� SD.
H, The body weight of mice over the treatment time. Data represent
the mean� SD (ns, not significant; � , P < 0.05; �� , P <
0.01;��� , P < 0.001).
Zhang et al.
Clin Cancer Res; 2020 CLINICAL CANCER RESEARCHOF10
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://clincancerres.aacrjournals.org/
-
the activity of CDK7 and the expression of
super-enhancer–associatedgenes in osteosarcoma, we used THZ2 in our
investigations.
Microarray expression analysis was used to detected alterations
oftotal transcripts in osteosarcoma cells treated with various
concentra-tions of THZ2. We observed that a cluster of genes was
particularlysensitive to THZ2 treatment, and was also enriched in
cancer-relatedbiological processes and pathways, such as apoptosis,
cell migration,PI3K-Akt signaling, and MAPK signaling, etc.
Notably, they weresimilar to the processes in which
super-enhancer–associated genes areinvolved. On the basis of these
interesting results, we explored therelation between the
THZ2-sensitive genes and super-enhancers weidentified, and found
that THZ2 could selectively suppress super-enhancer–associated
genes. Notably, a large number of well-definedoncogenes
associatedwith identified super-enhancers were found to bepresent
in the subset most sensitive to THZ2. These results indicatedthat
oncogenes associated with super-enhancers in osteosarcoma
areparticularly vulnerable to THZ2.
Moreover, we identified some seldom reported transcripts in
oste-osarcoma associated with super-enhancers that were also
sensitive toTHZ2, such as CEP55 and LACTB (Supplementary Table S1
and S2).The identification and analysis of
super-enhancer–associated genes inour study provides an important
molecular foundation to understandthe pathogenesis of osteosarcoma,
and a catalogue of genes which maybe valuable for further
research.
To explore the anti-osteosarcoma potential of THZ2, we exam-ined
changes of malignant features in vitro and in vivo after
THZ2treatment. Our results showed that THZ2 suppressed the
prolifer-ation of osteosarcoma cells in time- and dose-dependent
manners,and exhibited less cytotoxicity in the human osteoblast
cell linehFOB1.19. Osteosarcoma has a strong tendency to
metastasize, andpulmonary metastasis is the main cause of medical
failure and deathin patients with osteosarcoma. The effect of THZ2
on the metastaticpotential of osteosarcoma cells was examined using
the Transwellassay. The results showed that THZ2 markedly
suppressed themigration and invasion ability of osteosarcoma cells.
In addition,we also found that THZ2 induced G2–M cell-cycle arrest
andapoptotic cell death in osteosarcoma cells. Furthermore, an
ortho-topic murine model was established to assess the antitumor
poten-tial of THZ2 in vivo. THZ2 potently suppressed tumor growth
innude mice, and fewer lung metastatic nodules were found in
micetreated with THZ2 as compared with those not treated. Notably,
no
severe side effects or pathologic changes in important organs
wereobserved in mice treated with THZ2. Taken together, our
resultsindicate that THZ2 has a powerful antitumor activity
againstosteosarcoma in vitro and in vivo, and may have clinical
value forthe treatment of patients with osteosarcoma.
In summary, our results showed significant correlations
betweensuper-enhancers and the malignant potential of osteosarcoma,
andindicated that targeting super-enhancer–associated genes with
aCDK7 inhibitor such as THZ2 may be a promising treatment
forosteosarcoma patients. Moreover, our data provide an
importantmolecular foundation towards understanding the
pathogenesis ofosteosarcoma modified by epigenetic patterns.
Disclosure of Potential Conflicts of InterestNo potential
conflicts of interest were disclosed.
Authors’ ContributionsConception and design: J. Zhang, J. Yin,
J. ShenDevelopment of methodology: J. Zhang, W. Liu, J.
YinAcquisition of data (provided animals, acquired and managed
patients, providedfacilities, etc.): J. Zhang, Z. Zhao, Y. Lai, X.
ZhangAnalysis and interpretation of data (e.g., statistical
analysis, biostatistics,computational analysis): J. Zhang, X. Xie,
Y. Wang, Z. FanWriting, review, and/or revision of the manuscript:
J. Zhang, Z. Zhao, G. HuangAdministrative, technical, or material
support (i.e., reporting or organizing data,constructing
databases): C. Zou, Z. Shi, J. YinStudy supervision: Q. Su, J. Yin,
J. Shen
AcknowledgmentsThis work was supported by grants from National
Natural Science Foundation of
China (nos. 81972507 and 81772861), Natural Science Foundation
of GuangdongProvince (nos. 2016A030313227, 2018A030313077, and
2018A030313689), theScience & Technology Planning Project of
Guangzhou City (nos. 201707010007,and 201904010440), Scientific
ResearchCultivating Project of Sun Yat-sen University(nos.
80000-18827202 and 80000-18823701), the Fundamental Research Funds
forthe Central Universities (no. 19ykzd10), and Scientific Research
3� 3 Project of SunYat-sen University (no. Y70215).
The costs of publication of this article were defrayed in part
by the payment of pagecharges. This article must therefore be
hereby marked advertisement in accordancewith 18 U.S.C. Section
1734 solely to indicate this fact.
Received April 30, 2019; revised August 24, 2019; accepted
January 10, 2020;published first January 14, 2020.
References1. Isakoff MS, Bielack SS, Meltzer P, Gorlick R.
Osteosarcoma: current treatment
and a collaborative pathway to success. J Clin Oncol
2015;33:3029–35.2. Schwartz CL, Gorlick R, Teot L, KrailoM, Chen Z,
Goorin A, et al. Multiple drug
resistance in osteogenic sarcoma: INT0133 from the children's
oncology group.J Clin Oncol 2007;25:2057–62.
3. Laschi M, Bernardini G, Geminiani M, Ghezzi L, Amato L,
Braconi D, et al.Establishment of four new human primary cell
cultures from chemo-naiveItalian osteosarcoma patients. J Cell
Physiol 2015;230:2718–27.
4. Susa M, Iyer AK, Ryu K, Choy E, Hornicek FJ, Mankin H, et al.
Inhibition ofABCB1 (MDR1) expression by an siRNA nanoparticulate
delivery system toovercome drug resistance in osteosarcoma. PLoS
One 2010;5:e10764.
5. Lin CY, Loven J, Rahl PB, Paranal RM, Burge CB, Bradner JE,
et al. Transcrip-tional amplification in tumor cells with elevated
c-Myc. Cell 2012;151:56–67.
6. Thurman RE, Rynes E, Humbert R, Vierstra J, Maurano MT,
Haugen E, et al.The accessible chromatin landscape of the human
genome. Nature 2012;489:75–82.
7. Jin F, Li Y, Dixon JR, Selvaraj S, Ye Z, Lee AY, et al. A
high-resolution map ofthe three-dimensional chromatin interactome
in human cells. Nature 2013;503:290–4.
8. ENCODE Project Consortium. An integrated encyclopedia of DNA
elements inthe human genome. Nature 2012;489:57–74.
9. Loven J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, et al.
Selectiveinhibition of tumor oncogenes by disruption of
super-enhancers. Cell 2013;153:320–34.
10. Wang Y, Zhang T, Kwiatkowski N, Abraham BJ, Lee TI, Xie S,
et al. CDK7-dependent transcriptional addiction in triple-negative
breast cancer. Cell 2015;163:174–86.
11. Christensen CL, Kwiatkowski N, AbrahamBJ, Carretero J,
Al-Shahrour F, ZhangT, et al. Targeting transcriptional addictions
in small cell lung cancer with acovalent CDK7 inhibitor. Cancer
Cell 2014;26:909–22.
12. Jiang YY, Lin DC, Mayakonda A, Hazawa M, Ding LW, Chien WW,
et al.Targeting super-enhancer-associated oncogenes in oesophageal
squamous cellcarcinoma. Gut 2016;66:1358–68.
13. Hnisz D, Abraham BJ, Lee TI, Lau A, Saint-Andre V, Sigova
AA, et al. Super-enhancers in the control of cell identity and
disease. Cell 2013;155:934–47.
14. Niederriter AR, Varshney A, Parker SC, Martin DM. Super
enhancers incancers, complex disease, and developmental disorders.
Genes 2015;6:1183–200.
Targeting Super-Enhancer–Associated Genes in Osteosarcoma
AACRJournals.org Clin Cancer Res; 2020 OF11
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://clincancerres.aacrjournals.org/
-
15. Togel L, Nightingale R, Chueh AC, JayachandranA, TranH,
Phesse T, et al. Dualtargeting of bromodomain and extraterminal
domain proteins, and WNT orMAPK signaling, inhibits c-MYC
expression and proliferation of colorectalcancer cells. Mol Cancer
Ther 2016;15:1217–26.
16. MansourMR, Abraham BJ, Anders L, Berezovskaya A, Gutierrez
A, Durbin AD,et al. Oncogene regulation. an oncogenic
super-enhancer formed throughsomatic mutation of a noncoding
intergenic element. Science 2014;346:1373–7.
17. Hnisz D, Schuijers J, Lin CY, Weintraub AS, Abraham BJ, Lee
TI, et al.Convergence of developmental and oncogenic signaling
pathways at transcrip-tional super-enhancers. Mol Cell
2015;58:362–70.
18. Glodzik D, Morganella S, Davies H, Simpson PT. A
somatic-mutational processrecurrently duplicates germline
susceptibility loci and tissue-specific super-enhancers in breast
cancers. Nat Genet 2017;49:341–8.
19. Nagaraja S, Vitanza NA, Woo PJ, Taylor KR, Liu F, Zhang L,
et al. Transcrip-tional dependencies in diffuse intrinsic pontine
glioma. Cancer Cell 2017;31:635–52.e6.
20. Han J, Meng J, Chen S, Wang X, Yin S, Zhang Q, et al. YY1
complex promotesquaking expression via super-enhancer binding
during EMT of hepatocellularcarcinoma. Cancer Res
2019;79:1451–64.
21. Peng L, Jiang B, YuanX,QiuY, Peng J,HuangY, et al.
Super-enhancer-associatedlong noncoding RNAHCCL5 is activated by
ZEB1 and promotes themalignancyof hepatocellular carcinoma. Cancer
Res 2019;79:572–84.
22. Evan GI, Hah N, Littlewood TD, Sodir NM, Campos T, Downes M,
et al. Re-engineering the pancreas tumor microenvironment: a
"regenerative program"hacked. Clin Cancer Res 2017;23:1647–55.
23. Pelish HE, Liau BB, Nitulescu II, Tangpeerachaikul A, Poss
ZC, Da Silva DH,et al. Mediator kinase inhibition further activates
super-enhancer-associatedgenes in AML. Nature 2015;526:273–6.
24. Dawson MA, Gudgin EJ, Horton SJ, Giotopoulos G, Meduri E,
Robson S, et al.Recurrent mutations, including NPM1c, activate a
BRD4-dependent core tran-scriptional program in acute myeloid
leukemia. Leukemia 2014;28:311–20.
25. Groschel S, Sanders MA, Hoogenboezem R, de Wit E, Bouwman
BA, ErpelinckC, et al. A single oncogenic enhancer rearrangement
causes concomitant EVI1and GATA2 deregulation in leukemia. Cell
2014;157:369–81.
26. WhyteWA,OrlandoDA,HniszD,AbrahamBJ, LinCY,KageyMH, et
al.Mastertranscription factors and mediator establish
super-enhancers at key cell identitygenes. Cell
2013;153:307–19.
27. Akhtar MS, Heidemann M, Tietjen JR, Zhang DW, Chapman RD,
Eick D, et al.TFIIH kinase places bivalent marks on the
carboxy-terminal domain of RNApolymerase II. Mol Cell
2009;34:387–93.
28. Drapkin R, Le Roy G, Cho H, Akoulitchev S, Reinberg D. Human
cyclin-dependent kinase-activating kinase exists in three distinct
complexes. PNAS1996;93:6488–93.
29. Kwiatkowski N, Zhang T, Rahl PB, Abraham BJ, Reddy J,
Ficarro SB, et al.Targeting transcription regulation in cancer with
a covalent CDK7 inhibitor.Nature 2014;511:616–20.
30. Li B, Ni Chonghaile T, Fan Y, Madden SF, Klinger R, O'Connor
AE, et al.Therapeutic rationale to target highly expressed CDK7
conferring poor out-comes in triple-negative breast cancer. Cancer
Res 2017;77:3834–45.
31. Huang JR, Qin WM, Wang K, Fu DR, Zhang WJ, Jiang QW, et al.
Cyclin-dependent kinase 7 inhibitor THZ2 inhibits the growth of
human gastric cancerin vitro and in vivo. Am J Transl Res
2018;10:3664–76.
32. Zou CY, Wang J, Shen JN, Huang G, Jin S, Yin JQ, et al.
Establishment andcharacteristics of two syngeneic human
osteosarcoma cell lines from primarytumor and skip metastases. Acta
Pharmacol Sin 2008;29:325–32.
33. Berlin O, Samid D, Donthineni-Rao R, Akeson W, Amiel D,
Woods VL Jr.Development of a novel spontaneous metastasis model of
human osteosarcomatransplanted orthotopically into boneof
athymicmice.CancerRes 1993;53:4890–5.
34. Yin JQ, Wen L, Wu LC, Gao ZH, Huang G,Wang J, et al. The
glycogen synthasekinase-3beta/nuclear factor-kappa B pathway is
involved in cinobufagin-induced apoptosis in cultured osteosarcoma
cells. Toxicol Lett 2013;218:129–36.
35. Shimizu T, IshikawaT, Sugihara E, Kuninaka S,Miyamoto
T,Mabuchi Y, et al. c-MYC overexpression with loss of Ink4a/Arf
transforms bone marrow stromalcells into osteosarcoma accompanied
by loss of adipogenesis. Oncogene 2010;29:5687–99.
36. Mou S, Wang G, Ding D, Yu D, Pei Y, Teng S, et al.
Expression and function ofPIM kinases in osteosarcoma. Int J Oncol
2016;49:2116–26.
37. Chen K, Fallen S, Abaan HO, Hayran M, Gonzalez C, Wodajo F,
et al. Wnt10binduces chemotaxis of osteosarcoma and correlates with
reduced survival.Pediatr Blood Cancer 2008;51:349–55.
38. Koyani CN, Kitz K, Rossmann C, Bernhart E, Huber E, Trummer
C, et al.Activation of the MAPK/Akt/Nrf2-Egr1/HO-1-GCLc axis
protects MG-63osteosarcoma cells against 15d-PGJ2-mediated cell
death. Biochem Pharmacol2016;104:29–41.
39. Luo W, He H, Xiao W, Liu Q, Deng Z, Lu Y, et al. MALAT1
promotesosteosarcoma development by targeting TGFA via MIR376A.
Oncotarget2016;7:54733–43.
40. Shu Y, YeW, Gu YL, Sun P. Blockade of miR-663b inhibits cell
proliferation andinduces apoptosis in osteosarcoma via regulating
TP73 expression. Bratisl LekListy 2018;119:41–6.
41. Lv C, Hao Y, Tu G. MicroRNA-21 promotes proliferation,
invasion andsuppresses apoptosis in human osteosarcoma line MG63
through PTEN/Aktpathway. Tumour Biol 2016;37:9333–42.
42. Joeng KS, Long F. The Gli2 transcriptional activator is a
crucial effector for Ihhsignaling in osteoblast development and
cartilage vascularization. Development2009;136:4177–85.
43. Poulton IJ, McGregor NE, Pompolo S, Walker EC, Sims NA.
Contrastingroles of leukemia inhibitory factor in murine bone
development and remo-deling involve region-specific changes in
vascularization. J Bone Miner Res2012;27:586–95.
44. Lengner CJ, SteinmanHA, Gagnon J, Smith TW, Henderson JE,
KreamBE, et al.Osteoblast differentiation and skeletal development
are regulated byMdm2-p53signaling. J Cell Biol 2006;172:909–21.
45. Komori T. Roles of Runx2 in skeletal development. Adv ExpMed
Biol 2017;962:83–93.
46. Tahaei SE, Couasnay G, Ma Y, Paria N, Gu J, Lemoine BF, et
al. The reducedosteogenic potential of Nf1-deficient
osteoprogenitors is EGFR-independent.Bone 2018;106:103–11.
47. Larochelle S, Amat R, Glover-Cutter K, SansoM, Zhang C,
Allen JJ, et al. Cyclin-dependent kinase control of the
initiation-to-elongation switch of RNA poly-merase II. Nat Struct
Mol Biol 2012;19:1108–15.
48. Ajiro M, Jia R, Yang Y, Zhu J, Zheng ZM. A genome landscape
of SRSF3-regulated splicing events and gene expression in human
osteosarcoma U2OScells. Nucleic Acids Res 2016;44:1854–70.
49. Roose J, Clevers H. TCF transcription factors: molecular
switches in carcino-genesis. Biochim Biophys Acta
1999;1424:M23–37.
50. Faisham WI, Mat Saad AZ, Alsaigh LN, Nor Azman MZ, Kamarul
Imran M,Biswal BM, et al. Prognostic factors and survival rate of
osteosarcoma: a single-institution study. Asia Pac J Clin Oncol
2017;13:e104–e10.
51. HeH, Ni J, Huang J.Molecular mechanisms of chemoresistance
in osteosarcoma(review). Oncol Lett 2014;7:1352–62.
52. Pott S, Lieb JD. What are super-enhancers? Nat Genet
2015;47:8–12.53. Hanahan D, Weinberg RA. Hallmarks of cancer: the
next generation. Cell 2011;
144:646–74.54. Nagao-Kitamoto H, Nagata M, Nagano S, Kitamoto S,
Ishidou Y, Yamamoto T,
et al. GLI2 is a novel therapeutic target for metastasis of
osteosarcoma. Int JCancer 2015;136:1276–84.
55. YingM, Zhang L, ZhouQ, Shao X, Cao J, ZhangN, et al. The E3
ubiquitin proteinligase MDM2 dictates all-trans retinoic
acid-induced osteoblastic differentiationof osteosarcoma cells by
modulating the degradation of RARalpha.
Oncogene2016;35:4358–67.
56. Malumbres M. Cyclin-dependent kinases. Genome Biol
2014;15:122.
Clin Cancer Res; 2020 CLINICAL CANCER RESEARCHOF12
Zhang et al.
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://Am J Transl Reshttp://Cancer Reshttp://J Bone Miner
Reshttp://Asia Pac J Clin
Oncolhttp://clincancerres.aacrjournals.org/
-
Published OnlineFirst January 14, 2020.Clin Cancer Res Jiajun
Zhang, Weihai Liu, Changye Zou, et al. Osteosarcoma with THZ2, a
Covalent CDK7 Inhibitor
Associated Oncogenes in−Targeting Super-Enhancer
Updated version
10.1158/1078-0432.CCR-19-1418doi:
Access the most recent version of this article at:
Material
Supplementary
http://clincancerres.aacrjournals.org/content/suppl/2020/01/14/1078-0432.CCR-19-1418.DC1Access
the most recent supplemental material at:
E-mail alerts related to this article or journal.Sign up to
receive free email-alerts
Subscriptions
Reprints and
[email protected] at
To order reprints of this article or to subscribe to the
journal, contact the AACR Publications
Permissions
Rightslink site. (CCC)Click on "Request Permissions" which will
take you to the Copyright Clearance Center's
.http://clincancerres.aacrjournals.org/content/early/2020/04/03/1078-0432.CCR-19-1418To
request permission to re-use all or part of this article, use this
link
Cancer Research. on October 30, 2020. © 2020 American
Association forclincancerres.aacrjournals.org Downloaded from
Published OnlineFirst January 14, 2020; DOI:
10.1158/1078-0432.CCR-19-1418
http://clincancerres.aacrjournals.org/lookup/doi/10.1158/1078-0432.CCR-19-1418http://clincancerres.aacrjournals.org/content/suppl/2020/01/14/1078-0432.CCR-19-1418.DC1http://clincancerres.aacrjournals.org/cgi/alertsmailto:[email protected]://clincancerres.aacrjournals.org/content/early/2020/04/03/1078-0432.CCR-19-1418http://clincancerres.aacrjournals.org/
/ColorImageDict > /JPEG2000ColorACSImageDict >
/JPEG2000ColorImageDict > /AntiAliasGrayImages false
/CropGrayImages false /GrayImageMinResolution 200
/GrayImageMinResolutionPolicy /Warning /DownsampleGrayImages true
/GrayImageDownsampleType /Bicubic /GrayImageResolution 300
/GrayImageDepth -1 /GrayImageMinDownsampleDepth 2
/GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true
/GrayImageFilter /DCTEncode /AutoFilterGrayImages true
/GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict >
/GrayImageDict > /JPEG2000GrayACSImageDict >
/JPEG2000GrayImageDict > /AntiAliasMonoImages false
/CropMonoImages false /MonoImageMinResolution 600
/MonoImageMinResolutionPolicy /Warning /DownsampleMonoImages true
/MonoImageDownsampleType /Bicubic /MonoImageResolution 900
/MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000
/EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode
/MonoImageDict > /AllowPSXObjects false /CheckCompliance [ /None
] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false
/PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000
0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true
/PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ]
/PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier ()
/PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped
/False
/CreateJDFFile false /Description > /Namespace [ (Adobe)
(Common) (1.0) ] /OtherNamespaces [ > /FormElements false
/GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks
false /IncludeInteractive false /IncludeLayers false
/IncludeProfiles false /MarksOffset 18 /MarksWeight 0.250000
/MultimediaHandling /UseObjectSettings /Namespace [ (Adobe)
(CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /NA
/PageMarksFile /RomanDefault /PreserveEditing true
/UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling
/LeaveUntagged /UseDocumentBleed false >> > ]>>
setdistillerparams> setpagedevice