1 SUPPLEMENTARY DATA 1 2 Table S1. Primers used in this study 3 4 Primer name Sequence Primers used to clone nlpE EcoRI-nlpE-5 cccgaattcggtcgggaataaaaagaaggaatgg HindIII-nlpE-3 gcgaagcttgtctcaagacgggttactgccc Primers used to check single mutants cpxR.ext-5 gattgattcataaatactcc cpxR.ext-3 caaacagtaagttaatgaaatc rcsB.ext-5 aaatgctcgcagctgaccc rcsB.ext-3 tgccgtcaacggacaaagcgg degP.ext-5 cagcgatcttcttaagctatat degP.ext-3 acaagtgcatcaaccgcgac Kmfrt.verif-5 ggattcatcgactgtggccg Kmfrt.verif-3 cagtcatagccgaatagcct 5
13
Embed
Table S1. Primers used in this studyaem.asm.org/content/suppl/2013/11/15/AEM.02593-13.DCSupplemental/... · 3 Table S1. Primers used in this study 4 ... b3914 cpxP 13.36 Cpx, ...
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
SUPPLEMENTARY DATA 1
2
Table S1. Primers used in this study 3 4 Primer name Sequence
Primers used to clone nlpE
EcoRI-nlpE-5 cccgaattcggtcgggaataaaaagaaggaatgg
HindIII-nlpE-3 gcgaagcttgtctcaagacgggttactgccc
Primers used to check single mutants
cpxR.ext-5 gattgattcataaatactcc
cpxR.ext-3 caaacagtaagttaatgaaatc
rcsB.ext-5 aaatgctcgcagctgaccc
rcsB.ext-3 tgccgtcaacggacaaagcgg
degP.ext-5 cagcgatcttcttaagctatat
degP.ext-3 acaagtgcatcaaccgcgac
Kmfrt.verif-5 ggattcatcgactgtggccg
Kmfrt.verif-3 cagtcatagccgaatagcct 5
2
1 Table S2. ApoEdpL-W upregulated genes in E. coli K-12 2
3
N° Gene name FCa Encoded function Regulonb
Sugar metabolism and polysaccharide synthesis
b4026 yjbE 1910.25 Production of uncharacterized polysaccharide Rcs(+)
b0379 yaiY 492.16 Predicted inner membrane protein Rcs(+)
b1110 ycfJ 417.96 Hypothetical protein Rcs(+)
b0005 yaaX 170.84 Hypothetical protein
b1115 ycfT 103.62 Hypothetical protein Rcs(+)
5
b3563 yiaB 86.63 Hypothetical protein
b2671 ygaC 65.73 Hypothetical protein Rcs(+), Fur
b1172 ymgG 21.78 Hypothetical protein Rcs(+)
b1171 ymgD 18.19 Hypothetical protein Rcs(+), Cpx
b0753 ybgS 17.75 Hypothetical protein
b2833 ygdR 13.91 Hypothetical lipoprotein Rcs(+)
b1846 yebE 13.82 Hypothetical protein Cpx
b2936 yggG 9.98 Predicted peptidase Rcs(+)
b4045 yjbJ 9.39 Putative stress-response protein Rcs(+), σS
b3055 ygiM 8.73 Putative signal transduction protein σE
b1063 yceB 6.71 Predicted lipoprotein
b0453 ybaY 5.68 Hypothetical protein
b4217 ytfK 4.82 Hypothetical protein Rcs(+), σS
b1452 yncE 3.99 Hypothetical protein
b0865 ybjP 3.73 Predicted lipoprotein σS
b3192 mlaC (yrbC) 2.47 Predicted subunit of phospholipid ABC
transporter
b3191 mlaB (yrbB) 2.30 Predicted subunit of phospholipid ABC
transporter
b2922 yggE 2.36 Hypothetical protein Rcs(+), σS
b3098 yqjD 2.06 Hypothetical protein
Intergenic regions
IG 2135266/857-r 1650.08 yegH->wza
IG 2116427/701_r 508.94 wzxc->wcaK
IG 1341353/620_r 101.90 ycit->osmB
IG 2317849/8062_r 80.83 atoS->rcsC
IG 3198607/847_f 9.11 ygiF->ygiM
IG 2302414/3127_f 4.53 eco->mqo a FC, fold change. 1 b Known regulators of gene expression according to (1-4) and EcoCyc database (http://ecocyc.org/). When 2 established, the up (+)- or down(-)-action of the regulator is reported in brackets. Cpx*, regulation predicted by 3 promoter region analysis but not validated experimentally. 4 5 1. Rhodius VA, Suh WC, Nonaka G, West J, Gross CA. 2006. Conserved and variable functions 6
of the sigmaE stress response in related genomes. PLoS Biol 4:e2. 7
6
2. De Wulf P, McGuire AM, Liu X, Lin EC. 2002. Genome-wide profiling of promoter 1 recognition by the two-component response regulator CpxR-P in Escherichia coli. J Biol Chem 2 277:26652-26661. 3
3. Ferrieres L, Clarke DJ. 2003. The RcsC sensor kinase is required for normal biofilm formation 4 in Escherichia coli K-12 and controls the expression of a regulon in response to growth on a solid 5 surface. Mol Microbiol 50:1665-1682. 6
4. McHugh JP, Rodriguez-Quinones F, Abdul-Tehrani H, Svistunenko DA, Poole RK, Cooper 7 CE, Andrews SC. 2003. Global iron-dependent gene regulation in Escherichia coli. A new 8 mechanism for iron homeostasis. J Biol Chem 278:29478-29486. 9
10 11 12 13 14 15 16 17 18 19
20
7
1 Table S3. ApoEdpL-W downregulated genes in E. coli K-12 2
b0929 ompF -23.13 Outer membrane protein F Cpx(-),σE (-)
9
b0553 nmpC -11.24 Outer membrane porin protein
b2215 ompC -2.32 Outer membrane porin protein C Cpx(+), σE (-)
Iron homeostasis
b1905 ftnA -6.66 Ferritin iron storage protein Fur
Miscellaneous functions
b4314 fimA -2.80 Major type 1 fimbriae subunit Rcs(+)
Regulators
b1987 cbl -3.60 Transcriptional regulator
b4438 ryeE -2.95 Small regulatory RNA
b2369 evgA -2.84 DNA binding response regulator
b0034 caiF -2.70 DNA binding transcriptional activator
b2669 stpA -2.48 DNA binding protein
Predicted proteins
b4354 yjiY -10.06 Hypothetical protein
b0458 ylaC -2.32 Hypothetical protein
b0786 ybhL -2.25 Hypothetical protein
b4353 yjiX -2.21 Hypothetical protein
b2351 yfdh -2.17 Bactoprenol glucosyl transferase
Intergenic regions
IG 2660152/602_r -2.26 iscR/yfhP->tmrJ/yfhQ a FC, fold change. 1 b Known regulators of gene expression according to (1-4) and EcoCyc database (http://ecocyc.org/). When 2 established, the up(+)- or down(-)-action of the regulator is reported in brackets. 3 4 1. Rhodius VA, Suh WC, Nonaka G, West J, Gross CA. 2006. Conserved and variable functions 5
of the sigmaE stress response in related genomes. PLoS Biol 4:e2. 6 2. De Wulf P, McGuire AM, Liu X, Lin EC. 2002. Genome-wide profiling of promoter 7
recognition by the two-component response regulator CpxR-P in Escherichia coli. J Biol Chem 8 277:26652-26661. 9
3. Ferrieres L, Clarke DJ. 2003. The RcsC sensor kinase is required for normal biofilm formation 10 in Escherichia coli K-12 and controls the expression of a regulon in response to growth on a solid 11 surface. Mol Microbiol 50:1665-1682. 12
4. McHugh JP, Rodriguez-Quinones F, Abdul-Tehrani H, Svistunenko DA, Poole RK, Cooper 13 CE, Andrews SC. 2003. Global iron-dependent gene regulation in Escherichia coli. A new 14 mechanism for iron homeostasis. J Biol Chem 278:29478-29486. 15
16
10
1 Figure S1 Audrain et al 2
Sublethal concentrations of ApoEdpL-W have only a mild effect on E. coli growth. E. coli 3
growing cells were exposed to 0, 3 and 3.5 µM of ApoEdpL-W for 45 min and samples were 4
taken every 15 min, serially diluted and plated on LB plates. Percent of survival was calculated 5
by CFU counting and compared to numbers obtained at t=0 min. Statistical analysis: asterisks 6
indicate values significantly different from no ApoEdpL-W condition by the two-tailed unpaired 7
Student’s t-test : *p<0.05. 8
9
11
1 2
Figure S2 Audrain et al 3
The σE pathway is not required for E. coli tolerance to ApoEdpL-W. Decreased σE activity in 4
the wild-type strain or cpxR mutant did not significantly affect E. coli tolerance to ApoEdpL-W. 5
Survival of the wild-type strain carrying an empty vector or pCA24N-rseA (A) and cpxR mutant 6
carrying an empty vector or pCA24N-rseA (B) upon exposure to ApoEdpL-W. Cells were grown 7
in MH medium plus chloramphenicol and IPTG (0.01mM) until reaching OD600 0.1. They were 8
exposed to 0 and 5 µM (MIC) of ApoEdpL-W for 80 min. Samples were taken every 20 min, 9
serially diluted and plated on appropriate LB plates. Survival of each strain was estimated by 10
CFU counting and compared to numbers obtained prior to ApoEdpL-W treatment. NS: not 11
significant by two-tailed unpaired Student’s t-test. 12
12
1 2
3
Figure S3 Audrain et al 4
Impact of DegP on planktonic E. coli tolerance to ApoEdpL-W. degP mutation increased E. 5
coli susceptibility to ApoEdpL-W, whereas complementation of degP mutant with pCA24N-6
degP restored the wild-type phenotype. Wild-type strain, its corresponding degP mutant and the 7
complemented strain were grown in MH medium plus chloramphenicol and IPTG (0.025 mM) 8
until reaching OD600 0.1. They were exposed to 0 and 5 µM (MIC) of ApoEdpL-W for 60 min. 9
Survival of each strain was estimated by CFU counting and compared to numbers obtained prior 10
to ApoEdpL-W treatment. Statistical analysis: *p<0.05; NS: not significant by two-tailed 11
unpaired Student’s t-test. 12
13
14
15
13
1
2 3
4
Figure S4 Audrain et al 5
Induction of the Cpx pathway increased E. coli tolerance to ApoEdpL-W. Overexpression of 6
NlpE increased E. coli tolerance to ApoEdpL-W in a CpxR dependent manner. Survival of the 7
wild type strain carrying an empty vector or pBAD-nlpE and cpxR mutant carrying an empty 8
vector or pBAD-nlpE upon exposure to ApoEdpL-W. Cells were grown in MH medium plus 100 9
µg/ml ampicillin and 0.05% arabinose until reaching OD600 0.1. They were exposed to 0 and 5 10
µM (MIC) of ApoEdpL-W for 80 min. Survival of each strain was estimated by CFU counting 11
and compared to numbers obtained prior to ApoEdpL-W treatment. Statistical analysis: *p<0.05 12
and **p<0.01 by two-tailed unpaired Student’s t-test. 13