T-DNA Mutagenesis Purpose: Determine gene function to produce better plants for society
T-DNA Mutagenesis
Purpose: Determine gene function to
produce better plants for society
Mutant: An organism that differs from the “normal” or wild type by one or more changes in its DNA sequence.
Mutagenesis: Chemical or physical treatment that changes the nucleotide sequence of DNA. Can leadto changes in DNA sequence passed on to the next generation.
Mutagenesis
- Single nucleotide change G --> A
Mutagenesis- creating mutants
ATTAGGCTACCGTTAATCCGATGGCA
ATTAGACTACCGTTAATCTGATGGCA
-Or delete or add a nucleotide
Normal: Wild type MutantMutagenesis
- Delete a segment of DNA - delete many nucleotides
Mutagenesis- larger mutations
Insert a segment of DNA = “Insertional”
XX
Insertion tagging
• Principle: A DNA fragment (with a known sequence) is allowed to insert into the genome (when it lands in a gene, it usually causes a recessive, loss of function mutation).
Insertion tagging
• Advantages:
– tags or marks the gene.
– Provides a powerful way to identify or fish the gene out.
• Disadvantages: – Cannot knock out essential genes.
– Other redundant genes mask knock-out.
– May disrupt non-functional sub-region of gene.
Is it useful?
• Highly and broadly useful
• Applied to most organisms.
• Mice, bacteria, yeast and plants have had their genes inactivated by knockouts.
T-DNA Mutagenesis: A method of disrupting genes in plants with a “T-DNA” to “knock-out” gene function and activity.
T-DNAT-DNA = = TTransfer ransfer DNADNAa segment of DNA derived from the Ta segment of DNA derived from the Tii plasmid contained plasmid contained inside the bacterium, inside the bacterium, Agrobacterium tumefaciens. “Agro”Agrobacterium tumefaciens. “Agro”= plant pathogen= plant pathogen
TransferredTransferred from the bacterium to the plant. from the bacterium to the plant. Randomly integrated into chromosomal sites in the nuclei.Randomly integrated into chromosomal sites in the nuclei.
Agrobacterium tumefaciens - and Ti PlasmidAgrobacterium tumefaciens - and Ti Plasmid
Soil Bacterium infects plants Soil Bacterium infects plants through wounds & openingsthrough wounds & openingsAnd causes crown gall And causes crown gall tumors….tumors….by expressing genes on aby expressing genes on aTTii plasmid - Tumor Inducing plasmid - Tumor Inducing PlasmidPlasmid
Ti PlasmidTi Plasmid
• Contains genes for: Contains genes for:
Plant growth hormones Plant growth hormones - cytokinins and auxins.- cytokinins and auxins. - stimulate undifferentiated growth- stimulate undifferentiated growth
Opine biosynthesis - food for Agrobact.Opine biosynthesis - food for Agrobact.
Opine catabolismOpine catabolism
Acetosyringone receptors Acetosyringone receptors
Plant wound produces acetosyringone
Bacteria is attracted to wound - receptor tells bacteria to swim to wound
Bacterial T-plasmid produces receptors for acetosyringone
T-DNA is excised from Ti plasmid and integrates into plant genome. Genes on T-DNA are activated and stimulate cell proliferation.
and Opine genes produce bacterial nutrients “Opines”
Tumor-producing genes
Virulence region
Opine catabolism
ORI
T-DNAregion
IDEA: Ti- Plasmid, Tumor producing genes can be Replaced with other genes. New genes will be transferred!
Left & right borders must be retained.
Tumor-producing genes
Virulence region
Opine catabolism
ORI
T-DNAregion
Ti- Plasmid - delete genes for tumor and Agro nutrients
X XXX
Virulence region
Opine catabolism
ORI
T-DNAregion
Ti- Plasmid - delete genes for tumor and Agro nutrients
New Gene
New foreign genes can be carried as passengers when the T-DNA integrates into plant genome.
No tumors formed when auxin and cytokinin genes are replaced - plant has taken up T-DNA but no disease!
= Disarmed Ti Plasmid
What kind of genes can be added to T-DNA?
- Any gene
- Selectable marker
Kanamycin Resistance Hygromycin R “
- reporter gene, marks cells to show they are transformed. Not always used.
- genes for crop improvement, disease & insect resistance, new proteins,Vitamins, many possibilities
Leftborder
Rightborder
HygR GFP
Plants will be hygromycin resistant and express green fluorescent protein.
Modified T-DNA for GFP Expression
• Green fluorescent protein (GFP)
From luminescent jellyfish Aequorea victoria.Produces green fluorescence under blue and UV light
Root Root Hair cotyledon
Light
Dark
Redistribution of GFP-2SC in the Light
GFP-2SC moves from vacuole to ER and golgi, from Dark to Light
Protoplasts: plants with cell walls removed.
Leftborder
Rightborder
KanR
Plants will be Kanamycin resistant.
Might disrupt a gene or spacer DNA.
Modified T-DNA for Mutagenesis
Transformation with Disarmed Ti-plasmid in Agrobacterium
- Mix Agro containing Ti-plasmid with:
- Wounded leaf - Plant cells in culture - Floral dip under vacuum
-plant cells or seeds on growth media containing selection antibiotic (i.e. Kan).-Only engineered plants grow
Genome-wide insertional mutagenesis of Arabidopsis thaliana (2003)
• Objective: create loss of function mutations for all genes.
• Strategy: use T-DNA (with kanamycin-resistance gene as selectable marker) to generate collection of 150,000 T1 transformants.
• > 225,000 independent T-DNA integration events thus far.
Arabidopsis• Genome size = 125,000 kb; Average gene length = 2 kb
• Random distribution of insertion events, predicts 96.6% probability of finding an insertion in an average gene
• To determine the site of integration of each T-DNA, junction sequences were analyzed and 88,122 sites were proven to be at a single genomic location
• Of the 29,454 annotated genes, 21,799 (74%) were hit.
• Create a catalog and allow researchers to order seeds for their favorite gene disruption on-line.
2000 bp
1253
32
1423
32
CNGC10
Not all genes can be knocked out.
T-DNA
Distribution of T-DNAs showed hot spots (in gene-rich regions) and cold spots (in centromere and Peri-centromeric regions)
T1 generation - first generation after T-DNA insertion Single T-DNA insertion
T-DNA - heterozygous - 1 normal gene - 1 disrupted gene
Obtaining Homozygous - 2 T-DNAs in same gene
Heterozygous is self-pollinated
N T
N T
N T
NN NT
TN TT
Need homozygous - both copies knocked out
T-DNA - Homozygous
Screen for homozygotes by PCR using combinations of primers to the T-DNA and to the target gene to be knocked out
T-DNA Gene 3’Gene 3’Gene 5’Gene 5’
PCR screen T-DNA mappingPCR screen T-DNA mapping
No PCR product with this primer
Non-perfect, but usable, results