T-Cell mRNA Expression in Response to Mycobacterium bovis BCG Vaccination and Mycobacterium bovis Infection of White-Tailed Deer

CLINICAL AND VACCINE IMMUNOLOGY, Aug. 2009, p. 1139–1145 Vol. 16, No. 81556-6811/09/$08.00�0 doi:10.1128/CVI.00424-08

T-Cell mRNA Expression in Response to Mycobacterium bovis BCGVaccination and Mycobacterium bovis Infection of White-Tailed Deer�

Tyler C. Thacker,* Mitchell V. Palmer, and W. Ray WatersU.S. Department of Agriculture, Agricultural Research Service, Bacterial Diseases of Livestock Research Unit,

National Animal Disease Center, 2300 Dayton Ave., Ames, Iowa 50010

Received 15 November 2008/Returned for modification 10 December 2008/Accepted 1 June 2009

Understanding immune responses of white-tailed deer (WTD) to infection with Mycobacterium bovis providesinsight into mechanisms of pathogen control and may provide clues to development of effective vaccinestrategies. WTD were vaccinated with either M. bovis BCG strain Pasteur or BCG strain Danish. Both vaccineesand unvaccinated controls were subsequently inoculated with virulent M. bovis via the intratonsillar route.Real-time PCR was used to assess T-cell mRNA expression in peripheral blood leukocytes (PBL) from animalsfollowing vaccination and infection. Recall T-cell responses were measured by assessing the relative expressionof gamma interferon (IFN-�), T-cell-specific T-box transcription factor (Tbet), interleukin 12p40 (IL-12p40),IL-12p35, IL-23p19, FoxP3, IL-17, and GATA3 in PBL stimulated in vitro with purified protein derivative(PPD) of M. bovis or a recombinant fusion protein, ESAT6-CFP10. Animals vaccinated with BCG Danishexpressed more IFN-� and Tbet than either BCG Pasteur-vaccinated animals or unvaccinated controls. BCGPasteur-vaccinated animals expressed more GATA3 than either group. After infection, unvaccinated controlsexpressed more Tbet and IL-12p40 than vaccinated animals. BCG Pasteur-vaccinated animals expressed moreGATA3 than either the unvaccinated controls or the BCG Danish-vaccinated animals after infection. Animalswere divided into pathology groups to correlate gene expression with severity of pathology. Animals in thevisible lesion group expressed more Tbet and IFN-� than animals that were culture negative, while Tbet andIFN-� expression in the culture-positive, no-visible-lesion group was intermediate. GATA3 expression inverselycorrelated with pathology. Overall, expression of immune response genes correlated more closely with pathol-ogy than vaccination treatment.

A self-sustaining outbreak of Mycobacterium bovis in free-ranging white-tailed deer ([WTD] Odocoileus virginianus) hasoccurred in Michigan (36, 37). Epidemiological and strain typ-ing evidence suggests that infected WTD serve as a reservoirsince interspecies transmission from deer to cattle occurs (21,25, 29). In Minnesota, infected WTD have been found adjacentto infected cattle (http://www.bah.state.mn.us/tb/). It is not yetknown if the 18 infected deer (from 2005 to 2008) represent aself-sustaining outbreak. Control of these wildlife reservoirsmay be critical to preventing continued infection of domesticcattle. In Michigan, efforts to control tuberculosis (TB) infree-ranging WTD through removal of WTD and throughchanges in management practices, while providing some ben-efit, have not yet proven effective in eliminating the reservoir(22). Similar experiences have occurred in other areas of theworld where a wildlife reservoir exists (6, 7). Development ofan effective vaccine may provide a significant tool for eradica-tion of M. bovis from the free-ranging WTD population.

Immunological responses of WTD and other ruminants toM. bovis infection appear to be complex. The adaptive immuneresponse is believed to be primarily responsible for immunityto M. bovis infection. Specific T-cell responses have beenroughly divided into four types: T-helper type 1 (TH1), TH2,TH17, and regulatory T cells (Treg). Each of these responses

has been reported to play a role in M. bovis immunity orpathology. TH1 responses, characterized by gamma interferon(IFN-�) expression, are required for effective immune re-sponses to mycobacteria (4, 9). However, IFN-� expressiondoes not correlate with protection in mice (8, 19), deer (42), orcattle (41, 44). Two closely related cytokines, interleukin-12(IL-12) and IL-23, mediate TH1 and TH17 responses, respec-tively (13). The proinflammatory TH17 cells produce IL-17 inresponse to antigens; these cells are implicated in inflamma-tory diseases such as experimental autoimmune encephalomy-elitis (15) and have been implicated in playing a role in TB(13). In mice, IL-17 is not required for initial clearance of M.bovis BCG but is required for protection after challenge withM. tuberculosis (12), suggesting that IL-17 may be important inlong-term immunity to mycobacteria.

TH2 responses are implicated in poor prognosis relative toTB (31, 33, 38, 47), presumably by interfering with TH1-me-diated responses. In the murine model, blocking IL-4 in vivoresults in decreased bacterial burden, suggesting that TH2responses are detrimental to mycobacterial control (35). Asimilar detrimental role for IL-4 has been suggested from stud-ies in humans where IL-4 and IL-13 mRNA expression corre-late with disease severity (32, 38). In addition to TH2, Tregresponses are implicated in limiting protective immunity (5, 10,16). Treg frequency is increased in peripheral blood and sitesof infection in TB patients and correlates with disease severity(10, 16).

Vaccination of WTD with the M. bovis BCG strain Danish(20) or BCG strain Pasteur (23) has been shown to be effica-cious as measured by a reduction in pathology (24). To deter-

* Corresponding author. Mailing address: National Animal DiseaseCenter, Bacterial Diseases of Livestock Research Unit, 2300 DaytonAve., Ames, IA 50010. Phone: (515) 663-7294. Fax: (515) 663-7458.E-mail: [email protected].

� Published ahead of print on 10 June 2009.

1139

on July 1, 2015 by guesthttp://cvi.asm

.org/D

ownloaded from

mine T-cell-mediated responses induced by vaccination withthese BCG strains and to correlate these responses to protec-tion/pathology, WTD were vaccinated with either BCG Danishor BCG Pasteur and subsequently infected with virulent M.bovis. Sixteen weeks after vaccination and then 16 weeks afterinfection, gene expression was measured in isolated peripheralblood leukocytes (PBL) stimulated with either purified proteinderivative (PPD) of M. bovis or the recombinant fusion proteinESAT6 (early secreted antigenic target 6-kDa protein)-CFP10(culture filtrate 10-kDa protein). ESAT6-CFP10 was evaluatedbecause it is one of the dominant T-cell antigen proteins pro-duced by M. bovis (1, 30, 40) and has been used to increasediagnostic test specificity (45, 46). TH1 responses were evalu-ated using the T-cell-specific T-box transcription factor (Tbet),IFN-�, and IL-12p35. TH2 responses were evaluated by mea-suring transcription of GATA binding protein 3 transcriptionfactor (GATA3), IL-4, and IL-10. TH17 responses were eval-uated using IL-17, and IL-23p19 mRNA and Treg responseswere evaluated using the transcription factor Forkhead box P3(FoxP3).

MATERIALS AND METHODS

Animals, vaccination, and challenge. Thirty-five WTD (�1 year old) wereobtained from a captive breeding herd (TB and paratuberculosis free) at theNational Animal Disease Center (Ames, IA). All deer were housed and cared foraccording to institutional guidelines, and procedures were approved by the In-stitutional Animal Care and Use Committee prior to the beginning of theexperiment. Deer were randomly assigned to one of three groups: a groupreceiving one subcutaneous dose of 107 CFU of M. bovis BCG Pasteur (n � 12),a group receiving one subcutaneous dose of 107 CFU of M. bovis BCG Danish(n � 11), or a group of unvaccinated deer (n � 12). After 120 days deer receivedintratonsillar inoculations of approximately 495 CFU of M. bovis strain 95-1315into each tonsillar crypt, for a total dose of 990 CFU, as described previously(28).

Strain 95-1315 used for challenge was originally isolated from a free-ranging,naturally infected WTD in Michigan. For inoculation, deer were anesthetized byintramuscular injection of a combination of xylazine (2 mg/kg of body weight)(Mobay Corporation, Shawnee, KS) and ketamine (6 mg/kg) (Fort Dodge Lab-oratories, Fort Dodge, IA). After inoculation, the effects of xylazine were re-versed by intravenous injection of tolazoline (4 mg/kg) (Lloyd Laboratories,Shanandoah, IA). Vaccinated and unvaccinated deer were housed together in anoutdoor paddock prior to challenge with virulent M. bovis, at which time theywere moved to an appropriate biosecurity level 3 animal facility. Deer were feda commercial pelleted feed with free access to water.

The M. bovis BCG strains as well as the challenge strain M. bovis 95-1315 wasgrown in Middlebrook’s 7H9 medium supplemented with 10% oleic acid-albu-min-dextrose complex (Difco, Detroit, MI) plus 0.05% Tween 80 (Sigma Chem-ical Co., St. Louis, MO), as described previously (2). Mid-log-phase growthbacilli were pelleted by centrifugation at 750 � g, washed twice with phosphate-buffered saline (0.01 M; pH 7.2), and diluted to the appropriate cell density in 2ml of phosphate-buffered saline. Bacilli were enumerated by serial dilution platecounting on Middlebrook 7H11 selective medium (Becton Dickinson, Cock-eysville, MD).

Necropsy and tissue sampling. At 130 days postchallenge with virulent M.bovis, all deer were euthanized by intravenous sodium pentobarbital. At nec-ropsy, the following tissues or fluids were collected and processed for isolation ofM. bovis and microscopic analysis as described previously (26): palatine tonsil,lung, liver, and the mandibular, parotid, medial retropharyngeal, tracheobron-chial, mediastinal, hepatic, mesenteric, and prefemoral lymph nodes. Tissueswere processed for isolation of M. bovis as previously described (27). Isolates ofM. bovis were identified by colony morphology, growth, and biochemical char-acteristics as well as by PCR.

Leukocyte preparation and culture. Total PBL were prepared from the buffycoat fraction of blood collected in the anticoagulant acid-citrate-dextrose at 16weeks after vaccination (prior to infection) and 16 weeks after infection (32weeks after vaccination). Contaminating red blood cells were removed by hypo-tonic lysis as described previously (11, 34). PBL were seeded into 96-well round-bottom microtiter plates (Falcon, Becton-Dickinson; Lincoln Park, NJ) at 1 �

106 cells in a total volume of 200 �l of complete RPMI medium (RPMI 1640medium with 2 mM L-glutamine, 25 mM HEPES buffer, 100 units/ml penicillin,0.1 mg/ml streptomycin, 1% nonessential amino acids [Sigma, St. Louis, MO],2% essential amino acids [Sigma], 1% sodium pyruvate [Sigma], 50 �M 2-mer-captoethanol [Sigma], and 10% [vol/vol] fetal bovine serum). Wells containedmedium alone (nil stimulated) or either 10 �g/ml M. bovis PPD or 10 �g/mlESAT6-CFP10. PPD was obtained from CSL Animal Health, Parkville, Victoria,Australia, and ESAT6-CFP10 was kindly provided by F. Chris Minion. Cultureswere incubated at 37°C in a 5% CO2 atmosphere for 16 h.

Isolation and reverse transcription of leukocyte RNA. Isolation and reversetranscription of PBL RNA were performed as previously described (42). Briefly,cells were harvested by centrifugation, lysed with 150 �l of buffer RLT (Qiagen,Valencia, CA), and stored at �80°C. RNA was isolated using an RNeasy MiniKit (Qiagen) according to the manufacturer’s directions and eluted from thecolumn with 50 �l of RNase-free water (Ambion, Austin, TX). ContaminatingDNA was enzymatically removed by treating RNA with DNA-free (Ambion).Twenty microliters of RNA was reverse transcribed in a 50-�l reaction mixtureusing SuperScript II (Invitrogen, Carlsbad, CA) with 0.5 �g of oligo(dT)12-18 and40 units of RNaseOut (Invitrogen), according to the manufacturer’s directions.Samples were heated to 70°C for 5 min and then reverse transcribed at 42°C for60 min. The resulting cDNA was stored at �80°C until used in real-time PCRs.

Analysis of cytokine gene expression by real-time PCR. Real-time PCR wasperformed using SYBR green Master Mix (Applied Biosystems, Foster City, CA)according to the manufacturer’s directions. Briefly, 2.5 �l of cDNA was added toa 25-�l reaction mixture with 1 �M of each primer. Primers used were designedusing bovine sequences with Primer3Plus (43) and then sequenced to ensurecorrect design. The following primer pairs were used: FoxP3 Forward, TACGGGGCTCTTCTCTCTCA; FoxP3 Reverse, ACAGTCGAAAGGGTGCTGTC;GATA-3 Forward, AACCGGGCATTACCTGTGTA; GATA-3 Reverse, AGGACGTACCTGCCCTTCTT; IL-12p35 Forward, TGACAACCCTGTGCCTTAAA; IL-12p35 Reverse, CCTGCATCAGCTCAGCAATA; IL-23p19 Forward,TCACAGGGGAGCCTTCTCTA; IL-23p19 Reverse, AGTTCCCTGAGGCCCAGTAT; IL-17 Forward, CACAGCATGTGAGGGTCAAC; IL-17 Reverse,GGTGGAGCGCTTGTGATAAT; T-bet Forward, CCTGGACCCAACTGTCAACT; T-bet Reverse, GGTAGAAACGGCTGGAGATG. Primers for IFN-�,IL-12p40, IL-4, and IL-10 were as described previously (42). All reactions wereperformed in triplicate, and data were analyzed with the 2���Ct method as

FIG. 1. Relative cytokine gene expression in vaccinated and controlanimals 16 weeks after vaccination. Gene expression was measured inPBL that were stimulated with PPD. Data are presented as means standard errors of the means relative to prevaccination. Statisticalanalysis was performed as described in Materials and Methods.

1140 THACKER ET AL. CLIN. VACCINE IMMUNOL.

on July 1, 2015 by guesthttp://cvi.asm

.org/D

ownloaded from

FIG. 2. Cytokine gene expression in vaccinated and control animals 16 weeks after infection with M. bovis. Gene expression was measured inPBL stimulated with either PPD or ESAT6-CFP10 (EC). Data are presented as means standard errors of the means relative to prevaccination.Statistical analysis was performed as described in Materials and Methods.

1141

on July 1, 2015 by guesthttp://cvi.asm

.org/D

ownloaded from

described previously (18). -Actin served as the internal control to normalizeRNA content between samples. The nil-stimulated sample was used as thecalibrator. The use of -actin as the internal control was validated as suggestedby Livak and Schmittgen (18). The data are expressed relative to samples col-lected prior to vaccination.

Statistical analysis. All statistical analyses were performed with SAS software,version 9.1.3 (SAS Institute, Inc., Cary, NC). A mixed model for repeatedmeasures (PROC MIXED) using the spatial power law for unequally spacedtime points as the repeated effect (17) was used. For each stimulus and gene, theoutcome variable (2���Ct) was log transformed. The model accounted for theeffects of vaccination/pathology and time along with the interaction of vaccina-tion/pathology and time. Prior to either analysis, the following covariance struc-tures were tested, and the structure with the lowest scores was used in the finalanalysis: �2 REML (residual maximum likelihood) log likelihood, Akaike’sinformation criterion, and the Schwarz’s Bayesian information criterion. AP value of less than 0.05 was considered significant.

Correlations were calculated using the PROC CORR function (SAS). A Pear-son product moment correlation was calculated for cytokine-to-cytokine corre-lations. Correlation of cytokine gene expression with pathology was performedusing Spearman’s correlation using the relative gene expression verses pathology.The pathology groups were assigned the following ordinal values: culture nega-tive (CN group), 1; no visible lesions (NVL group), 2; and visible lesions (VLgroup), 3. Effects with a P value of less than 0.05 and an R value of greater than0.5 were considered significant.

RESULTS

Vaccine-induced immunological responses. Sixteen weeksafter vaccination and prior to infection, PPD-specific immuneresponses were evaluated. Animals vaccinated with BCG Dan-ish expressed approximately twofold more Tbet mRNA in re-sponse to PPD than did the unvaccinated controls (Fig. 1A),whereas the BCG Pasteur-vaccinated animals were not statis-tically different from controls. IFN-� expression followed apattern similar to that of Tbet expression (Fig. 1B). Animalsvaccinated with BCG Danish expressed 15-fold more IFN-�mRNA than controls expressed and 7-fold more than the BCGPasteur-vaccinated animals. Vaccination did not induce signif-icant differential expression of GATA3, IL-4, IL-10, IL-12p35,IL-12p40, IL-17, IL-23p19, and FoxP3 in response to PPDstimulation (data not shown). There was no significant geneexpression in response to ESAT6-CFP10 stimulation in con-junction with BCG vaccination (data not shown). These dataare consistent with the absence of the genes encoding ESAT6or CFP10 in BCG Danish or BCG Pasteur.

Gene expression in vaccinees after infection. Sixteen weeksafter infection, PPD- and ESAT6-CFP10-specific immune re-sponses were evaluated. When recall responses to ESAT6-CFP10 were evaluated, BCG Danish-vaccinated deer ex-pressed 1.9-fold less Tbet mRNA than unvaccinated controls(Fig. 2A), and FoxP3 gene expression was 1.3-fold greater (Fig.2E). No significant differences between IFN-�, IL-12p40, IL-17, IL-4, IL-10, or GATA3 gene expression in response toESAT6-CFP10 stimulation were detected between BCG Dan-ish vaccinees and unvaccinated controls (Fig. 2 and data notshown). PPD stimulation resulted in decreased IL-12p40 ex-pression in the PBL from BCG Danish vaccinees compared tocontrols. Tbet, IFN-�, GATA3, or FoxP3 gene expression lev-els were not different between the BCG Danish vaccinees andunvaccinated controls (Fig. 2).

PBL from BCG Pasteur-vaccinated animals expressed sig-nificantly less Tbet and IL-12p40 mRNA than controls whencells were stimulated with ESAT6-CFP10, whereas GATA3and FoxP3 mRNA increased (Fig. 2). IFN-�, IL-17, IL-4, or

IL-10 recall responses to ESAT6-CFP10 were not significantlydifferent between these two groups. When PPD was used asthe antigen, PBL from BCG Pasteur vaccinees expressed sig-nificantly less IL-12p40 and significantly more GATA3 andFoxP3 (Fig. 2). IFN-�, Tbet, IL-17, IL-4, and IL-10 mRNAexpression levels were not significantly different between BCGPasteur-vaccinated deer and controls when cells were stimu-lated with PPD (Fig. 2 and data not shown).

Gene expression was similar between BCG Danish- andBCG Pasteur-vaccinated animals as determined by measure-ment of Tbet, IFN-�, IL-12p40, IL-17, IL-4, IL-10, and FoxP3(Fig. 2 and data not shown). BCG Pasteur-vaccinated animalsexpressed significantly more GATA3 mRNA than eitherBCG Danish-vaccinated animals or the unvaccinated con-trols (Fig. 2D).

Across all time points and conditions IFN-� gene expressioncorrelated with Tbet expression (for PPD, R � 0.86 and P �0.0001; for ESAT6-CFP10, R � 0.79 and P � 0.0001). Neithervaccination nor infection induced significant IL-12p35 or IL-23p19 mRNA expression in stimulated PBL.

Correlation of cytokine gene expression with pathology. M.bovis infection of WTD produces variable pathology. To assessthe association between gene expression and pathology, ani-mals were divided into three pathology groups, irrespective ofvaccine, based on pathology and culture results (Table 1).Animals with visible lesions at necropsy and from which M.bovis was cultured were included in the VL group (n � 6). M.bovis culture-positive animals with no gross lesions were as-signed to the NVL group (n � 5). M. bovis culture-negativeanimals without visible lesions were assigned to the CN group(n � 13). The low numbers of vaccinated animals in the VLand NVL pathology groups prevented the analysis of vaccine-

TABLE 1. Pathology and culture results

Animal Vaccine Lesion Lung/LNa Head LNb Culturec Group

903 Control VL � � � VL919 Control VL � � � VL933 Control VL � � � VL895 Control VL � � � VL888 Danish VL � � � VL922 Pasteur VL � � � VL877 Control NVL � � � NVL929 Control NVL � � � NVL899 Danish NVL � � � NVL923 Danish NVL � � � NVL898 Pasteur NVL � � � NVL881 Control NVL � � � CN886 Control NVL � � � CN920 Control NVL � � � CN891 Danish NVL � � � CN897 Danish NVL � � � CN901 Danish NVL � � � CN904 Danish NVL � � � CN927 Danish NVL � � � CN878 Pasteur NVL � � � CN879 Pasteur NVL � � � CN884 Pasteur NVL � � � CN906 Pasteur NVL � � � CN907 Pasteur NVL � � � CN

a Visible lesions in the lungs and/or associated lymph nodes.b Visible lesion in the lymph nodes of the head.c Isolation of M. bovis from one or more tissues.

1142 THACKER ET AL. CLIN. VACCINE IMMUNOL.

on July 1, 2015 by guesthttp://cvi.asm

.org/D

ownloaded from

specific effects on gene expression and pathology; therefore,the association of gene expression with pathology was per-formed irrespective of vaccination.

Sixteen weeks after challenge with virulent M. bovis, Tbetgene expression in response to PPD stimulation was approxi-mately four- and threefold greater in PBL from the VL groupthan in the CN and NVL groups, respectively, while the NVLgroup expressed 1.5-fold more than the CN group (Fig. 3A).Recall responses to ESAT6-CFP10 resulted in approximatelyfivefold greater Tbet expression in the VL group than in eitherthe NVL or CN group.

IFN-� gene expression was greatest in the VL group, with nosignificant difference between the NVL and CN groups (Fig.3B). IFN-� expression in PBL from the VL group was 86-foldgreater than in the CN group and 26-fold greater than that inthe NVL group when cells were stimulated with PPD. ESAT6-

CFP10 stimulation of PBL from the VL group resulted inIFN-� mRNA expression at levels 193-fold greater than in theCN group and 110-fold greater than in the NVL group. IFN-�mRNA expression was not statistically different between theNVL and CN groups, regardless of antigenic stimulus. IFN-�mRNA expression correlated with pathology (for PPD, R �0.68989 and P � 0.0008; for ESAT6-CFP10, R � 0.79805 andP � 0.0001). Tbet expression correlated with IFN-� (r � 0.86and P � 0.0001) expression.

IL-17 expression in the VL group was approximately 4-and 25-fold greater than expression in the NVL and CNgroups, respectively, when cells were stimulated withESAT6-CFP10 (Fig. 3C). There were no statistically signif-icant differences in IL-17 gene expression detected in thePPD-stimulated cells primarily due to one animal with highexpression levels in the NVL group; however, IL-17 expres-

FIG. 3. T-cell mRNA expression in different pathology groups following vaccination and infection. Animals were grouped by pathology. Tbet(A), IFN-� (B), IL-17 (C), FoxP3 (D), and GATA3 (E) were measured in PBL stimulated with either PPD or ESAT6-CFP10 (EC) 16 weeks afterinfection with M. bovis. Data are presented as means standard errors of the means relative to prevaccintion.

VOL. 16, 2009 IMMUNOLOGICAL RESPONSES OF WTD TO M. BOVIS INFECTION 1143

on July 1, 2015 by guesthttp://cvi.asm

.org/D

ownloaded from

sion correlated with pathology (for PPD, R � 0.57997 andP � 0.0147; for ESAT6-CFP10, R � 0.81482 and P �0.0002). Expression of IL-23, a cytokine that is closely re-lated to IL-17, correlated with IL-17 expression (r � 0.56and P � 0.03; data not shown).

FoxP3, a transcription factor responsible for Treg differen-tiation and function, was not differentially regulated betweenthe groups in this study (Fig. 3D). GATA3 expression inverselycorrelated with pathology (Fig. 3E) (R � �0.67834; P �0.0020). When cells were stimulated with ESAT6-CFP10, theVL group expressed approximately 1.5-fold fewer GATA3transcripts than the CN group, and the NVL group was inter-mediate. When cells were stimulated with PPD, the NVL andVL groups expressed similar levels of GATA3, yet each ex-pressed less than the CN group (Fig. 3D).

DISCUSSION

Differential immune responses as measured by mRNA ex-pression were elicited by vaccination with BCG Danish versusBCG Pasteur. BCG Danish vaccination induced stronger TH1responses, as indicated by Tbet and IFN-� expression. Unex-pectedly, BCG Pasteur vaccination elicited greater GATA3expression than vaccination with BCG Danish. After infection,BCG Danish-vaccinated animals did not have lesions in head-or lung-associated lymph nodes; however, they did have min-imal lung lesions (24). In contrast, BCG Pasteur-vaccinatedanimals had lesions in head- and lung-associated lymph nodesbut none in the lungs (24). Differential gene expression inperipheral blood may explain, in part, the observed differencein lesion location. BCG Danish induced a stronger IFN-� re-sponse (Fig. 1) in peripheral leukocytes that may be reflectiveof immune competence in the lymph nodes that prevents es-tablishment of infection at that site. BCG Pasteur may gener-ate a more tissue-oriented immune response since the IFN-�response was low in peripheral blood (Fig. 1) and since therewere no lesions in the lungs.

TH1 immune responses after infection were generallygreater in the unvaccinated group than in either vaccine group.The large variation observed, particularly with IFN-� expres-sion, obscured vaccine effects (Fig. 2B). This large variationmay be explained by the failure of the vaccine in some animalsto limit pathology. When gene expression is considered irre-spective of the vaccine group, the variation is considerablysmaller (Table 1; Fig. 3B). The correlation of IFN-� expressionto pathology is consistent with previously published data fromWTD (42) and cattle (41, 44). IL-17 expression was similar tothat of the IFN-� (Fig. 3). These data are consistent withprevious reports that vaccination of mice produces similarnumbers of IFN-�- and IL-17-producing cells in the lungs (12).In addition, it has been reported that IL-17 was not requiredfor the primary response to vaccination; however, it was re-quired for the recall response when the mice were infectedwith virulent M. tuberculosis (12, 48). The contribution of IL-17to pathology is not clear; however, the absence of IL-23 andIL-17 in mice results in increased lung inflammation (14) afterTB infection. Here, we report that IL-17 expression correlateswith pathology, suggesting that IL-17 may contribute to overallimmunopathology or is indicative of uncontrolled infection(i.e., continuous antigenic stimulation).

GATA3 gene expression is associated with TH2 differenti-ation (49) and is the transcription factor that is believed to bethe master regulator of TH2 cells (3). Regardless of the vac-cine group, GATA3 expression was least in the VL group andinversely correlated with pathology. These data suggest that,over the time frame examined in this study, increased TH2responses are not indicative of increased pathology (42) andmay correlate with bacterial control. In M. tuberculosis-infectedhumans, GATA3 expression was 3.8-fold greater in patientsthat had fast responses to anti-TB therapy than in those in theslow-response group (39). Among the vaccinees, PBL from theBCG Pasteur-vaccinated animals expressed more GATA3 af-ter infection (Fig. 2D). The relevance of induction of GATA3by BCG Pasteur is not clear; however, these animals did nothave lesions in the lung (24).

In the current study, there was no clear correlation betweengene expression and protection; however, the correlation ofIFN-� with pathology was confirmed, and GATA3 inversecorrelation with pathology is established. Here, we report thatimmune responses in the peripheral blood did not identify amechanism for the differences observed in efficacy, at least forthe genes measured in this experiment. Measurement of im-mune responses at foci of infection may be required to deter-mine the immunological responses that correlate with the dif-ferences in vaccine efficacy.

REFERENCES

1. Andersen, P., A. B. Andersen, A. L. Sorensen, and S. Nagai. 1995. Recall oflong-lived immunity to Mycobacterium tuberculosis infection in mice. J. Im-munol. 154:3359–3372.

2. Bolin, C. A., D. L. Whipple, K. V. Khanna, J. M. Risdahl, P. K. Peterson, andT. W. Molitor. 1997. Infection of swine with Mycobacterium bovis as a modelof human tuberculosis. J. Infect. Dis. 176:1559–1566.

3. Bowen, H., A. Kelly, T. Lee, and P. Lavender. 2008. Control of cytokine genetranscription in Th1 and Th2 cells. Clin. Exp. Allergy 38:1422–1431.

4. Casanova, J. L., and L. Abel. 2002. Genetic dissection of immunity to my-cobacteria: the human model. Annu. Rev. Immunol. 20:581–620.

5. Chen, X., B. Zhou, M. Li, Q. Deng, X. Wu, X. Le, C. Wu, N. Larmonier, W.Zhang, H. Zhang, H. Wang, and E. Katsanis. 2007. CD4� CD25� FoxP3�

regulatory T cells suppress Mycobacterium tuberculosis immunity in patientswith active disease. Clin. Immunol. 123:50–59.

6. Corner, L. A., M. A. Stevenson, D. M. Collins, and R. S. Morris. 2003. There-emergence of Mycobacterium bovis infection in brushtail possums (Tricho-surus vulpecula) after localised possum eradication. N. Z. Vet. J. 51:73–80.

7. Donnelly, C. A., R. Woodroffe, D. R. Cox, F. J. Bourne, C. L. Cheeseman,R. S. Clifton-Hadley, G. Wei, G. Gettinby, P. Gilks, H. Jenkins, W. T.Johnston, A. M. Le Fevre, J. P. McInerney, and W. I. Morrison. 2006.Positive and negative effects of widespread badger culling on tuberculosis incattle. Nature 439:843–846.

8. Elias, D., H. Akuffo, and S. Britton. 2005. PPD induced in vitro interferongamma production is not a reliable correlate of protection against Mycobac-terium tuberculosis. Trans. R. Soc. Trop. Med. Hyg. 99:363–368.

9. Flynn, J. L., J. Chan, K. J. Triebold, D. K. Dalton, T. A. Stewart, and B. R.Bloom. 1993. An essential role for interferon � in resistance to Mycobacte-rium tuberculosis infection. J. Exp. Med. 178:2249–2254.

10. Guyot-Revol, V., J. A. Innes, S. Hackforth, T. Hinks, and A. Lalvani. 2006.Regulatory T cells are expanded in blood and disease sites in patients withtuberculosis. Am. J. Respir. Crit. Care Med. 173:803–810.

11. Kehrli, M. E., Jr., B. J. Nonnecke, and J. A. Roth. 1989. Alterations in bovinelymphocyte function during the periparturient period. Am. J. Vet. Res.50:215–220.

12. Khader, S. A., G. K. Bell, J. E. Pearl, J. J. Fountain, J. Rangel-Moreno, G. E.Cilley, F. Shen, S. M. Eaton, S. L. Gaffen, S. L. Swain, R. M. Locksley, L.Haynes, T. D. Randall, and A. M. Cooper. 2007. IL-23 and IL-17 in theestablishment of protective pulmonary CD4� T cell responses after vacci-nation and during Mycobacterium tuberculosis challenge. Nat. Immunol.8:369–377.

13. Khader, S. A., and A. M. Cooper. 2008. IL-23 and IL-17 in tuberculosis.Cytokine 41:79–83.

14. Khader, S. A., J. E. Pearl, K. Sakamoto, L. Gilmartin, G. K. Bell, D. M.Jelley-Gibbs, N. Ghilardi, F. deSauvage, and A. M. Cooper. 2005. IL-23compensates for the absence of IL-12p70 and is essential for the IL-17

1144 THACKER ET AL. CLIN. VACCINE IMMUNOL.

on July 1, 2015 by guesthttp://cvi.asm

.org/D

ownloaded from

response during tuberculosis but is dispensable for protection and antigen-specific IFN-� responses if IL-12p70 is available. J. Immunol. 175:788–795.

15. Komiyama, Y., S. Nakae, T. Matsuki, A. Nambu, H. Ishigame, S. Kakuta, K.Sudo, and Y. Iwakura. 2006. IL-17 plays an important role in the develop-ment of experimental autoimmune encephalomyelitis. J. Immunol. 177:566–573.

16. Li, L., S. H. Lao, and C. Y. Wu. 2007. Increased frequency of CD4� CD25high

Treg cells inhibit BCG-specific induction of IFN-� by CD4� T cells from TBpatients. Tuberculosis 87:526–534.

17. Littell, R. C., G. A. Milliken, W. W. Stroup, and R. D. Wolfinger. 1996. SASsystem for mixed models. SAS Institute Inc., Cary, NC.

18. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expressiondata using real-time quantitative PCR and the 2���CT method. Methods25:402–408.

19. Majlessi, L., M. Simsova, Z. Jarvis, P. Brodin, M. J. Rojas, C. Bauche, C.Nouze, D. Ladant, S. T. Cole, P. Sebo, and C. Leclerc. 2006. An increase inantimycobacterial Th1-cell responses by prime-boost protocols of immuni-zation does not enhance protection against tuberculosis. Infect. Immun.74:2128–2137.

20. Nol, P., M. V. Palmer, W. R. Waters, F. E. Aldwell, B. M. Buddle, J. M.Triantis, L. M. Linke, G. E. Phillips, T. C. Thacker, J. C. Rhyan, M. R.Dunbar, and M. D. Salman. 2008. Efficacy of oral and parenteral routes ofMycobacterium bovis bacille calmette-guerin vaccination against experimen-tal bovine tuberculosis in white-tailed deer (Odocoileus virginianus): a feasi-bility study. J. Wildl. Dis. 44:247–259.

21. O’Brien, D. J., S. M. Schmitt, J. S. Fierke, S. A. Hogle, S. R. Winterstein,T. M. Cooley, W. E. Moritz, K. L. Diegel, S. D. Fitzgerald, D. E. Berry, andJ. B. Kaneene. 2002. Epidemiology of Mycobacterium bovis in free-rangingwhite-tailed deer, Michigan, USA, 1995–2000. Prev. Vet. Med. 54:47–63.

22. O’B rien, D. J., S. M. Schmitt, S. D. Fitzgerald, D. E. Berry, and G. J.Hickling. 2006. Managing the wildlife reservoir of Mycobacterium bovis: theMichigan, USA, experience. Vet. Microbiol. 112:313–323.

23. Palmer, M. V., T. C. Thacker, and W. R. Waters. 2007. Vaccination ofwhite-tailed deer (Odocoileus virginianus) with Mycobacterium bovis bacillusCalmette Guerin. Vaccine 25:6589–6597.

24. Palmer, M. V., T. C. Thacker, and W. R. Waters. 2008. Vaccination withMycobacterium bovis BCG strains Danish and Pasteur in white-tailed deer(Odocoileus virginianus) experimentally challenged with Mycobacteriumbovis. Zoonoses Public Health 56:243–251.

25. Palmer, M. V., W. R. Waters, and D. L. Whipple. 2004. Investigation of thetransmission of Mycobacterium bovis from deer to cattle through indirectcontact. Am. J. Vet. Res. 65:1483.

26. Palmer, M. V., W. R. Waters, and D. L. Whipple. 2002. Lesion developmentin white-tailed deer (Odocoileus virginianus) experimentally infected withMycobacterium bovis. Vet. Pathol. 39:334–340.

27. Palmer, M. V., W. R. Waters, and D. L. Whipple. 2002. Susceptibility ofraccoons (Procyon lotor) to infection with Mycobacterium bovis. J. Wildl. Dis.38:266–274.

28. Palmer, M. V., D. L. Whipple, and S. C. Olsen. 1999. Development of amodel of natural infection with Mycobacterium bovis in white-tailed deer. J.Wildl. Dis. 35:450–457.

29. Payeur, J. B., S. Church, L. Mosher, B. Robinson-Dunn, S. Schmitt, and D.Whipple. 2002. Bovine tuberculosis in Michigan wildlife. Ann. N. Y. Acad.Sci. 969:259–261.

30. Pollock, J. M., and P. Andersen. 1997. Predominant recognition of theESAT-6 protein in the first phase of interferon with Mycobacterium bovis incattle. Infect. Immun. 65:2587–2592.

31. Ritacco, V., B. Lopez, I. N. De Kantor, L. Barrera, F. Errico, and A. Nader.1991. Reciprocal cellular and humoral immune responses in bovine tuber-culosis. Res. Vet. Sci. 50:365–367.

32. Rook, G. A. 2007. Th2 cytokines in susceptibility to tuberculosis. Curr. Mol.Med. 7:327–337.

33. Rook, G. A., R. Hernandez-Pando, K. Dheda, and G. Teng Seah. 2004. IL-4

in tuberculosis: implications for vaccine design. Trends Immunol. 25:483–488.

34. Roth, J. A., and M. L. Kaeberle. 1981. Evaluation of bovine polymorphonu-clear leukocyte function. Vet. Immunol. Immunopathol. 2:157–174.

35. Roy, E., J. Brennan, S. Jolles, and D. B. Lowrie. 2008. Beneficial effect ofanti-interleukin-4 antibody when administered in a murine model of tuber-culosis infection. Tuberculosis 88:197–202.

36. Schmitt, S. M., S. D. Fitzgerald, T. M. Cooley, C. S. Bruning-Fann, L.Sullivan, D. Berry, T. Carlson, R. B. Minnis, J. B. Payeur, and J. Sikarskie.1997. Bovine tuberculosis in free-ranging white-tailed deer from Michigan. J.Wildl. Dis. 33:749.

37. Schmitt, S. M., D. J. O’Brien, C. S. Bruning-Fann, and S. D. Fitzgerald.2002. Bovine tuberculosis in Michigan wildlife and livestock. Ann. N. Y.Acad. Sci. 969:262–268.

38. Seah, G. T., G. M. Scott, and G. A. Rook. 2000. Type 2 cytokine geneactivation and its relationship to extent of disease in patients with tubercu-losis. J. Infect. Dis. 181:385–389.

39. Siawaya, J. F., N. B. Bapela, K. Ronacher, N. Beyers, P. van Helden, and G.Walzl. 2008. Differential expression of interleukin-4 (IL-4) and IL-4�2mRNA, but not transforming growth factor beta (TGF-), TGF-RII,Foxp3, gamma interferon, T-bet, or GATA-3 mRNA, in patients with fastand slow responses to antituberculosis treatment. Clin. Vaccine Immunol.15:1165–1170.

40. Sorensen, A. L., S. Nagai, G. Houen, P. Andersen, and A. B. Andersen. 1995.Purification and characterization of a low-molecular-mass T-cell antigensecreted by Mycobacterium tuberculosis. Infect. Immun. 63:1710–1717.

41. Thacker, T. C., M. V. Palmer, and W. R. Waters. 2007. Associations betweencytokine gene expression and pathology in Mycobacterium bovis infectedcattle. Vet. Immunol. Immunopathol. 119:204–213.

42. Thacker, T. C., M. V. Palmer, and W. R. Waters. 2006. Correlation ofcytokine gene expression with pathology in white-tailed deer (Odocoileusvirginianus) infected with Mycobacterium bovis. Clin. Vaccine Immunol. 13:640–647.

43. Untergasser, A., H. Nijveen, X. Rao, T. Bisseling, R. Geurts, and J. A.Leunissen. 2007. Primer3Plus, an enhanced web interface to Primer3. Nu-cleic Acids Res. 35:W71–W74.

44. Vordermeier, H. M., M. A. Chambers, P. J. Cockle, A. O. Whelan, J. Sim-mons, and R. G. Hewinson. 2002. Correlation of ESAT-6-specific gammainterferon production with pathology in cattle following Mycobacterium bovisBCG vaccination against experimental bovine tuberculosis. Infect. Immun.70:3026.

45. Vordermeier, H. M., A. Whelan, P. J. Cockle, L. Farrant, N. Palmer, andR. G. Hewinson. 2001. Use of synthetic peptides derived from the antigensESAT-6 and CFP-10 for differential diagnosis of bovine tuberculosis incattle. Clin. Diagn. Lab. Immunol. 8:571–578.

46. Waters, W. R., B. J. Nonnecke, M. V. Palmer, S. Robbe-Austermann, J. P.Bannantine, J. R. Stabel, D. L. Whipple, J. B. Payeur, D. M. Estes, J. E.Pitzer, and F. C. Minion. 2004. Use of recombinant ESAT-6:CFP-10 fusionprotein for differentiation of infections of cattle by Mycobacterium bovis andby M. avium subsp. avium and M. avium subsp. paratuberculosis. Clin. Diagn.Lab. Immunol. 11:729–735.

47. Welsh, M. D., R. T. Cunningham, D. M. Corbett, R. M. Girvin, J. McNair,R. A. Skuce, D. G. Bryson, and J. M. Pollock. 2005. Influence of pathologicalprogression on the balance between cellular and humoral immune responsesin bovine tuberculosis. Immunology 114:101.

48. Wozniak, T. M., A. A. Ryan, and W. J. Britton. 2006. Interleukin-23 restoresimmunity to Mycobacterium tuberculosis infection in IL-12p40-deficient miceand is not required for the development of IL-17-secreting T cell responses.J. Immunol. 177:8684–8692.

49. Zheng, W., and R. A. Flavell. 1997. The transcription factor GATA-3 isnecessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell89:587–596.

VOL. 16, 2009 IMMUNOLOGICAL RESPONSES OF WTD TO M. BOVIS INFECTION 1145

on July 1, 2015 by guesthttp://cvi.asm

.org/D

ownloaded from