Synthesis of a small, cysteine-rich, 29 amino acids long peptide in Mycoplasma pneumoniae

www.fems-microbiology.org

FEMS Microbiology Letters 253 (2005) 315–321

Synthesis of a small, cysteine-rich, 29 amino acids long peptidein Mycoplasma pneumoniae

C.-U. Zimmerman, R. Herrmann *

Zentrum fur Molekulare Biologie Heidelberg (ZMBH), Universitat Heidelberg, 69120 Heidelberg, Germany

Received 2 August 2005; received in revised form 22 September 2005; accepted 30 September 2005

First published online 14 October 2005

Edited by W. Schumann

Abstract

A 205–210 bases long, small RNA (MP200RNA) ofMycoplasma pneumoniae encodes an open reading frame (ORF pmp200) thathas the potential to be translated into a 29 amino acids long peptide with nine cysteines. The expression of this peptide in M. pneu-

moniae was proven indirectly by constructing a gene fusion between the ORF pmp200 and mrfp1, the gene encoding the monomericred fluorescent protein. The fusion construct was translated in M. pneumoniae. The corresponding fusion protein, with a molecularmass of approximately 35,000 Da, was isolated and the correct sequence was proven by Edman degradation and by massspectrometry� 2005 Federation of European Microbiological Societies. Published by Elsevier B.V. All rights reserved.

1. Introduction

Mycoplasma pneumoniae possesses a small genomewith a size of 816 kbp only [1]. Based on the completegenome sequence, presently 688 open reading framesand 42 genes coding for 42 untranslated RNA specieswere predicted [2].

Recently, we described the identification of a heteroge-neous, small and highly abundant RNA, about 205–210bases long, named MP200RNA [3]. It was localized onthe genome within a 319 bp long intergenic space of thepyruvate dehydrogenase (pdh) gene cluster, between pdhBand pdhC (Fig. 1). The 5 0-end of this RNA was deter-mined by primer extension analysis, which permitted todefine the putative promoter region of the small RNA.Prediction of secondary structures indicated that this

0378-1097/$22.00 � 2005 Federation of European Microbiological Societies

doi:10.1016/j.femsle.2005.09.054

* Corresponding author. Tel.: +49 6221 54 68 27; fax: +49 6221 5458 93.

E-mail address: [email protected] (R. Herr-mann).

RNA might function as RNA only, but we could notexclude that it is translated, since anORF (pmp200) couldbe proposedwith the potential to code for a small peptide,29 amino acids long, of which nine are cysteines and sixare lysines, organized in a specific motif.

Such cysteine-rich motifs are found in metallothione-ins and single cysteines with redox properties appear innumerous proteins that function as reducing agents toprotect against oxidative stress, e.g., thioredoxin, perox-idases, Ohr (organic hydrogen peroxide resistance),OsmC proteins [4] and even the tripeptide glutathione.Therefore, we assumed that this peptide might beinvolved in such a response in M. pneumoniae.

So far, our attempts to prove translation of the smallORF failed; neither in vivo labeling with [35S] cysteineand subsequent electrophoretic analysis, nor Westernblotting with antiserum directed against the chemicallysynthesized peptide identified the expected translationproduct. Therefore, we decided to take a geneticapproach to prove its translation by fusing theMP200RNA to the gene encoding the monomeric red

. Published by Elsevier B.V. All rights reserved.

Fig. 1. Cloning strategy of pmp200/mrfp1 and tufP-pmp200/mrfp1. The promoter- and gene constructs were PCR amplified from genomic DNA ofM. pneumoniae M129, ligated with mrfp1 and cloned in pBC before transfer into pKV74. The plasmid pKV74 contains the transposon 4001 whichwas modified by inserting a BamHI site within the IS256 [7] (A) construction of pKVpmp200/mrfp1. (B) construction of pKVtufP-pmp200/mrfp1.

316 C.-U. Zimmerman, R. Herrmann / FEMS Microbiology Letters 253 (2005) 315–321

fluorescent protein (mRFP1) [5] and to search in trans-formants of M. pneumoniae for a fusion protein consist-ing of the 29 amino acids long peptide and mRFP1.

2. Methods

2.1. Bacterial strains

2.1.1. Escherichia coli

Top10 (Invitrogen; Groningen, Netherlands); Geno-type: F mcrA D(mrr-hsdRMS-mcrBC) /80lacZDM15DlacX74 recA1 araD139 D(ara-leu)7697 galU galK rpsL(StrR) endA1 nupG.

2.1.2. Mycoplasma pneumoniae

M129-B18 (ATCC 29342) represents subtype 1 of M.pneumoniae. Cells from the 30th passage were used fortransformation. Cultivation was done as previouslydescribed [6].

2.2. Transformation of M. pneumoniae and isolation of

transformants

M. pneumoniae was transformed with the correspond-ing plasmids by electroporation [7] and single colonies oftransformants were selected on PPLO agar plates con-taining gentamicin (80 lg ml�1) as described [8].

2.3. Transformation of E. coli

Cloning and transformation of E. coli was doneaccording to standard methods [9]. Competent cells,stored at �80 �C, were thawed out on ice. DNA wasadded, and the cells were incubated on ice for an addi-

tional 10 min before heatshock. Cells were shocked at37 �C for 4 min and incubated for 30 min at 37 �C in1 ml standard-I medium before plating on standard-Iagar.

2.4. Protein techniques

2.4.1. Western blot

Proteins were separated by SDS–PAGE (12.5% or15%) and blotted as published [10].

Immunoblots with monoclonal anti-poly Histidineantibodies(Sigma–Aldrich, Inc.; Prod. No. H1029) werecarried out as described in the protocol, except thatmembranes were blocked in 1· PBS buffer containing1% BSA.

Immunoblots with the following antisera were carriedout as described [10]: anti-P65 serum (#66578, [11]) andanti-Pmp200 serum (#119, [3]).

2.4.2. Immobilized nickel affinity chromatography

Lysates were prepared from 5 · 100 ml M. pneumo-

niae transformants grown at standard growth condi-tions. Chromatography was done as described in themanufacturer�s protocol (Qiagen).

2.4.3. ESI-QTOF MS analysis

ESI-QTOF MS analysis was done by T. Ruppert andA. Bosseroff at the (ZMBH).

Histidine-tagged proteins were purified with nickel-bound sepharose columns. The purified proteins wereseparated by SDS–PAGE (12.5%) and stained with amethanol free Coomassie-blue solution. Protein bandsof interest were excised from the gel and analyzed. In-gel digestion was done as described [12] with minormodifications.

C.-U. Zimmerman, R. Herrmann / FEMS Microbiology Letters 253 (2005) 315–321 317

2.4.4. Edman-degradation

Edman-degradation was carried out by Dr. Heid atthe DKFZ (Deutsches Krebsforschungszentrum Heidel-berg, Germany).

Histidine-tagged proteins were purified with nickel-bound sepharose columns. The purified proteins wereseparated by SDS–PAGE (12.5%), blotted onto nitrocel-lulose membranes and stained with a methanol freeCoomassie-blue solution. Protein bands of interest wereexcised from the blot and analyzed.

3. DNA techniques

3.1. PCR and Sequencing

Polymerase chain reactions were done in an Eppen-dorff Thermocycler (Mastercycler� Gradient) with Plat-inum Pfx DNA Polymerase (Invitrogen) as described inthe manufacturer�s protocol. PCR products were ampli-fied in 35 cycles and afterwards routinely purified withthe High Pure PCR Product Purification Kit (Roche).

3.2. Synthesis of his-tagged mrfp1

The plasmid containing the mrfp1 gene [5] served astemplate for PCR amplification of a his-tagged mrfp1

with the primers P6 and P7. A 7· His tag encodingsequence was added C-terminally. XhoI and BamHIrestriction sites were added to the 5 0- and 3 0-ends,respectively. The ATG start-codon of the fluorescentprotein encoding gene was deleted.

3.3. Construction of pKV pmp200/mrfp1, pKV tuf

P-pmp200mrfp1 and pKV pmp200-0/mrfp1

The ORF pmp200 was amplified by PCR togetherwith its expression unit with the primers P1 and P2 fromthe cosmid pcosMP F11 [13]. As native promoter, aregion of 178 bp upstream of the ORF�s ATG start-

Table 1Primers used in this publication for the synthesis of products presented in the c(�ATG), ATG eliminated

Primer no. Sequence (50–3 0)

P1 GCCGCCGGATCCTACCAGTTCAATTTAAATGCP2 GGCGGCCTCGAGTTTTTGGCAGCATTTGCAACP3 GCCGCCGGATCCGATGACAATGTCAGCAATTAP4 GTGTTTGAATTACGTCTCTAP5 ATGGAAGACAAGAAATGCTP6 GCCGCCCTCGAGGCCTCCTCCGAGGACGTCAP7 GCCGCCCTCGAGCGGGGATCCTTAGTGATGGTGATGGP8 GCCGGATCCTTATTTCATAATAAGP9 GCCGGATCCGTTTTTTTAACTAAAGTP10 GCCGGATCCAGCCATTTGAAATAAGTTP11 CGGAATTCTTAGTGATGGTGATGGTGATG

Letters in bold represent restriction sites.

codon was chosen (Fig. 1). pmp200 was elongated atits 3 0-end by adding in frame a restriction site (CTC-GAG) for the endonuclease XhoI (see Table 1 forprimers).

An alternative construct for the synthesis of a recom-binant Pmp200 protein contained the expression unit ofthe tuf gene (MPN665) in place of its own promoter.This expression unit comprised 210 bp upstream of theATG start-codon of the tuf gene and was PCR amplifiedwith the primers P3 and P4 from the cosmid pcosMPK05. The fragment was ligated blunt to the ATGstart-codon of the ORF pmp200, which was PCR ampli-fied with the primers P5 and P2. This construct wasnamed tufP-pmp200.

An XhoI restriction site(CTCGAG) facilitated an inframe fusion of the 3 0-end of ORF pmp200 with the5 0-end of mrfp1 which was likewise amplified and mod-ified by PCR, replacing its ATG start-codon with anXhoI restriction site. From the ligation mixture, the genefusions were amplified by PCR to gain full length fusionconstructs (pmp200/mrfp1 with P1 and P7 and tufP-pmp200/mrfp1 with P3 and P7). The PCR products wereBamHI digested and ligated into pBC SK+ (Stratagene),yielding pBCpmp200/mrfp1, pBCtufP-pmp200/mrfp1,respectively. Constructs were sequenced and correctfusions were excised with BamHI for ligation intopKV74 [7] yielding pKVpmp200/mrfp1 and pKVtufP-pmp200/mrfp1, respectively.

A promoter less fusion construct was synthesizedwith the primers P5 and P11 by PCR and ligated intothe MCS of pKV74, yielding pKVpmp200-0/mrfp1.

3.4. Construction of pMT pmp200-15/mrfp1, pMT

pmp200-55/mrfp1, pMT pmp200-100/mrfp1, pMT

pmp200-178/mrfp1

Gene fusions were amplified by PCR usingpBCpmp200/mrfp1 as template. The following four con-structs were amplified with the following primers:pmp200-15/mrfp1 with P8 and P11, pmp200-55/mrfp1

olumn denoted ‘‘Construct’’; FW, forward primer; RV, reverse primer;

Construct

FW pmp200-178RV pmp200

FW tufPRV tufPFW pmp200-0FW mrfp1 (�ATG)

TGATGGTGGGCGCCGGTGGAGTGGCG RV mrfp1 7· HisFW pmp200-15FW pmp200-55FW pmp200-100RV 7· His

318 C.-U. Zimmerman, R. Herrmann / FEMS Microbiology Letters 253 (2005) 315–321

with P9 and P11, pmp200-100/mrfp1 with P10 and P11,pmp200-178/mrfp1 with P1 and P11. Each forward pri-mer contained a BamHI restriction site and each reverseprimer an EcoRI restriction site. PCR products weredigested at both ends and ligated into pMT85 (Pirkland Herrmann, unpublished) (Fig. 5).

Fig. 2. Immunoblot of M. pneumoniae transformed with pmp200/

mrfp1 gene fusions. Total protein extract was separated by SDS–PAGE (12.5%) and blotted onto nitrocellulose. Lanes 1 and 4,pKVpmp200/mrfp1; lanes 2 and 5, pKVtufP-pmp200/mrfp1; lane 3, M.

pneumoniae WT. Two antibodies (a-His (1:3000) and a-Pmp200 serum(#119; 1:250)) were used to detect the recombinant proteins. The bandlabeled ‘‘degradation product’’ is a degradation product of mRFP1,beginning with the 68th amino acid of mRFP1. The first six aminoacids of this product were analyzed by Edman-degradation, yieldingthe sequence: GS(X)AYV.

4. Results

4.1. Construction of a fusion protein between Pmp200 and

mRFP1

As a tool for proving that the ORF pmp200 can beexpressed in M. pneumoniae a gene fusion betweenpmp200 and the gene encoding the monomeric fluores-cent protein (mrfp1) was constructed. A DNA fragmentwas amplified by PCR containing the complete ORFpmp200 and a 178 bp long region upstream of its ATGstart-codon and fused to the 5 0-end of the mrfp1 gene,which was modified at its 3 0-end by adding a seven his-tidine encoding DNA sequence (see Section 2 fordetails). The 178 bp upstream region contains the exper-imentally defined 5 0-end of the MP200RNA, located 60nucleotides upstream of the ATG start-codon [14], andextends 56 bp into the 3 0-end of pdhB (Fig. 1A). Thegene fusion was inserted into the transposon Tn4001,which is part of the plasmid pKV74. This new plasmidwas named pKVpmp200/mrfp1 (Fig. 1A). It cannot rep-licate in M. pneumoniae, but the gene fusion will be inte-grated randomly into the genome by transposonmutagenesis.

A second construct was designed for the synthesis ofa recombinant Pmp200-mRFP1 fusion protein, contain-ing the expression unit of the tuf gene (elongation factorTu, MPN665) in the place of the upstream region ofpmp200. We chose the expression unit of tuf, as this genebelongs to the highest expressed in M. pneumoniae onthe levels of both, transcription [15] and translation[6,16]. Thus, this gene fusion served as a positive controlfor fusion protein expression. The expression unit ofMPN665 comprised 210 bp upstream of the ATGstart-codon of the tuf gene, which was fused blunt tothe ATG start-codon of the ORF pmp200. This selectedpromoter region extends 125 bp into the 5 0-end ofMPN666 (hypothetical function). The plasmid contain-ing the gene fusion was named pKVtufP-pmp200/mrfp1

(Fig. 1B).

4.2. Expression of the fusion protein Pmp200-mRFP1 in

M. pneumoniae M129

M. pneumoniae was transformed with pKVpmp200/

mrfp1 and transformants with single transposon inte-grations were cloned and observed by fluorescencemicroscopy. Single cells showed a strong, homogeneous

cellular distribution of the fusion protein Pmp200-mRFP1, based on fluorescence microscopic imaging.Synthesis of the fusion protein was proven by Westernblotting (Fig. 2) with two antisera; one directed againstthe 7· His tag and another one against the syntheticPmp200 peptide. Both antisera recognized a proteinwith a molecular mass of about 35,000 Da. This wasthe expected molecular mass of a fusion protein com-posed of the pmp200 derived peptide, the mRFP1and the 7· His tag. There was a striking difference inthe pattern of bands reacting with the sera. While theanti-polyHis serum reacted only with one band, theanti-peptide serum reacted with many bands, even insamples of untransformed M. pneumoniae cell. Thefusion protein, however, was clearly absent in the sam-ples of M. pneumoniae WT.

To confirm the results of the Western blotting analy-sis, the fusion protein Pmp200-mRFP1 was enrichedfrom a total protein cell extract of M. pneumoniae byimmobilized nickel affinity chromatography and furtherpurified by SDS–PAGE for sequence analysis. A singleband containing the fusion proteins was either excisedfrom a nitrocellulose blot and further analyzed byEdman degradation for determination of the N-termi-nus, or in gel digested with trypsin for electro sprayquadropol time of flight mass spectrometry (ESI-QTOFMS) to prove the identity of the fusion protein. TheEdman degradation yielded the sequence MEDKK(X)(X)G(X)(X)TE (Fig. 3), which is compatible with thepredicted sequence of the N-terminal region ofPmp200. ESI-QTOF MS identified several peptidesfrom mRFP1 and, among others, a peptide beginning

Fig. 3. Amino acid sequence of the fusion protein Pmp200-mRFP1The first row represents the Pmp200 peptide sequence. Pmp200 wasfused with mRFP1 via an XhoI linker, represented by the underlinedletters LE. The sequence contains a 7· His tag at the C-terminus.Letters in bold indicate the sequence which was determined viaEdman-degradation and letters in italics indicate the sequence deter-mined via ESI-QTOF MS analysis. The sequence coverage was 39%.

C.-U. Zimmerman, R. Herrmann / FEMS Microbiology Letters 253 (2005) 315–321 319

with the two amino acids glutamic acid and leucine,which resembles the XhoI linker between Pmp200 andmRFP1 (Fig. 3). These data, together with the positiveresults from Western blotting with anti-polyHis tag spe-cific antiserum, showed that the Pmp200-mRFP1 fusionprotein was indeed synthesized in M. pneumoniae. Theexpression of the fusion protein was independent ofthe direction of integration of the gene fusion into thetransposon, strongly indicating that the transcriptionwas initiated from the promoter in front of pmp200

and not from the proposed promoters which are locatedboth, upstream and downstream of the BamHI sitewithin IS256 of Tn4001 [17]. As a control experiment,the promoter-less gene fusion (pKVpmp200-0/mrfp1)was also integrated into the BamHI site of IS256 andtested in M. pneumoniae for expression. A weak signalwas detected in Western blotting experiments for thisconstruct after overloading the gel (Fig. 4; lane 10),which meant that the Tn4001 promoter could contribute

Fig. 4. Immunoblot of M. pneumoniae transformed with pmp200/

mrfp1 gene fusions with altered expression unit lengths. Total proteinextract (5 lg) was separated by SDS–PAGE (12.5%) and blotted ontonitrocellulose. a-His (1:3000) was used to detect the fusion proteins. Asinternal control, P65 protein was detected with a-P65 serum (#66578;1:300). Lane 1, M. pneumoniae WT; lane 2, pKVpmp200-0/mrfp1; lane3, pKVtufP-pmp200/mrfp1; lane 4, pKVpmp200/mrfp1; lane 5,pMTpmp200/mrfp1 (counterclockwise direction in pMT); lane 6,pMTpmp200-15/mrfp1 (clockwise); lane 7, pMTpmp200-55/mrfp1

(clockwise); lane 8, pMTpmp200-100/mrfp1 (clockwise); lane 9,pMTpmp200-178/mrfp1 (clockwise). 10 lg total protein extract wereblotted in lanes 10 pKVpmp200-0/mrfp1 and 11 pKVpmp200/mrfp1.

to the expression of the inserted fusion, however, themain expression is attributed to the pmp200 promoter.To confirm that the expression of the pmp200/mrfp1

gene fusion was directed by its own expression unitand not by a vector derived promoter, additional con-trol experiments were done: (i) transfer of the genefusion to another transposon devoid of these IS specificpromoters (ii) step-wise deletion of the 5 0-end of the178 bp long expression unit, reducing it to 100, 55 and15 bp (the last two do not contain the proposed pro-moter region) and (iii) Western blotting for the presenceof the Pmp200-mRFP fusion in M. pneumoniae cellstransformed with the individual gene fusions.

Using pBCpmp200/mrfp1 (Fig. 1) as template, thecomplete gene fusion with the 178 bp expression unitwas amplified and modified by replacing the BamHI siteat the 3 0-end with an EcoRI site. This facilitated thedirected cloning of the complete gene fusion module inthe BamHI and EcoRI sites of the plasmid pMT85(Fig. 5). This plasmid functions as a mini-transposonand consists of a modified Tn4001 (Pirkl and Herrmann,unpublished) with an integrated origin of replication.The two IS256 copies were almost completely deletedand only the two repetitive 26 bp long flanking ends ofthe transposon were kept. The multiple cloning site(MCS1, Fig. 5) is part of the lac promoter. Since this

Fig. 5. Cloning strategy of the four pmp200/mrfp1 constructs withaltered length of the pmp200 expression unit (15, 55, 100 and 178 bpunpstream of the start ATG of the ORF). Illustration of the fourconstructs pmp200-15, pmp200-55, pmp200-100 and pmp200-178, andtheir distance to pdhB. The expression unit of the construct pmp200-178 extends into the C-terminal part of pdhB. The constructs wereligated between the BamHI and EcoRI sites of the vector pMT85.Genomic integration sites for pmp200-15/mrfp1, pmp200-55/mrfp1,pmp200-100/mrfp1 and pmp200-178/mrfp1 were 196,429 (intergenic),375,220 (MPN316), 110,579 (intergenic) and 416,566 (MPN349),respectively.

320 C.-U. Zimmerman, R. Herrmann / FEMS Microbiology Letters 253 (2005) 315–321

promoter was deleted by excision with BamHI andEcoRI, a vector derived influence on the expression ofpmp200 was eliminated. By the same procedure asdescribed for the complete gene fusion, we constructedthree different pMT85 variants, which carried the genefusion with shorter expression units (Fig. 5).

M. pneumoniae transformants carrying the differentconstructs were screened for the expression of thePmp200-mRFP fusion in Western blots with anti-poly-His antibodies (Fig. 4). Only thoseM. pneumoniae trans-formants expressed the Pmp200-mRFP fusion proteinand showed a bright fluorescence, which carried eitherthe 178 or 100 bp long upstream region. Gene fusionscontrolled by the 55 or 15 bp upstream region werenot expressed in quantities that could be detected bythe anti-polyHis antiserum, although a very weak fluo-rescence was observed in these transformants by fluores-cence microscopy.

5. Discussion

The results of the experiments described proved thatthe MP200RNA is encoding a 29 amino acids long pep-tide and that this peptide is synthesized in M. pneumo-

niae under the control of its own expression unit,which extends at least 100 nucleotides upstream of theATG start-codon. Expression was proven indirectly byfusing the reporter gene mrfp1 to the 3 0-end ofpmp200 and locating the fusion protein by Westernblotting and fluorescent imaging.

From four pmp200/mrfp1 gene constructs with differ-ent expression units (Fig. 5), only the ones with the 100and 178 bp long expression units contained the pro-posed promoter region and also expressed the fusionprotein. The 100 nucleotide upstream region does notextend into the preceding pdhB gene, contains, however,both the �10 and a possible �35 region of the pmp200expression unit. Since the gene construct pmp200/mrfp1

was also expressed when it was integrated counterclock-wise into the plasmid pMT85, the transcriptionfrom a foreign promoter can also be excluded. The onlytwo expression units provided in pMT85, after insertioninto the genome, the lac promoter and the promoter reg-ulating the gentamicin resistance encoding gene, aretranscribed in clock-wise direction.

The experimental data presented in this publicationare in accord that pmp200 is an independent ORF withinthe pdh gene cluster.

A fluorescent microscopic comparison of the fluores-cence of Pmp200-mRFP1 expressing M. pneumoniae

cells with cells expressing other mrfp1 gene fusions,e.g., thioredoxin-mRFP1 (data not shown), suggest thatpmp200 is not only strongly expressed at transcriptionalbut also at the translational level, being among the high-est expressed ORFs in M. pneumoniae.

Several properties grant Pmp200 and interestingcharacter, e.g., the small size, the amino acid sequence,the rate of expression at the levels of transcription andtranslation, and the ubiquitous cellular distribution.All these properties allude to a major functional roleof Pmp200 for the existence of M. pneumoniae.

The amino acid sequence of Pmp200 contains a totalof nine cysteines, suggesting multiple dimerization,involvement in metal ion binding, redox propertiesand high stability.

So far, Pmp200 is functionally uncharacterized. Itssequence, however, includes motifs found in metallothio-nines (Cys–X–Cys, Cys–X–X–Cys and Cys–Cys) [18]and among a series of short cysteine-rich peptides ofhigher eukaryotes (Cys–(X)m–Cys/Cys–(X)n–Cys) [19]and prokaryotes [20] . Such cysteine-rich proteins andpeptides, some not longer than 30 residues, include avariety of disulfide-bridging toxins and inhibitors whichall contain at least six cysteines [19,21] . Pmp200, how-ever, misses the motif (Cys–(X)1–Cys/Cys–(X)3–Cys),privileged for cysteine-stabilized a-helix (CSH) foldingwhich seems to be common among this peptide class.The metallothionein-1B of the equine kidney cortex con-tains twenty cysteines within its 61 amino acid sequence,many of which are adjacent to serine or lysine [18], con-stellations that we also observe in the Pmp200 sequence.

The presence of cysteines in Pmp200 strongly suggestredox properties of this peptide and its involvement inreducing oxidative stress caused by oxygen radicals. Itsfunction could be similar to the reducing cysteines in thi-oredoxin or in the tripeptide glutathione, meaning adimerization based on the forming of disulfide bridgesin conjunction with the reduction of oxidized cellularcomponents or the decomposition of hydrogen peroxideto oxygen and water. Such properties, however, havenot been tested yet. But the fact that the conservative,preventive enzymes for the reduction of oxidative stress,such as catalase, superoxide dismutase and peroxidasesare missing inM. pneumoniae [1,2] supports the idea thata homogeneous peptide with redox properties, as sug-gested for Pmp200, is present and active within the cell.

Acknowledgements

We thank E. Pirkl for excellent technical assistance,R.Y. Tsien for providing the plasmid encoding mrfp1,T. Ruppert and A. Bosseroff for mass spectrometricanalysis. The research was supported by grants fromthe Deutsche Forschungsgemeinschaft (He780/10-4).

References

[1] Himmelreich, R., Hilbert, H., Plagens, H., Pirkl, E., Li, B.C. andHerrmann, R. (1996) Complete sequence analysis of the genome

C.-U. Zimmerman, R. Herrmann / FEMS Microbiology Letters 253 (2005) 315–321 321

of the bacterium Mycoplasma pneumoniae. Nucleic Acids Res. 24,4420–4449.

[2] Dandekar, T., Huynen, M., Regula, J.T., Ueberle, B., Zimmer-mann, C.U., Andrade, M., Doerks, T., Sanchez-Pulido, L., Snel,B., Suyama, M., Yuan, Y.P., Herrmann, R. and Bork, P. (2000)Re-annotating the Mycoplasma pneumoniae genome sequence:adding value, function and reading frames. Nucleic Acids Res. 28,3278–3288.

[3] Gohlmann, H.W., Weiner III, J., Schon, A. and Herrmann, R.(2000) Identification of a small RNA within the pdh gene clusterof Mycoplasma pneumoniae and Mycoplasma genitalium. J.Bacteriol. 182, 3281–3284.

[4] Meunier-Jamin, C., Kapp, U., Leonard, G.A. and McSweeney, S.(2004) The structure of the organic hydroperoxide resistanceprotein from Deinococcus radiodurans. Do conformationalchanges facilitate recycling of the redox disulfide?. J. Biol. Chem.279, 25830–25837.

[5] Campbell, R.E., Tour, O., Palmer, A.E., Steinbach, P.A., Baird,G.S., Zacharias, D.A. and Tsien, R.Y. (2002) A monomeric redfluorescent protein. Proc. Natl. Acad. Sci. USA 99, 7877–7882.

[6] Regula, J.T., Ueberle, B., Boguth, G., Gorg, A., Schnolzer, M.,Herrmann, R. and Frank, R. (2000) Towards a two-dimensionalproteome map of Mycoplasma pneumoniae. Electrophoresis 21,3765–3780.

[7] Hedreyda, C.T., Lee, K.K. and Krause, D.C. (1993) Transfor-mation of Mycoplasma pneumoniae with Tn4001 by electropor-ation. Plasmid 30, 170–175.

[8] Catrein, I., Herrmann, R., Bosserhoff, A. and Ruppert, T. (2005)Experimental proof for a signal peptidase I like activity inMycoplasma pneumoniae, but absence of a gene encoding aconserved bacterial type I SPase. FEBS J. 272, 2892–2900.

[9] Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) MolecularCloning: A Laboratory Manual, 2nd edn. Cold Spring HarborLaboratory Press, Cold Spring Harbor, NY.

[10] Dumke, R., Catrein, I., Pirkil, E., Herrmann, R. and Jacobs, E.(2003) Subtyping of Mycoplasma pneumoniae isolates based onextended genome sequencing and on expression profiles. Int. J.Med. Microbiol. 292, 513–525.

[11] Proft, T. and Herrmann, R. (1994) Identification and character-ization of hitherto unknown Mycoplasma pneumoniae proteins.Mol. Microbiol. 13, 337–348.

[12] Opitz, C., Di Cristina, M., Reiss, M., Ruppert, T., Crisanti, A.and Soldati, D. (2002) Intramembrane cleavage of micronemeproteins at the surface of the apicomplexan parasite Toxoplasma

gondii. EMBO J. 21, 1577–1585.[13] Wenzel, R. and Herrmann, R. (1989) Cloning of the complete

Mycoplasma pneumoniae genome. Nucleic Acids Res. 17, 7029–7043.

[14] Weiner III, J., Herrmann, R. and Browning, G.F. (2000)Transcription in Mycoplasma pneumoniae. Nucleic Acids Res.28, 4488–4496.

[15] Weiner III, J., Zimmerman, C.U., Gohlmann, H.W. and Herr-mann, R. (2003). Nucleic Acids Res. 31, 6306–6320.

[16] Regula, J.T., Boguth, G., Gorg, A., Hegermann, J., Mayer, F.,Frank, R. and Herrmann, R. (2001) Defining the mycoplasma�cytoskeleton�: the protein composition of the Triton X-100insoluble fraction of the bacterium Mycoplasma pneumoniae

determined by 2-D gel electrophoresis and mass spectrometry.Microbiology 147, 1045–1057.

[17] Byrne, M., Rouch, D.A. and Skurray, R.A. (1989) Nucleotidesequence analysis of IS256 from the Staphylococcus aureus

gentamicin–tobramycon–kanamycin-resistance transposonTn4001. Gene 81, 361–367.

[18] Kojima, Y., Berger, C., Vallee, B.L. and Kagi, J.H. (1976) Amino-acid sequence of equine renal metallothionein-1B. Proc. Natl.Acad. Sci. USA 73, 3413–3417.

[19] Tamaoki, H., Miura, R., Kusunoki, M., Kyogoku, Y., Kobayashi,Y. and Moroder, L. (1998) Folding motifs induced and stabilizedby distinct cystine frameworks. Protein Eng. 11, 649–659.

[20] Gariepy, J., Judd, A.K. and Schoolnik, G.K. (1987) Importanceof disulfide bridges in the structure and activity of Escherichia coli

enterotoxin ST1b. Proc. Natl. Acad. Sci. USA 84, 8907–8911.[21] Heitz, A., Le-Nguyen, D. and Chiche, L. (1999) Min-21 and min-

23, the smallest peptides that fold like a cystine-stabilized beta-sheet motif: design, solution structure, and thermal stability.Biochemistry 38, 10615–10625.