Supplementary Material Inverse regulatory coordination of ...genesdev.cshlp.org/content/suppl/2008/08/14/22.17.2434.DC1/Pesavento... · Supplementary Material Inverse regulatory coordination

Supplementary Material

Inverse regulatory coordination of motility and adhesion in

Escherichia coli

Christina Pesavento, Gisela Becker, Nicole Sommerfeldt, Alexandra Possling, Natalia

Tschowri, Anika Mehlis and Regine Hengge

Supplementary material and methods

Bacterial strains and growth conditions

All strains used in this study are derivatives of the E.coli K-12 strains W3110 (Hayashi et al.

2006) or MC4100 (Casadaban 1976). While curli production is similar in the two strains, only

W3110 is motile, but MC4100 is non-motile as it carries an insertion of a T between

nucleotide 123 and 124 in flhD (an allele previously termed flbB5301; Fig. S1). Mutations

were introduced by P1 transduction (Miller 1972). All strains used in this study also carry a

Δlac deletion. The following mutations were described previously: rpoS359::Tn10 (Lange

and Hengge-Aronis 1991); ydaM::cat, yciR::kan, yedQ::cat, mlrA::kan, csgD::cat (Weber et

al. 2006); fliA::cat (Barembruch and Hengge 2007); crl::cat (Typas et al. 2007); and

clpP1::cat (Maurizi et al. 1990). The newly constructed mutant alleles yegE::kan, yeaJ:kan,

yhjH::cat, ycgR::kan, flhDC::kan, fliZ::kan and rsd::cat are all deletion-insertion mutations

generated by one-step inactivation according to (Datsenko and Wanner 2000) using the

primers listed in Table S2. Non-polar in-frame-deletion mutations were obtained by flipping

out the insertion cassettes as described (Datsenko and Wanner 2000).

Cells were grown at 28°C under aeration if not otherwise indicated (as this is the

appropriate temperature for curli expression). The medium used was Luria–Bertani broth

(LB) (Miller 1972). Antibiotics were added as recommended (Miller 1972). For induction of

proteins from the tac promoter, 10 µM IPTG was added. Growth was monitored by

measuring the optical density at 578 nm (OD578).

Construction of plasmids and chromosomal lacZ fusions

The primers used for plasmid constructions are listed in Table S2 (see below). pFlhDC, pFliZ

and pYhjH are derivatives of pCAB18 (Barembruch and Hengge 2007), which is a tac

Pesavento et al. (Supplement) 2

promoter expression plasmid based on the low copy number vector pACYC184 (Chang and

Cohen 1978). pFlhDC is identical to the previously described pCAB19 (Barembruch and

Hengge 2007). The low copy number plasmid carrying yhjH under its native promoter control

is a pACYC184 derivative. For in-vitro determination of PDE activity, C-terminally His6-

tagged YhjH was expressed from pQE60 (Qiagen). Point-mutated variants of YhjH were

obtained using a four-primer/two-step PCR protocol (Germer et al. 2001). The plasmid for the

ectopic expression of csgD under pBAD promoter control is a derivative of pBAD18 previously

described (Weber et al. 2006).

All primers used to construct lacZ fusions are listed in Table S2. In order to construct

single copy lacZ reporter fusions to yegE, yhjH, flhDC, mlrA and gadB, the appropriate PCR

fragments (depending on the chromosomal context of the specific genes) were cloned into the

lacZ fusion vector pJL28 as previously described (Weber et al. 2006). flhDC::lacZ is inserted

in flhC and includes the entire operon control region as well as the complete flhD gene. The

fliA::lacZ and fliAZ::lacZ reporter fusions were constructed with the fusion vector pCAB6

(Barembruch and Hengge 2007). fliA::lacZ includes the fliA class 2 and 3 promoters,

fliAZ::lacZ contains the same upstream regulatory region as present in fliA::lacZ as well as

the entire fliA gene. All reporter fusions were transferred to the att(λ) location of the

chromosome via phage λRS45 or λRS74 (Simons et al. 1987). Single lysogeny was tested by

a PCR approach (Powell et al. 1994). The following lacZ fusions were described earlier:

ydaM::lacZ and yciR::lacZ (Weber et al. 2006); flgA::lacZ and flgM::lacZ (Barembruch and

Hengge 2007); osmY::lacZ (Lange and Hengge-Aronis 1991); synp9::lacZ (Typas et al.

2007).

References

Barembruch, C. and R. Hengge. 2007. Cellular levels and activity of the flagellar sigma factorFliA of Escherichia coli are controlled by FlgM-modulated proteolysis. Mol.Microbiol. 65: 76-89.

Casadaban, M.J. 1976. Transposition and fusion of the lac genes to selected promoters inEscherichia coli using bacteriophage lambda and Mu. J. Mol. Biol. 104: 541-555.

Chang, A.C.Y. and S.N. Cohen. 1978. Construction and characterization of amplifiablemulticopy DNA cloning vehicles derived from the P15A cryptic miniplasmid. J.Bacteriol. 134: 1141-1156.

Datsenko, K.A. and B.L. Wanner. 2000. One-step inactivation of chromosomal genes inEscherichia coli K-12 using PCR products. Proc. Nat. Acad. Sci. USA 97: 6640-6645.

Germer, J., G. Becker, M. Metzner, and R. Hengge-Aronis. 2001. Role of activator siteposition and a distal UP-element half-site for sigma factor selectivity at a CRP/H-NSactivated σS-dependent promoter in Escherichia coli. Mol. Microbiol. 41: 705-716.


Hayashi, K., N. Morooka, Y. Yamamoto, K. Fujita, K. Isono, S. Choi, E. Ohtsubo, T. Baba,B.L. Wanner, H. Mori, and T. Horiuchi. 2006. Highly accurate genome sequences ofEscherichia coli K-12 strains MG1655 and W3110. Mol. Syst. Biol. 2: 2006.0007.

Lange, R. and R. Hengge-Aronis. 1991. Identification of a central regulator of stationary-phase gene expression in Escherichia coli. Mol. Microbiol. 5: 49-59.

Maurizi, M.R., W.P. Clark, Y. Katayama, S. Rudikoff, J. Pumphrey, B. Bowers, and S.Gottesman. 1990. Sequence and structure of ClpP, the proteolytic component of theATP-dependent Clp protease in Escherichia coli. J. Biol. Chem. 265: 12536-12545.

Miller, J.H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, ColdSpring Harbor, N. Y.

Powell, B.S., D.L. Court, Y. Nakamura, M.P. Rivas, and C.L. Turnbough Jr. 1994. Rapidconfirmation of single copy lambda prophage integration by PCR. Nucl. Acids Res.22: 5765-5766.

Simons, R.W., F. Houman, and N. Kleckner. 1987. Improved single and multicopy lac-basedcloning vectors for protein and operon fusions. Gene 53: 85-96.

Typas, A., C. Barembruch, and R. Hengge. 2007. Stationary phase reorganisation of the E.colitranscription machinery by Crl protein, a fine-tuner of σS activity and levels. EMBO J.26: 1569-1578.

Weber, H., C. Pesavento, A. Possling, G. Tischendorf, and R. Hengge. 2006. Cyclic-di-GMP-mediated signaling within the σS network of Escherichia coli. Mol. Microbiol. 62:1014-1034.


Supplementary tables

Table S1. FliZ-controlled genes.

Genome-wide transcriptional profiling on microarrays was performed for strain MC4100carrying pFliZ (a low copy number plasmid carrying fliZ under tac promoter control) incomparison to MC4100 carrying the vector pCAB18 only. Strains were grown in LB at 28oCwithout the inducer IPTG, as even low level expression of FliZ is effective in shifting geneexpression patterns. Cells were harvested at an OD578 of 4.0. Genes affected are listed inalphabetical order, with their b-numbers and a short description of molecular or physiologicalfunctions added. Column A: Ratios of expression in the pFliZ versus pCAB18-carryingstrains for genes that are positively regulated by FliZ (only genes with ratios > 3 are listed);column B: similar as in column A, but for genes that are negatively regulated by FliZ (onlygenes with ratios < 0.33 are listed); column C: genes are indicated (“x”) that have beenshown previously to be σS-dependent (Weber, H., T. Polen, J. Heuveling, V. Wendisch, andR. Hengge. 2005. J. Bacteriol. 187: 1591-1603), genes with σS-dependence apparent only at28oC are indicated as “28” (H. Weber and R.H., unpublished data); column D: genes arelabeled whose expression was previously observed to be modulated by Crl (Typas, A., C.Barembruch, and R. Hengge. 2007. EMBO J. 26: 1569-1578).

Experimental details: Cell lysis, RNA isolation (Tani, T.H., A. Khodursky, R.M.Blumenthal, P.O. Brown, and R.G. Matthews. 2002. Proc. Natl. Acad. Sci. USA 99: 13471-13476.), DNaseI treatment and phenol/chloroform extraction were previously described(Weber, H., T. Polen, J. Heuveling, V. Wendisch, and R. Hengge. 2005. J. Bacteriol. 187:1591-1603). Escherichia coli K-12 microarray array slides (produced by H. Mollenkopf andcoworkers at the Max-Planck-Institut für Infektionsbiologie, Berlin, Germany) carrying 4288gene-specific 50mer oligonucleotide probes representing all open reading frames in the E.coligenome (synthesized by MWG, Ebersberg, Germany) were used. The cDNA was labelledwith Cy3/Cy5-dCTP, purified with the illustraTM CyScribeTM GFXTM Purification Kit (GEHealthcare, Germany) and hybridized to the microarray with SlideHyb #1 buffer (AmbionInc.). The washing procedure, fluorescence detection and image analysis was carried out asdescribed before (Weber, H., T. Polen, J. Heuveling, V. Wendisch, and R. Hengge. 2005. J.Bacteriol. 187: 1591-1603) using a GenePix 4100A (Axon, Inc.) laser scanner. Microarrayexperiments were repeated at least two times (biological replicates). Genes were considereddifferentially regulated when (i) signal-to-noise ratios exceeded a factor of three, (ii) the sumof median intensity counts was above 300 and (iii) relative RNA level differences (ratios)were at least threefold in both of two independent experiments (done with a dye-swap).

Name ID Description A B C D

acrB b0462 acridine efflux pump 6,132 allA b0505 ureidoglycolate amidohydrolase; allantoin assimilation 5,069

allB b0512 allantoinase; allantooin assimilation 10,663arpB2 b1721 orf, hypothetical protein 13,419 chaB b1217 cation transport regulator 10,266 x

csgA b1042 curlin major subunit 0,052 x x csgB b1041 curli nucleator 0,029 x x csgD b1040 curli transcriptional activator 0,111 x


csgE b1039 curli production assembly/transport component 0,146 x

csgF b1038 curli production assembly/transport component 0,166 x csgG b1037 curli production assembly/transport component 0,116 x dsbC b2893 protein disulfide isomerase II 0,091

fliZ b1921 fliZ 46,552 gadB b1493 glutamate decarboxylase isozyme 0,103 x xgadC b1492 acid sensitivity protein, putative transporter; xa 0,243 x x

gadE b3512 transcriptional activator 0,091 x x gatA b2094 galactitol-specific enzyme IIA of phosphotransferase 0,122

gatB b2093 galactitol-specific enzyme IIB of phosphotransferase 0,161 gatZ b2095 subunit of tagatose-1,6-bisphosphate aldolase 2 0,196 gcl b0507 glyoxylate carboligase 12,870

glpF b3927 glycerol MIP channel, facilitated diffusion of glycerol 3,675glxR b0509 putative oxidoreductase 11,008 glyS b3559 glycine tRNA synthetase, beta subunit 0,278

gyrA b2231 DNA gyrase, subunit A, type II topoisomerase 0,239 hdeA b3510 acid resistence protein, chaperone 0,014 x x

hdeB b3509 acid stress chaperone 0,040 x x hsdM b4349 host modification; DNA methylase M 4,143hyi b0508 glyoxylate-induced protein; gip 11,130

lamB b4036 phage lambda rec. pr.; maltose high-affinity recepeptor 6,115 lrp b0889 transcriptional dual regulator 0,162 malE b4034 periplasmic maltose-binding protein 4,171

malK b4035 ATP-binding component of transport system for maltose 8,250 malM b4037 periplasmic protein of mal regulon 4,314

modE b0761 molybdate uptake regulatory protein 3,732mokB b1420 regulatory peptide, translation enables hokB expression 5,239 narG b1224 nitrate reductase 1, alpha subunit 7,493

ompC b2215 outer membrane protein 1b (Ib;c) 0,111 28 oppA b1243 oligopeptide transport; periplasmic binding protein 0,180 priC b0467 primosomal replication protein N''; priC 3,934

putA b1014 proline dehydrogenase, P5C dehydrogenase 6,551puuA b1297 _-glutamylputrescine synthetase 0,222

rzpQ b1573 Qin prophage; predicted protein 3,789 tdcC b3116 TdcC threonine STP transporter 0,041 28 x treB b4240 PTS system enzyme II, trehalose specific 10,608

ybbW b0511 NCS1 Transporter 19,557ycfZ b1121 homolog of virulence factor 14,587 ydfA b1571 Qin prophage; predicted protein 27,483

ydfB b1572 Qin prophage; predicted protein 14,183 ydiT b1700 putative ferredoxin 0,219

yhjR b3535 conserved protein 0,269 28 x yiaM b3577 predicted transporter 0,168 yjbJ b4045 predicted stress response protein 0,103 x x

ymfE b1138 orf, hypothetical protein 0,116 xymgG b1172 predicted protein 4,675 ynhG b1678 conserved protein 3,626 x

yoaI b1788 predicted protein 9,572


Table S2. Oligonucleotide primers used in the present study.

I. Primers used for generating knockout mutations:

Mutation Sequences of primers used for one-step inactivationflhDC::kan 5´-CCGGGGCTTCCCGGCGACATCACGGGGTGCGGTGAA

ACGTGTAGGCTGGAGCTGCTTC-3´5´-GCTGAATATCCCGCGCTTCCTGAACAATGCTTTTTTCACATTCCGGGGATCCGTCGACC-3´

fliZ::kan 5´-TAAATGCCGCACTTTAACTTTGACTACCAGGAGTTCTTAATGATGGTGCAGTGTAGGCTGGAGCTGCTTC-3´5´-CCATTGTTTGTAAACACAAAAACAACTCCGCTACATCTTATTCTTATTTACATATGAATATCCTCCTTAG-3´

rsd::cat 5´-CCCCGCAAATGGGGCATTGAATGTAAATTACGCGTTAACAGCGCAGAACGTGTAGGCTGGAGCTGCTTC-3´5´-GTTTTTACATTTCTCACTGAGCAGTTTTTGAATACAAACTTGCGGAGTCAATCATATGAATATCCTCCTTAG-3´

ycgR::kan 5´-AACTGTGACCGATAAACCAAAGACAGTTTGTCAGTCAGGAGTTTTTCCGCGTGTAGGCTGGAGCTGCTTC-3´5´-GGCTCCGCGCTATATCTACAAACTTGAGCAGGCACTGGACGCGATGTAAACATATGAATATCCTCCTTAG-3´

yeaJ::kan 5´-GGGGGCAACAAAGTGATTATTCATCATATTTAAGTGGTGTAGGCTGGAGCTGCTTC-3´5´-CACGCTCCTGAGATTACAAGCAAACAACCACAGAAGGCATATGAATATCCTCCTTAG-3´

yegE::kan 5´-ACGAATACTGGCGACCAGGTCTTGCGGATAAAGCGGTAGTGTAGGCTGGAGCTGCTTC-3´5´-GCGTTAGCGTCGCATCAGGCGATGGGGAAGCACGCCCATATGAATATCCTCCTTAG-3´

yhjH::cat 5´-AATCTTTGTCGAGTCCGGGCAGCATCACTTTTAAACACAGGACATCTTTGGTGTAGGCTGGAGCTGCTTC-3´5´-TTCCTGTGCCAGTCCTAAAGATAGTCCAGCCAGGCGGAAAATGAGGCAGCCATATGAATATCCTCCTTAG-3´

II. Primers used for generating gene fusions:

PgadB-EcoRI 5´-GTGAGAATTCAGGAGACACAGAATGC-3PgadB-SalI 5´-GATAATCTGAAAGTCGACATCATCGC-3PmlrA-BamHI 5´-CGCGGATCCTAAAACGCGTAACATACATTGCCTGC-3´PmlrA-HindIII 5´-ATCTATAAGCTTTCAGCAATCCGTAACGCCTCTGCCAC-3´PyegE-BamHI 5´-GCGGATCCCCAGCGATACCGATAATGACG-3´PyegE-HindIII 5´- GCTCAGAAGCTTCATGCTGTGATTGTTTGCTC -3´PyhjH-EcoRI 5´- CGGAATTCGGAAAGCTCAATCATGCATTCG-3´PyhjH-HindIII 5´- CCCAAGCTTCGATGCTTGCTTCAGGGTTGC-3´PflhDC’-BamHI 5´-CCCATTTGGATCCTTCCTGTTTCATTTTTGC-3´PflhDC’-HindIII 5´-TTCCAAAGCTTGCTGAATATCCCGCGC-3´PfliA5-BamHI 5´- GTTGGATCCCAATTTATTGAATTTGCAC-3´PfliA4-HindIII 5´- GTCAAGCTTCACGCTCGCGGGCAGTC-3´PfliAZ-HindIII 5´-CAGCAAGCTTCGGCAATGCGCGCAATGGGTCTG -3´


III. Primers for cloning fliZ into pCAB18:

IV. a) Primers for cloning and mutagenizing yhjH into pACYC184:

PyhjH-u-(-299)/EagI 5´-TTAACGGCCGCGCCTTTCTCGGAAAGCTC-3´PyhjH-d-978/HindIII 5´-GCAGAAGCTTTCTGGTTGATAGTCGGTTTGAGTC-3´PyhjH-d-492/KpnI 5´-CATCCCGGTACCAAAATCATCC-3´PyhjH-u-471/KpnI 5´-GGATGATTTTGGTACCGGGATG-3´PyhjH-u-Cend(A254D/L255D) 5´-GTTCTGGATGATTAAGCTGCCTCATTTTC-3´PyhjH-d-Cend(A254D/L255D) 5´-GAGGCAGCTTAATCATCCAGAACCGCCG-3

b) Primers for cloning yhjH into pCAB18:

c) Primers for cloning yhjH into pQE60:

PyhjH-NcoI 5´-CGGCCATGGTAAGGCAGGTTATCCAGCG -3PyhjH-BglII 5´-GAAGATCTTAGCGCCAGAACCGCCG -3PyhjH-f-E48A 5´-GGCCGTGGCGCTATTAACGG -3PyhjH-r-E48A 5´-CCGTTAATAGCGCCACGGCC -3

PfliZ-EcoRI 5´-GCGAATTCGCCGCACTTTAACTTTGACTACCAGGAG-3´PfliZ-HindIII ´5´-TGCGAAGCTTCGCCCATGTCGTTATCGCAGAATAAAAGCG-3´

PyhjH-EcoRI 5´- CGGAATTCAAGGAGGACTGAGATGATAAGGCAGG -3´PyhjH-HindIII ´5´-GCAGAAGCTTTCTGGTTGATAGTCGGTTTGAGTC -3´


Supplementary figures

Figure S1. Comparison of the E.coli K-12 strains MC4100 and W3110 with respect tomotility and expression of csgB::lacZ in different mutant backgrounds with altered curliexpression. A: motility plates incubated at 28oC; B, C: OD578 (open symbols) and specific β-galactosidase activities (closed symbols) were determined along the growth curve. Symbolsfor mutant backgrounds and colour code used are indicated in the boxes above the graphs.

A

B

C

MC4100

W3110


Figure S2. Identification of FliZ as an inhibitor of curli expression. Derivatives of strainMC4100 carrying a single copy csgB::lacZ reporter fusion (reflecting stationary phaseinduction of curli genes), low copy number plasmids expressing the flagellar master regulatorFlhDC or the corresponding vector (pCAB18) alone as well as insertion mutations in fliA (B)or fliZ (C) were grown in LB in the presence or absence of the inducer IPTG. OD578 (opensymbols) and specific β-galactosidase activities (closed symbols) were determined along thegrowth curve. Symbols used are: A: circles: pCAB18/-IPTG, squares: pCAB18/+IPTG,diamonds: pFlhDC/-IPTG; triangles: pFlhDC/+IPTG; B: squares: pFlhDC/fliA+, triangles:pFlhDC/fliA::cat, circles: pCAB18/fliA+, diamonds: pCAB18/ fliA::cat; all cultures shown inB contained IPTG; C: squares: pFlhDC/fliZ+, triangles: pFlhDC/ΔfliZ, circles: pCAB18/fliZ+,diamonds: pCAB18/ΔfliZ; all cultures shown in C contained IPTG.

A

B

C


Figure S3. Mutations that affect sigma factor competion for core RNA polymerase andtherefore the formation of EσS during entry into stationary phase, also alter the timing ofexpression of mlrA. A non-polar deletion of fliA (fliZ is expressed), i.e. the removal of theflagellar sigma factor which competes with σS, leads to mlrA expression about 30 min earlier;on the other hand, mutations that result in a disadvantage of σS in sigma factor competition,i.e. in rsd (encoding an anti-sigma factor sequestering a fraction of the vegetative σ70) and incrl (encoding a factor that stimulates σS-containing RNAP holoenzyme formation) result indelays in mlrA expression. For comparison, earlier expression of mlrA in the fliZ mutant isalso included. Cultures were grown in LB and OD578 (open symbols) and specific β-galactosidase activities (closed symbols) were determined along the growth curve.


Figure S4. Suppression of the non-motility phenotype of the yhjH mutant derivative of strainW3110 by the presence of additional mutations in ycgR or GGDEF genes (yedQ, yegE, yeaJ)in various combinations. Cells were incubated on motility plates at 37oC.

Figure S5. Mutations in rpoS, csgD, mlrA, ydaM and yciR, which affect curli expression (seeFig. S1) do not affect motility of strain W3110.


C

Figure S6. YhjH protein is not a ClpXP substrate and remains stable during entry intostationary phase.A, B: Cellular levels of YhjH were monitored by immunoblot analysis along the growth curve(A), as well as after treatment with spectinomycin in order to eliminate de-novo proteinbiosynthesis (B). As YhjH expressed from its chromosomal gene is below reliabledetectablility in immunoblot analysis, strain W3110 carrying yhjH under its own promotercontrol on the low-copy number vector pACYC184 was used (lane 1 in A and B, pACYC184vector only; lanes 2ff., pACYC184-yhjH). A: Cells were grown in LB and samples forimmunoblot analysis were taken at an OD578 of 0.35 (lane 2), 1.1 (lane 3), 1.8 (lane 4), 2.2(lane 5), 2.6 (lane 6), 3.1 (lane 7), 3.5 (lane 8), 3.9 (lane 9). Note that the expression of yhjHstops at an OD578 of approximately 2.5 (see Fig. 4; denoted by a vertical arrow in A), and thatYhjH levels are then slowly reduced, consistent with dilution by further cell division. B: Forspectinomycin treatment, the antibiotic (1.5 mg ml-1) was added at an OD578 of 4.0, andsamples for immunoblotting were taken at the times indicated. 60 µg cellular protein wasapplied per lane. A polyclonal serum against YhjH (Pineda-Antikörper-Service, Berlin) wasused, and visualization of bands was as described in Materials and Methods.C: With low-level ectopic expression of yhjH (under ptac control from the low copy numberplasmid pYhjH; no inducer added), the clpP mutation results in increased csgB::lacZexpression. When expressed in a W3110 derivative carring flhDC::kan and csgB::lacZ,pYhjH partially reduced csgB expression, but the additional introduction of clpP::catincreased instead of further reduced csgB expression as it would have been expected if YhjHwere a Clp substrate. Rather, a factor that specifically counteracts YhjH, i.e. a DGC that canaffect curli expression, may be a Clp substrate (note that YdaM, i.e. the DGC essential forcurli expression, has been observed to be associated with ClpXP; Flynn et al. 2003. Mol. Cell11: 671-683).

B

Spectinomycin - - - + + + + +

time (min) 0 10 20 30 40 50

1 2 3 4 5 6 7 8

YhjH

A 1 2 3 4 5 6 7 8 9

Stop of YhjH expression

YhjH

0,01

0,1

1

10

0

0,5

1

1,5

2

0 5 10 15 20 25

LB 28°C

pCAB18

pCAB18-yhjH

clpP::cat, pCAB18

clpP::cat, pCAB18-yhjH

OD

(57

8nm

)spec. ß

-gal.-act. (µmol/m

in/mg)

time (h)


Figure S7. The mutations in the GGDEF/EAL genes yegE and yhjH, which affect CsgD andtherefore curli expression (see Fig. 6), do not alter the expression of the curli control genesmlrA, ydaM and yciR, assayed as the respective single-copy lacZ fusions as indicated in thefigure. OD578 (open symbols) and specific β-galactosidase activities (closed symbols) weredetermined along the growth curve. Symbols and colour code for mutant backgrounds areindicated in the boxes above the graphs.

A

B

C


Figure S8. When csgD mRNA is expression ectopically from the arabinose-inducible pBAD

promoter, mutations in the GGDEF/EAL genes yegE and yhjH do not affect CsgD levels andcurli expression. A: csgB::lacZ expression was determined in the csgD mutant derivative ofW3110 carrying the intact csgD gene on pBAD18 either in the presence or absence ofarabinose. OD578 (open symbols) and specific β-galactosidase activities (closed symbols) weredetermined along the growth curve. Symbols and colour code for mutant backgrounds andconditions used are indicated in the boxes above the graphs. Arrows indicate the addition of0.05 % arabinose (at an OD578 of 1.2) B: In parallel to the determination of β-galactosidaseactivities, samples were taken from the same cultures and CsgD levels were determined byimmunoblot analysis at the times after arabinose addition as indicated.

A

B

Supplementary Material Inverse regulatory coordination of ...genesdev.cshlp.org/content/suppl/2008/08/14/22.17.2434.DC1/Pesavento... · Supplementary Material Inverse regulatory coordination

Documents