Top Banner
SUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1 Supplementary Table 1. Clinical characteristics of type 2 diabetic and normoglycemic patients. In the type 2 diabetic group, skin was obtained from leg amputates. Amputations were necessary because of severe vascular side effects of the diabetic condition. All patients had peripheral arterial occlusive disease (PAOD) and were treated because of hypertension. In the non-diabetic group, skin was taken from leg amputates (2 samples) and from abdominoplasty (2 samples). Only one of the patients had PAOD and was hypertensive. (*glycated haemoglobin in percent (% NGSP) and † in (mmol/mol) of total haemoglobin, ‡ body mass index, § peripheral arterial occlusive disease) Type 2 diabetic patients Patient sample dLEC #1 dLEC #2 dLEC #3 dLEC #4 Age 87 77 56 76 Sex male female male male Duration of disease > 6 years > 6 years > 6 years > 6 years HbA1c (% NGSP)* 11.4 8.7 12.4 8.7 HbA1c (mmol/mol) 101 72 112 72 BMI 30.8 16.4 26.2 32 PAOD § yes yes yes yes Microangiopathy yes no yes yes Hypertension yes yes yes yes Blood pressure (mmHg) 130/65 120/65 120/70 130/80 Anti-hypertensive therapy (number of antihypertensives) yes (1) yes (2) yes (2) yes (1) Anti-diabetic therapy yes (Insulin, diet) yes (Insulin, diet) yes (Insulin, diet) yes (Insulin, diet) Indication for surgery Ulcus cruris Ulcus cruris Ulcus cruris Bypass stenosis Non-diabetic patients Patient sample ndLEC #1 ndLEC #2 ndLEC #3 ndLEC #4 Age 35 26 31 84 Sex female male male male BMI† 25 30.4 26 24.7 PAOD‡ no no no yes Microangiopathy no no no no Hypertension no no no yes Anti-hypertensive therapy no no no yes (3) Indication for surgery Cutis laxa abdominis Cutis laxa abdominis Trauma (right leg) Ulcus cruris
13

SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http...

Aug 06, 2019

Download

Documents

phungkiet
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Table 1. Clinical characteristics of type 2 diabetic and normoglycemic patients. In the type 2 diabetic group, skin was obtained from leg amputates. Amputations were necessary because of severe vascular side effects of the diabetic condition. All patients had peripheral arterial occlusive disease (PAOD) and were treated because of hypertension. In the non-diabetic group, skin was taken from leg amputates (2 samples) and from abdominoplasty (2 samples). Only one of the patients had PAOD and was hypertensive. (*glycated haemoglobin in percent (% NGSP) and † in (mmol/mol) of total haemoglobin, ‡ body mass index, § peripheral arterial occlusive disease) Type 2 diabetic patients

Patient sample dLEC #1 dLEC #2 dLEC #3 dLEC #4 Age 87 77 56 76 Sex male female male male Duration of disease > 6 years > 6 years > 6 years > 6 years HbA1c (% NGSP)* 11.4 8.7 12.4 8.7 HbA1c (mmol/mol)† 101 72 112 72 BMI‡ 30.8 16.4 26.2 32 PAOD§ yes yes yes yes Microangiopathy yes no yes yes Hypertension yes yes yes yes Blood pressure (mmHg) 130/65 120/65 120/70 130/80 Anti-hypertensive therapy (number of antihypertensives)

yes (1) yes (2) yes (2) yes (1)

Anti-diabetic therapy yes (Insulin, diet) yes (Insulin, diet) yes (Insulin, diet) yes (Insulin, diet)

Indication for surgery Ulcus cruris Ulcus cruris Ulcus cruris Bypass stenosis

Non-diabetic patients

Patient sample ndLEC #1 ndLEC #2 ndLEC #3 ndLEC #4 Age 35 26 31 84 Sex female male male male BMI† 25 30.4 26 24.7 PAOD‡ no no no yes Microangiopathy no no no no Hypertension no no no yes Anti-hypertensive therapy no no no yes (3)

Indication for surgery Cutis laxa abdominis

Cutis laxa abdominis

Trauma (right leg) Ulcus cruris

Page 2: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplemental Table 2. Primary and secondary antibodies used for *FACS: Fluorescence-activated cell sorting; †MB: magnetic bead sorting; ‡IF: Immunofluorescence; §IHC: Immunohistochemistry; ||WB: Western blotting; ¶CC: Cell culture experiments; and #ELISA.

Description Application Cat. number Company / Source Dilution RPE-Cy5.1-conjugated mouse monoclonal anti-CD45

*FACS PM IM2653 Beckman Coulter 1:100

FITC-conjugated mouse anti-CD31

FACS 555445 Becton Dickinson Pharmingen

1:10

Mouse anti-CD31 (clone JC70A)

†MB, ‡IF M0823 DAKO Cytomation 1:50 for MB+IF 1:500 for WB

Rabbit polyclonal anti-podoplanin antiserum, IgG fraction

FACS, MB, IF, §IHC, ||WB

In house developed 1:150 for FACS 1:500 for MB+IF 1:1000 for IHC 1:3000 for WB

Mouse anti-Ki67 IHC M7240 DAKO Cytomation 1:50 Mouse anti-DARC (clone 2C3)

IF Kindly provided by Dr. I. Colin, INSERM, Paris

1:50

Mouse monoclonal anti-laminin alpha-chain

IF M0638 DAKO Cytomation 1:50

Rabbit anti-collagen IV IHC 20411 Novotec 1:200 Mouse anti-CD68 IF M0876 DAKO Cytomation 1:50 Goat anti-VEGFC IF AF752 R&D 1:40 Rabbit anti-TNF-α IF, ¶CC ab6671 Abcam 1:250 for IF

1:40 for CC ChromPure Rabbit IgG IF 011-000-003 Jackson

ImmunoResearch 1:250

Mouse anti-VCAM-1 IF 1244 Immunotech 1:100 Rabbit anti-CXADR IF sc-15405 Santa Cruz (kindly

provided by Dr. B. Vigl, ETH Zurich)

1:50

Goat anti-FABP4 IF AF3150 R&D 1:100 Goat anti-CXCL10 IF, CC,

#ELISA AF-266-NA R&D 1:50 for IF+CC

1:200 for ELISA Rabbit anti-AQP3 IF ab15117 Abcam 1:50 Rabbit anti-CYR61 IF ab24448 Abcam 1:50

Description Application Cat. number Company Dilution R-Phycoerythrin donkey anti-rabbit IgG

FACS 711-116-152 Jackson ImmunoResearch

1:200

Alexa Fluor 546 goat anti-mouse IF A11018 Molecular Probes 1:1000 Alexa Fluor 488 goat anti rabbit IF A11034 Molecular Probes 1:1000 Alexa Fluor 546 goat-anti rabbit IF A11010 Molecular Probes 1:1000 Alexa Fluor 488 goat anti-mouse IF A11017 Molecular Probes 1:1000 Alexa Fluor 488 donkey anti-mouse IF A21202 Molecular Probes 1:1000 Alexa Fluor 594 donkey anti-goat IF A11058 Molecular Probes 1:1000 HRP-conjugated rabbit anti-mouse IF, IHC,

WB JZM035046 Axell 1:500 for IF+IHC

1:3500 for WB HRP-conjugated goat anti rabbit IF, IHC,

WB SGZ034047 Axell 1:500 for IF+IHC

1:3500 for WB HRP-conjugated donkey anti-goat WB, ELISA 705-036-147 Jackson

ImmunoResearch 1:3500 for WB 1:5000 for ELISA

Page 3: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Table 3. Percentage of nuclei positive for proliferation marker Ki67 per total number of nuclei in podoplanin+ lymphatic vessels.

Patient sample Ki67+ nuclei per # of nuclei counted in lymphatic vessels

dLEC #1 3 / 102 (2.9 %) dLEC #2 2 / 110 (1.8 %) dLEC #3 1 / 82 (1.2 %) dLEC #4 2 / 91 (2.2 %)

ndLEC #1 0 / 42 (0%) ndLEC #2 0 / 51 (0%) ndLEC #3 0 / 47 (0%) ndLEC #4 0 / 48 (0%)

Supplementary Table 4. Stability of LEC-specific genes in dLECs and ndLECs. Expression of several LEC-specific genes was not significantly altered between dLECs and ndLECs. *dLEC/ndLEC is the ratio of respective expression levels of array probesets corresponding to the indicated genes in diabetic (dLECs) versus non-diabetic (ndLECs) LECs.

AffyID Gene Gene name dLEC/ndLEC* P-value

210082_at ABCA4 Retinal-specific ATP-binding cassette transporter

0.66 0.58

211148_s_at ANGPT2 Angiopoietin-2 precursor 1.27 0.31 214591_at KLHL4 Kelch-like protein 4 0.95 0.89 221898_at PDPN Podoplanin 1.08 0.70 204776_at THBS4 Thrombospondin 4 precursor 1.88 0.57 210316_at VEGFR3/FLT4 Vascular endothelial cell receptor 3 1.08 0.84

Page 4: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Table 5. A: Primers used for reverse transcription PCR shown in Supplemental Figure 2D. B: Taqman probes used for quantitative realtime PCR shown in Figure 3A. A: Primers used for RT-PCR as described in {Wick, 2007 #90}

Gene Forward 5’ – 3’ Reverse 5’ – 3’ PDPN caacgggaacgatgtggaag cgttggcagcagggcgtaac

PROX-1 acaagccgaagcgagaagg aacaagggtggtggctcag VWF cgctccttctcgattattgg ccggacagcttgtagtaccc KRT agaccaaaggtcgctactgc agaactgggaggaggagagg ACT atctggcaccacaccttctacaatgagctgcg cgtcatactcctgcttgctgatccacatctgc

B: Probes for Taqman® qPCR purchased from Applied Biosystems.

Gene Assay number GAPDH hs99999905_m1 PDPN hs01089982_g1

CXCL10 hs00171042_m1 NOX4 hs00418356_m1

VCAM-1 hs01003369_m1 GALNTL2 hs00365065_m1

FABP4 hs00609791_m1 APOD hs00155794_m1 MMP2 hs00234422_m1 CYR61 hs00155479_m1 CXADR hs00154661_m1 AQP3 hs00185020_m1 SDC1 hs00896424_g1

Page 5: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Figure 1. A: Dermal lymphatic capillaries show no differences in collagen IV deposition. Representative images of double immunofluorescence staining with anti-podoplanin and anti-collagen IV antibodies showed that lymphatic vessel basement membranes were weakly positive for collagen IV, but without significant expression differences between type 2 diabetic and non-diabetic lymphatic vessels. Podoplanin-negative blood capillaries showed strong collagen IV staining. Size bar = 20 µm. B: Dermal blood capillaries are specifically stained with DARC. Immunohistochemical stainings of consecutive human skin sections with anti-DARC and anti-CD31 antibodies show overlapping staining. Size bar = 100µm.

Page 6: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Figure 2. Ex vivo isolation of LECs from human skin and purity control. A: Ex vivo isolated endothelial cells were sorted into CD31+PDPN+ LECs (green dots) and CD31+PDPN- BECs (red dots). B: Post-sort analysis showing percentage of CD31+PDPN+ double positive cells (=LECs) in the upper right quadrant. x-axis: CD31 (FITC-labelled) intensities, y-axis: podoplanin (PE-labelled) intensities. C: Post-sort analysis showing that the amount of CD45-positive cells was less than one percent in cell preparations, indicating exclusion of leukocytes. D: RT-PCR and subsequent agarose gel electrophoresis detected transcripts for vanWillebrand factor (vWF), podoplanin and PROX-1, but no keratin expression in dLEC and ndLECs, indicating exclusion of keratinocytes (dLEC: type 2 diabetic LEC, ndLEC: non-diabetic LEC, +: PCR positive control, -: PCR negative control). Respective primer sequences are listed in Supplemental Table 4A. E: Quantitative realtime PCR analysis confirmed similar podoplanin expression levels in dLECs and ndLECs.

Page 7: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Figure 3. Ingenuity pathway analysis (IPA) results for dLEC transcripts enriched in annotated molecular and cellular functions. Rankings of the top ten Molecular and Cellular Functions most significant to the gene clusters “Inflammation and Wounding”, “Lymph Vessel Remodeling and Growth” and “Small Molecule Biochemistry” in Table 1. IPA software was used to calculate a P-value (set ≤ 0.05, shown as blue bars) by Fisher´s exact test, determining the probability with which a set of genes is associated with a known biological function. Categories are ranked according to the numbers of associated genes that are significantly enriched within them. The y-axis denotes the –log transformed P-value, denoting –log (0.05) = 1.3 as significance threshold (yellow line).

Page 8: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Figure 4. IPA results for dLEC transcripts enriched in annotated canonical pathways. For the canonical pathway categorization of all altered expressed genes, IPA software was used to calculate a P-value (set ≤ 0.05, shown as blue bars) by Fisher´s exact test, determining the probability with which a set of genes is associated with a known canonical pathway. The ratio (yellow squares) represents the number of differentially expressed genes from the dataset divided by the total number of genes that constitute that canonical pathway.

Page 9: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Figure 5. Immunofluorescent positive and respective antibody isotype control stainings of TNF-α in human heart and artery tissue samples. Paraffin embedded tissue sections were stained with anti-TNF-α and unspecific rabbit IgG as isotype control and PE-conjugated anti-rabbit antibody as secondary antibody, as described in the Materials and Methods section. DAPI was used to counterstain the nuclei. A: Immunofluorescent stainings of human heart sections. Shown are myoblasts of the myocard. Size bar: 100µm. B: Immunofluorescent stainings of human artery sections. Shown are myoblasts of the tunica media. Size bar: 100µm.

Page 10: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Figure 6. Dermal macrophages express VEGF-C and VEGF-A. Double immunofluorescence staining of frozen sections of human type 2 diabetic and non-diabetic skin samples revealed cytoplasmic VEGF-C and VEGF-A abundance in CD68-positive cells. Size bar: 20µm. A: Representative images of double immunofluorescence stainings with anti-CD68 and anti-VEGF-C antibodies. Quantitative evaluation of CD68-positive macrophages colocalizing with VEGF-C in double immunofluorescence staining was done as described in Fig. 4A (P-value = 0.11). B: Representative images of double immunofluorescence stainings with anti-CD68 and anti-VEGF-A antibodies. Quantitative evaluation of CD68-positive macrophages colocalizing with VEGF-A in double immunofluorescence staining was done as described in Fig. 4A (P-value = 0.31).

Page 11: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Figure 7. Identity control of cultured human dermal LECs (HDLECs) used for in vitro cell culture experiments. HDLECs were isolated by magnetic beading from human dermal microvascular endothelial cells (HDMECs, Promocell no. C-12260) using rabbit anti-podoplanin antibody. A: Confirmation of LEC identity by immunoprobing of BEC and LEC lysates transferred to nitrocellulose membranes with respective antibodies. LECs are CD31+/CD146-/Podoplanin+. B: Confirmation of LEC identity by Podoplanin/CD31 and Prox-1/CD31 double immunofluorescence staining.

Page 12: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

Supplementary Figure 8. TNF-α induces CXCL10 protein expression and secretion by LECs. A: Immunoblot analysis and densitometric quantification of lysates from LECs treated under conditions shown below and transferred to nitrocellulose membranes, probed with anti-CXCL10 antibody, which reveals a 10kDa band. Blots were reprobed with anti-GAPDH antibodies as loading control. CXCL10 band densities were normalized to GAPDH levels (P-value = 0.007). Data are given as the mean ± S.D. of the experiment performed in triplicates. B: ELISA of LEC culture supernatants detecting enhanced levels of CXCL10 after stimulation with TNF-α (P-value = 0.06), which could be inhibited by TNF-α blocking antibody (P = 0.048). ELISA was performed according to standard protocol: After coating with concentrated LEC culture supernatants, wells were washed (PBS/0.1% tween-20), blocked with PBS/4% BSA and 100µl anti-CXCL10 antibody diluted in PBS/1%BSA was added. After incubation for 2 hours at room temperature, wells were washed three times and 100µl of peroxidase-coupled secondary antibody dilution was added for 1 hour at room temperature. After washing, color was developed for 20 minutes with 50µl substrate solution (3,3',5,5'-Tetramethylbenzidine Liquid Substrate, no.T4444, Sigma) under light protection. The reaction was stopped (TMB Substrate Stop Reagent, Sigma-Aldrich, no. S5814) and color absorbance was read at 450nm in a plate reader (Synergy HT; Bio-Tek) within 10 minutes.

Page 13: SUPPLEMENTARY DATA - Diabetesdiabetes.diabetesjournals.org/.../DB120844SupplementaryData.pdfSUPPLEMENTARY DATA ©2013 American Diabetes Association. Published online at http ://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

SUPPLEMENTARY DATA  

©2013 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db12-0844/-/DC1

References

1. Viemann D, Goebeler M, Schmid S, et al. Transcriptional profiling of IKK2/NF-kappa B- and p38 MAP kinase-dependent gene expression in TNF-alpha-stimulated primary human endothelial cells. Blood 2004;103:3365-3373

2. Roy S, Khanna S, Shah H, et al. Human genome screen to identify the genetic basis of the anti-inflammatory effects of Boswellia in microvascular endothelial cells. DNA Cell Biol 2005;24:244-255