1 Supplemental Materials and Methods Protein, primers, strains and media Wild-type and mutant DnaA proteins were purified from overproducing E. coli cells using a method described previously (Nishida et al. 2002; Ishida et al. 2004; Kawakami et al. 2005; Kawakami et al. 2006). DARS-candidate sequences were amplified by PCR. FK7-4, FK7-7 and FK7-22 were amplified using Kohara phage λ #201 (Kohara et al. 1987) and the following primers: SIS-1 and del-3 for FK7-4, SIS-6 and SIS-7 for FK7-7, SIS-6 and SIS-16 for FK7-22. FK7-21, FK7-8, FK7-9 and FK7-13 were amplified using plasmids as template (pOA76 for FK7-21, pOA23 for FK7-8, pOA24 for FK7-9, and pOA35 for FK7-13) and primers (SIS-6 and SIS-7). Sequences of these primers and of primers used for derivatives of DARS1 and DARS2 are listed in Supplemental Table 3. All bacterial strains used in this study are listed in Supplemental Table 4. M9 medium contained standard M9 medium salts (Miller, 1972) supplemented with 0.2% glucose, 0.2% casamino acids, and 5 μg/ml thiamine. Plasmids pCL1920 was a gift from National Institute Genetics (Japan). pKD46 was a gift from Dr. Wanner and Dr. Niki (Datsenko and Wanner 2000). FK7-7 DNA was digested with BamHI and ligated into the BamHI and XhoI sites of pACYC177 after the unique XhoI site was filled in using KOD polymerase (Toyobo Co.), resulting in
24
Embed
Supplemental Materials and Methods Protein, primers ...genesdev.cshlp.org/content/suppl/2009/04/29/gad...Apr 29, 2009 · MG1655, MIT17, MIT78 and MIT80 using P1 transduction. 5 Supplemental
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
Supplemental Materials and Methods
Protein, primers, strains and media
Wild-type and mutant DnaA proteins were purified from overproducing E.
coli cells using a method described previously (Nishida et al. 2002; Ishida et al. 2004;
Kawakami et al. 2005; Kawakami et al. 2006). DARS-candidate sequences were
amplified by PCR. FK7-4, FK7-7 and FK7-22 were amplified using Kohara phage λ
#201 (Kohara et al. 1987) and the following primers: SIS-1 and del-3 for FK7-4, SIS-6
and SIS-7 for FK7-7, SIS-6 and SIS-16 for FK7-22. FK7-21, FK7-8, FK7-9 and
FK7-13 were amplified using plasmids as template (pOA76 for FK7-21, pOA23 for
FK7-8, pOA24 for FK7-9, and pOA35 for FK7-13) and primers (SIS-6 and SIS-7).
Sequences of these primers and of primers used for derivatives of DARS1 and DARS2
are listed in Supplemental Table 3.
All bacterial strains used in this study are listed in Supplemental Table 4. M9
medium contained standard M9 medium salts (Miller, 1972) supplemented with 0.2%
glucose, 0.2% casamino acids, and 5 µg/ml thiamine.
Plasmids
pCL1920 was a gift from National Institute Genetics (Japan). pKD46 was a
gift from Dr. Wanner and Dr. Niki (Datsenko and Wanner 2000). FK7-7 DNA was
digested with BamHI and ligated into the BamHI and XhoI sites of pACYC177 after the
unique XhoI site was filled in using KOD polymerase (Toyobo Co.), resulting in
2
pOA21. A region within pOA21 was amplified using primers SIS-17 and SIS-18,
self-ligated after being filled in, and phosphorylated by T4 polynucleotide kinase,
resulting in pOA76. Regions within the Kohara phageλ#462 (Kohara et al., 1987) were
amplified using primers (Kaz-9 and MutH-2 for pOA54, MutH-4 and MutH-2 for
pOA61, MutH-5 and MutH-2 for pOA62, and Kaz-9 and MutH-6 for pOA63), and the
resultant DNA fragments were digested with HindIII and BamHI, and cloned into the
HindIII and BamHI sites of pACYC177, resulting in pOA54, pOA61, poA62 and
pOA63. pOA54 was digested with BmgB1 and BamHI, the BamHI terminus was filled
in, and the resultant DNA fragment was self-ligated, resulting in pOA64. The fragment
amplified using pOA61 and a primer pair of MutH-14 and MutH-15 was self-ligated
after being filled in, and phosphorylated, resulting in pOA71. Similarly, pOA81, pOA82
and pOA83 were constructed using pOA61 and primer pairs of MutH-32 and MutH-33,
MutH-34 and MutH-35, and MutH-36 and MutH-37, respectively. A 0.45-kb
HindIII–BamHI fragment bearing minimal DARS2 or DARS2 mutant lacking DnaA
box-cluster was isolated from pOA61 or pOA71, respectively, and inserted into the
corresponding sites of pBR322, resulting in pKX11 or pOA77, respectively. Fragments
carrying mutations in DARS1 were prepared by annealing complementary
oligonucleotides (fk-7 and fk-8 for DnaA box I mutation, fk-9 and fk-10 for DnaA box
II mutation, fk-17 and fk-18 for DnaA box III mutation). The resultant DNA fragments
were cloned into the XhoI and BamHI sites of pACYC177, resulting in pOA23, pOA24
and pOA35, respectively.
3
Construction of ΔDARS1::kan, ∆DARS2::cat, and ∆DARS2::spec mutants
The chromosomal region corresponding to FK7-4 (Fig. 1) was replaced with
the kanamycin-resistant (kan) gene. Briefly, a downstream region of DARS1 was PCR
amplified using MG1655-genomic DNA and primers (Del-6 and Del-7). The resultant
DNA fragment was digested with SalI and SphI, and cloned using the corresponding
sites on pBR322, resulting in pOA5. The kan gene was amplified by PCR using pUC4K
and primers (Del-4 and Del-5), digested with SphI and BamHI, and ligated into the
corresponding sites on pOA5, resulting in pOA6. An upstream region of DARS1 was
amplified similarly using primers (Del-1 and Del-2), and the resultant DNA fragment
was digested with NheI and BamHI and ligated into the corresponding sites on pOA6,
resulting in pOA7. pOA7 was digested with SalI and ScaI, and introduced into E. coli
strain ME9018 (recD::mini-tet). Colonies were formed on LB plates containing
kanamycin (50 µg/mL) and screened for ampicillin sensitivity. Replacement of DARS1
with kan was verified by PCR. The resultant mutation (∆DARS1::kan) was introduced
into MG1655, MK86, KW262-5 and MIT166 using P1 transduction, resulting in MIT17,
MIT47, MIT167 and MIT168, respectively. Deletion of DARS1 in the transductants
was verified by PCR.
A DARS2 region containing DnaA box I-III was replaced with the cat or spec
gene in strain MG1655 harboring pKD46 (λ Red expression plasmid), according to a
method described previously (Datsenko and Wanner 2000; Baba et al. 2006), resulting
in the ∆DARS2::cat or spec mutants. Briefly, DNA fragments were PCR amplified
using pACYC184 and primers MutH-9 and MutH-10 (for ∆DARS2::cat) or using
4
pCL1920 and primers MutH-12 and MutH-13 (for ∆DARS2::spec). The resultant DNA
fragments were introduced into MG1655 bearing pKD46. Each deletion was verified by
PCR. ∆DARS2::cat was introduced into MG1655, MIT17 and KW262-5 using P1
transduction, resulting in MIT78, MIT80 and MIT166, respectively. ∆DARS2::spec
was also introduced into MG1655, MIT17, MK86 and MIT47 using P1 transduction,
resulting in MIT84, MIT92, MIT86 and MIT88, respectively. Deletion of DARS2 in the
transcductants was verified by PCR. tnaA::Tn10-linked dnaA508 was introduced into
MG1655, MIT17, MIT78 and MIT80 using P1 transduction.
5
Supplemental Table 1 Initial screen for DnaA-ADP-releasing activities on E. coli chromosomal regions
F.kaz-51 4460262 – 4461270 1009 0 The indicated E. coli chromosomal regions were amplified by PCR, and the resultant DNA fragments (100 fmol) were incubated with [3H]ADP-DnaA (2 pmol) at 30°C for
15 min in buffer containing 2 mM ATP. DNA-dependent release of ADP is shown for each fragment (ADP release %). Error range is <10%.
7
Supplemental Table 2 Relative cell mass and DNA content in DARS mutant cells
Cells of indicated strains were grown at 37°C in M9 medium. Cell size and DNA content were analyzed by flow cytometry. The values of obtained for strain MG1655
are defined as 1, and relative values are shown compared to this value. MIT17, MIT78, and MIT80 are derivatives of MG1655 (wild-type). MIT167, MIT166 and MIT168 are derivatives of KW262-5 (ΔoriC rnhA::Tn3).
8
Supplemental Table 3 List of oligonucleotides
Primer Sequence SIS-1 CCGCTCGAGCGTCTTCGATTGACTGCAA
KA474 KA473a dnaN59a Kurokawa et al (1999) KH5402-1 thyA b Nishida et al (2002) YT411 KH5402-1 rnhA::cat Nishida et al (2002)
KA451 KH5402-1 rnhA::cat, dnaA::Tn10 Nishida et al (2002) KA429 KH5402-1 rnhA::cat, ∆oriC1071::Tn10 Nishida et al (2002) KA450 KH5402-1 ∆oriC1071::Tn10 Nishida et al (2002)
dnaA17 (Amber) rnhA199(Amber), WK001(pHCS4-1) KH5402-1 ∆hda::cat bearing pHCS4-1c (Fujimitsu et al. 2008) KP7364 KP245d ∆dnaA::spec rnhA::kan Miki, T.
(Kurokawa et al. 1999) ME9018 MG1655 recD1903::mini-tet NIGe MG1655 Wild type Laboratory stock
MIT17 MG1655 ∆DARS1::kan This work MIT78 MG1655 ∆DARS2::cat This work MIT84 MG1655 ∆DARS2::spec This work
MIT80 MIT17 ∆DARS2::cat This work MIT92 MIT17 ∆DARS2::spec This work KW262-5 MG1655 rnhA::Tn3 ∆oriC::tet (Kato and Katayama 2001)
MK86 KW262-5 ∆hda::cat (Kato and Katayama 2001) MIT47 MK86 ∆DARS1::kan This work MIT86 MK86 ∆DARS2::spec This work
MIT88 MIT47 ∆DARS2::spec This work MIT140 MG1655 dnaA508 tnaA::Tn10 This work MIT21 MIT17 dnaA508 tnaA::Tn10 This work
MIT141 MIT78 dnaA508 tnaA::Tn10 This work MIT142 MIT80 dnaA508 tnaA::Tn10 This work MIT167 KW262-5 ∆DARS1::kan This work
11
MIT166 KW262-5 ∆DARS2::cat This work MIT168 MIT166 ∆DARS1::kan This work a Other genetic markers are HfrC thyA metB uhp-1 rel-1 tnA22 (λ+). b Other genetic markers are ilv thr thrA(amber) trpE9829(amber) metE deo supF6(Ts). c pACYC177 derivatives carrying hda gene. d Other genetic markers are thyA trp his metB lac gal tsx. e National Institute of Genetics, Japan.
12
Supplemental References
Baba, T., Ara, T., Hasegawa, M., Takai, Y., Okumura, Y., Baba, M., Datsenko, K.A., Tomita, M., Wanner, B.L., and Mori, H. 2006. Construction of Escherichia coli K-12 in-frame, single-gene knockout mutants: the Keio collection. Mol Syst Biol
2: 2006 0008. Datsenko, K.A. and Wanner, B.L. 2000. One-step inactivation of chromosomal genes in
Escherichia coli K-12 using PCR products. Proc Natl Acad Sci U S A 97(12):
6640-6645. Fujimitsu, K., Su'etsugu, M., Yamaguchi, Y., Mazda, K., Fu, N., Kawakami, H., and
Katayama, T. 2008. Modes of overinitiation, dnaA gene expression, and
inhibition of cell division in a novel cold-sensitive hda mutant of Escherichia
coli. J Bacteriol 190(15): 5368-5381. Ishida, T., Akimitsu, N., Kashioka, T., Hatano, M., Kubota, T., Ogata, Y., Sekimizu, K.,
and Katayama, T. 2004. DiaA, a novel DnaA-binding protein, ensures the timely initiation of Escherichia coli chromosome replication. J Biol Chem 279(44): 45546-45555.
Kato, J. and Katayama, T. 2001. Hda, a novel DnaA-related protein, regulates the replication cycle in Escherichia coli. EMBO J 20(15): 4253-4262.
Kawakami, H., Keyamura, K., and Katayama, T. 2005. Formation of an
ATP-DnaA-specific initiation complex requires DnaA Arginine 285, a conserved motif in the AAA+ protein family. J Biol Chem 280(29): 27420-27430.
Kawakami, H., Ozaki, S., Suzuki, S., Nakamura, K., Senriuchi, T., Su'etsugu, M., Fujimitsu, K., and Katayama, T. 2006. The exceptionally tight affinity of DnaA for ATP/ADP requires a unique aspartic acid residue in the AAA+ sensor 1
motif. Mol Microbiol 62(5): 1310-1324. Kohara, Y., Akiyama, K., and Isono, K. 1987. The physical map of the whole E. coli
chromosome: application of a new strategy for rapid analysis and sorting of a
large genomic library. Cell 50(3): 495-508. Kurokawa, K., Nishida, S., Emoto, A., Sekimizu, K., and Katayama, T. 1999.
Replication cycle-coordinated change of the adenine nucleotide-bound forms of
DnaA protein in Escherichia coli. EMBO J 18(23): 6642-6652.
13
Miller J. H. (1972). Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
Nishida, S., Fujimitsu, K., Sekimizu, K., Ohmura, T., Ueda, T., and Katayama, T. 2002.
A nucleotide switch in the Escherichia coli DnaA protein initiates chromosomal replication: evidnece from a mutant DnaA protein defective in regulatory ATP hydrolysis in vitro and in vivo. J Biol Chem 277(17): 14986-14995.
14
Legends of Supplemental Figures
Supplemental Figure 1 Heat-liable activity of DARS2-stimulating crude extract.
A crude protein extract (2 µg as protein) was incubated at 60°C for the indicated
amount of time, and further incubated at 30°C for 15 min in buffer containing
[3H]ADP-DnaA (2 pmol) and 5 fmol of pACYC177 (vector; ○) or pOA54 (●).
Supplemental Figure 2 DARS2 can reactivate ADP-DnaA resulting from RIDA
in vitro.
A, Release of DnaA-bound ADP that was produced by RIDA. DARS2-dependent
release of DnaA-bound ADP produced by RIDA was determined as described in Figure
3B, with exception that products were further incubated with the indicated amounts of
pOA61 or pACYC177 (Vector) in the presence of crude protein extract (80 µg/mL).
ADP-DnaA constituted 94% of ATP-/ADP-DnaA after the RIDA reaction.
B, DARS2-driven reactivation of RIDA-produced ADP-DnaA. The first stage was
performed as described in Figure 3B. In the second stage, the samples that had been
incubated at 30°C with (red) or without (blue) the DNA-clamp complexes in the first
stage were further incubated at 30°C for 15 min with the indicated amounts of pOA61
or pACYC177 (Vector) in the presence of crude protein extract (80 µg/mL). After the
first or second stage, replication activity of DnaA was assessed in a minichromosomal
replication system as described in Figure 3C. Incorporation of nucleotides was 2 pmol
in the absence of DnaA or minichromosome (data not shown).
15
Supplemental Figure 3 Growth of colonies of hda::cat DARS mutant cells.
hda::cat was transduced into MG1655 (wild-type), MIT17 (∆DARS1::kan), MIT84
(∆DARS2::spec), MIT92 (∆DARS1::kan ∆DARS2::spec) by P1 phage. These
transdutants were incubated at 37°C for 20 h on LB agar plates containing