Supplemental Data Antisense-Mediated Depletion Reveals Essential and Specific Functions of MicroRNAs in Drosophila Development Dan Leaman, Po Yu Chen, John Fak, Abdullah Yalcin, Michael Pearce, Ulrich Unnerstall, Debora S. Marks, Chris Sander, Thomas Tuschl, and Ulrike Gaul Figure S1. Northern Blots for All Drosophila miRNAs Figure S1
8
Embed
Supplemental Data Antisense-Mediated Depletion Reveals Essential and Specific Functions of MicroRNAs in Drosophila Development
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Supplemental Data
Antisense-Mediated Depletion
Reveals Essential and Specific Functions
of MicroRNAs in Drosophila Development Dan Leaman, Po Yu Chen, John Fak, Abdullah Yalcin, Michael Pearce, Ulrich Unnerstall, Debora S. Marks, Chris Sander, Thomas Tuschl, and Ulrike Gaul Figure S1. Northern Blots for All Drosophila miRNAs Figure S1
Note that since miRNAs differing in only a few bases are expected to crosshybridize, only one miRNA per multicopy group was tested.
Figure S2. Sequence Alignments for the Six Predicted miR-2 Family Target Sites in the 3′UTRs of the Proapoptotic Factors hid, grim, rpr, and skl. rpr
987654321 mir-2b CGAGGA UUUCG GACACUA -26.6 G ACC U --------------------------------------------------------------------------------------------- miR-13b UGAG GUUUU CG ACACUA -15.4 CA AC U --------------------------------------------------------------------------------------------- miR-11 UCGU UUG A UCUG ACACUA -17.3 UC G C --------------------------------------------------------------------------------------------- miR-6 UUUUC UGU GG ACACUA -14.7 U U C UG U --------------------------------------------------------------------------------------------- miR-308 GUGU GGACACUAA -13.2 GA CAUAUUA --------------------------------------------------------------------------------------------- skl271_vir GU----GAAGGCUGAUUA-AAAUGUUUGGAUAAGCGCAAAUGUGAUAAAUAAUUUUGCUAAAACAU skl271_moj GUUUUUGAAGGCUGAUUUGAAAUGUUUGGAUAAGCGCAAAUGUGAUAAAUAAUUUUGCUAAAAAUU skl271_pse AAUUGCCGUCGC-GAUACACACUUUUUGGAUAAGCGCAAAUGUGAUAAAUAAUUUUGCUAAAAAUA skl271_ana CU--------------UAAAACACUUUGGAUAAGCGCAAAUGUGAUAAAUGAUUUUGCUAAAAAUA skl271_yak -------------------AAAACUUUGGAUAAGCGCAAAUGUGAUAAAUAAUUUUGCUAAAAAAA skl271_mel -------------------AAAACUUUGGAUAAGCGCAAAUGUGAUAAAUAAUUUUGCUAAAAAAA
987654321 miR-6 UCU UCG GU ACACUAU -20.3 UUUU UG G --------------------------------------------------------------------------------------------- mir-2b GAGG UUCG ACACUAU -17.0 C AGU ACCG --------------------------------------------------------------------------------------------- miR-11 UUGAG UCUG ACACUA -12.3 UCGUUC C --------------------------------------------------------------------------------------------- miR-308 UC UAUU ACACUA -11.4 GAGUG A GGA A --------------------------------------------------------------------------------------------- miR-13b GAGC GUUU CG ACACUAU -11.9 U A UAC --------------------------------------------------------------------------------------------- Sequences surrounding the target sites for the 6 available Drosophilid species (D. melanogaster, D. yakuba, D. ananassae, D. pseudoobscura, D. virilis, and D. mojavensis) were retrieved from VistaBrowser (http://pipeline.lbl.gov/cgi-bin/gateway2) and aligned, species are ordered by distance from D. melanogaster; nucleotides conserved in all species are shaded blue, nucleotides conserved in the majority are shaded gray. Target sites are named according to the position in the 3′UTR that is complementary to the 5′ end of the miRNA (position 1), in D. melanogaster coordinates. Pairings of miR-2 family miRNAs with the target sites are based on optimal foldings as computed with mfold (Zuker, 2003) and are listed in order of ∆G value. Watson-Crick base pairings are shaded red, G:U pairings yellow, nonpairing residues of the miRNA are offset. For miR-2 and miR-13, only the miRNA copy with the best alignment is shown.
Supplemental References Zuker, M. (2003). Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31, 3406–3415.