8/7/2019 STR Biology
1/33
Biology of STRs
8/7/2019 STR Biology
2/33
Artifacts in Genotyping STRs
A number of artifacts are possible:
Stuttering Non-template additions
Microvariants Three peaks
Allele dropouts
Mutations
All interfere with reading a DNA profile
accurately and consistently
8/7/2019 STR Biology
3/33
Stuttering
Stuttering is caused by the very structure
of the STRs that make them good markers They are repeats
That are highly polymorphic Stutter product is a band that has the
wrong number of repeats Either one repeat more or one less
Caused by strand slippage
8/7/2019 STR Biology
4/33
Strand-slippageATGCGGCGGCGTGTGTGTGTGGCG
TACGCCGCCGCACACACACACCGCCG53
ATGCGGCG
TACGCCGCCGCACACACACACCGCCG
53
CGTGT
GGT
GT
GT
DNA Replication
Or PCR
Elongation
ATGCGGCGGCGTGTGTGTGTGGCGGC
TACGCCGCCGCACACACACACCGCCG
53
GT
ATGCGGCGGCGTGTGTGT
TACGCCGCCGCACACACACACCGCCG
53
GT Misalignment
8/7/2019 STR Biology
5/33
Strand Slippage
Occurs during extension step of PCR
The newly formed strand of DNA skipsone repeat unit starts complementary
base pairing with next repeat Pushing out a non-base paired loop from
the template strand of DNA
Usually causes a deletion of one repeatunit therefore band will be one unit
smaller than true genotype
8/7/2019 STR Biology
6/33
Strand Slippage
Naturally this is the mechanism that
makes repeats polymorphic When it happens during PCR it can
produce a band that is not real: Genotype will be wrong
One repeat unit lower or higher than reality
Rarer in Tetranucleotides than any otherrepeats which is why tetras are used
8/7/2019 STR Biology
7/33
Amount of Stutter Product
Stutter is usually rare
Therefore might show a small bump - canusually be differentiated from a true band
Earlier in PCR reaction strand slips More stutter product will be produced
Or if genotyping protocol doesnt work welltrue band may be very low
Difficult to separate stutter band from true
band
8/7/2019 STR Biology
8/33
Stutter Products
Stutter Stutter Stutter ?
Call these genotypes:
8/7/2019 STR Biology
9/33
Calling Alleles
Biggest problem with stutter bands:
They are the same size as a real allele!
Especially difficult if you know the DNA
sample is mixed Or you are unsure whether sample has
been contaminated
Difficult to determine:
Stutter band
Minor allele (because less DNA)
8/7/2019 STR Biology
10/33
13 CODIS STR Loci
All produce some stutter products
Longer alleles produce more stuttering Why does this make sense?
Stutter percentages for Tetranucleotides: From Less than 1 %
Up to 15% - of the true allele size
Therefore always calculate percentage ofsmall bands peak height
Be sure < 15% height of large band
8/7/2019 STR Biology
11/33
Reducing Stuttering Products
Changing PCR conditions
Faster DNA Polymerase Faster it works, less chance for slippage
STRs with longer repeats (> 4 bps) More difficult to skip past repeat
STRs with imperfect repeat units Complex and compound repeats
More difficult to skip past repeat if next repeat
unit sequence is different
8/7/2019 STR Biology
12/33
Summary of Stutter Products
One repeat unit more or less than real
allele peaks Less then 15% real allele height
Quantity of stutter band depends on: When in PCR reaction first slippage occurs
Allele size (bigger alleles, more stutter)
PCR Conditions
Polymerase used
Repeat length and sequence
8/7/2019 STR Biology
13/33
Non-Template Additions
Polymerase often adds an extra
Adenosine to the end of the newly formedsequence
Not a part of the template sequence Makes PCR product one base longer than
actual sequence
If your PCR reaction forms both +A and -Aproducts then your band will be wide
8/7/2019 STR Biology
14/33
Non-Template Additions
Want to have peaks as clear as possible
Therefore want all PCR products to beidentical
Either all +A or all -A Imagine case where you were genotyping
a dinucleotide, with stutter, and half theproducts were +A and half were -A
Impossible to separate genotypes
8/7/2019 STR Biology
15/33
Non-Template Additions
Set up PCR conditions so that every
product will be +A Conditions:
Final extension for 10 mins Allows all products to be fully adenylated
Primer ends in a guanosine
Commercially available kits turn everyallele (and ladder) into +A
8/7/2019 STR Biology
16/33
Overloading Sample
Signal on gel is too strong will be difficult
to call May result in a split peak
Or a peak that is off scale Caused by:
Too much DNA sample in PCR reaction Primer concentrations too high
Why DNA quantification is so important
8/7/2019 STR Biology
17/33
D3S1358 VWA FGA
-A
+A10 ng
template(overloaded)
2 ng template(suggested level)
DNA Size (bp)
RelativeF
luorescence(RFUs)
off-scale
Figure 6.5, J.M. Butler (2005) Forensic DNA Typing, 2nd Edition 2005 Elsevier Academic Press
Non-Template Additions and
Overloading Samples
8/7/2019 STR Biology
18/33
Microvariants
Remember these are variants of the
repeat that are not a full repeat unit Example TH01 9.3 allele
As opposed to stutter allele microvariantsare not same size as expected allele
Problem is determining whether there isa true microvariant in the person
Or you are seeing a normal band being
shifted over for some genotyping reason?
8/7/2019 STR Biology
19/33
Microvariants
1. True microvariants must be validated to
happen in many samples Even if variant is rare it must show up in
more than one individual to be considered a
true microvariant
2. Exact distance in base pairs should be
calculated 9.3 means 9 repeats plus 3 bases
Always calculate in bases exactly how offthe microvariant is
8/7/2019 STR Biology
20/33
Sequence Microvariants
Sometimes there are also sequence
differences in these polymorphisms aswell as length differences
The only way to genotype a sequencevariant is to sequence the PCR product
Not necessary for Forensics because you
are simply matching genotypes
These variants are not important for
Forensics analysis
8/7/2019 STR Biology
21/33
Peaks outside of the Ladder
Sometimes you will see a peak that it
outside of the expected range for anymarker (between markers?)
What could cause this? Unsuccessful PCR product
Primer dimers or etc.
Person really has a new allele
Check with different set of primers
Sequence new allele and region
8/7/2019 STR Biology
22/33
Three Peaks
Sometimes three bands may be seen
What could cause three bands? Stuttering
Mixed or contaminated samples Genotyping error
True duplication or extra chromosome in the
individual
Need to validate what is seen in gel
8/7/2019 STR Biology
23/33
Three Peaks
1. Check other markers in panel:
1. Is there evidence of mixed or contaminatedsamples in any other markers?
2. Check database information for this
marker:1. More than 50 tri-allelic patterns have been
reported as possible with 13 CODIS loci3. Sequence or genotype this region:
1. Is there truly a duplication or extrachromosome in this person?
8/7/2019 STR Biology
24/33
Allele Dropout
Most worrisome problem
May call a person homozygous whenreally they are heterozygous
What can this be caused by?
Larger allele is not amplified successfully
Primer site mutation
Rare with chosen tetranucleotides: Alleles are very similar in size
Primers have been optimized and chosen inregions that are very stable
8/7/2019 STR Biology
25/33
Avoiding Allele Dropout
Chose primers carefully
Work with polymorphisms that have allelesof similar size
Always check genotypes with Hardy-Weinberg Equation
Make sure you see the expected number of
heterozygotes population wide
Most commercial kits have taken care of
all these issues
8/7/2019 STR Biology
26/33
Fixing Allele Dropouts
Add a degenerate primer
Extra primer with known polymorphism Three primers total will be added
Lower annealing temperature Reduce the stringency of primer binding
Remember that with Forensics whatmatters is matching genotypes
As long as allele always drops out, dont have
a problem
8/7/2019 STR Biology
27/33
Mutations
STRs do mutate at an expected mutation
rate over time Mutation may cause:
New Alleles Change primer binding regions
Sequence changes (less important)
Very rare events
Can be validated by examining families
8/7/2019 STR Biology
28/33
Mendelization of Alleles
Using family members to determine which
alleles are possible If you know parents alleles then there are
only so many genotypes possible forchildren
Mendels law of segregation
All STRs have been genotyped on CEPHfamilies huge family sets from Utah
8/7/2019 STR Biology
29/33
Mendelization of Alleles
3/148/12
3/8 8/14 3/12
2/9 5/11
10/112/11
As always must validate mutation
By sequencing or regenotyping
8/7/2019 STR Biology
30/33
Mutation Rates
Mutations rates of 13 CODIS have been
calculated over thousands of meioses All 13 are between 1 to 5 per 1000
generational events
Highest mutation rates:
Markers that are most polymorphic
Lowest mutation rates:
Markers that are least informative
8/7/2019 STR Biology
31/33
Impact of Mutations
Paternity testing
Can cause problems Because father may not match true child if
genotype has change in child
Compare many STR loci
Identity matching
Will not cause a problem
Because mutation will be consistent over a
persons lifetime and in all tissues
8/7/2019 STR Biology
32/33
Genotyping Errors
All the previous were artifacts that can be
explained However the problems you really worry
about are unexplained errors
Especially if sample may be:
Contaminated
Mixed samples
Need to always validate any artifact
Be sure its not genotyping error
8/7/2019 STR Biology
33/33
Any Questions?
Review Chapters 1 6
Email me at least 2 questions you
have about the first 6 chapters
Next class will be review for Exam
Exam One February 5th