Experimental Hematology 31 (2003) 389–397 Stathmin expression and megakaryocyte differentiation:A potential role in polyploidy Camelia Iancu Rubin, Deborah L. French, and George F. Atweh Division of Hematology, Mount Sinai School of Medicine, New York, NY, USA (Received 21 October 2002; revised 23 January 2003; accepted 4 February 2003) Objective. Megakaryopoiesis is characterized by two major processes, acquisition of lineage- specific markers and polyploidization. Polyploidy is a result of endomitosis, a process that is characterized by continued DNA replication in the presence of abortive mitosis. Stathmin is a major microtubule-regulatory protein that plays an important role in the regulation of the mitotic spindle. Our previous studies had shown that inhibition of stathmin expression in human leukemia cells results in the assembly of atypical mitotic spindles and abnormal exit from mitosis. We hypothesized that the absence of stathmin expression in megakaryocytes might be important for their abortive mitosis. Materials and Methods. The experimental models that we used were human K562 and HEL cell lines that can be induced to undergo megakaryocytic differentiation and primary murine megakaryocytes generated by in vitro culture of bone marrow cells. The megakaryocytic phenotype was evaluated by flow cytometry and light microscopy. The DNA content (ploidy) was analyzed by flow cytometry. Stathmin expression was analyzed by Western and Northern blotting and by RT-PCR. Results. Our studies showed an inverse correlation between the level of ploidy and the level of stathmin expression in megakaryocytic cell lines and in primary cells. More importantly, inhibition of stathmin expression in K562 cells enhanced the propensity of these cells to undergo endomitosis and to become polyploid upon induction of megakaryocytic differentiation. In contrast, inhibition of stathmin expression interfered with the ability of the cells to acquire megakaryocyte-specific markers of differentiation. Conclusion. Based on these observations, we propose a model of megakaryopoiesis in which stathmin expression is necessary for the proliferation and differentiation of early megakary- oblasts and its suppression in the later stages of megakaryocytic maturation is necessary for polyploidization. 2003 International Society for Experimental Hematology. Published by Elsevier Science Inc. Megakaryopoiesis is a complex process that consists of cellular proliferation and acquisition of specific markers of differentiation in the early stages of megakaryocyte devel- opment [1]. This is followed by progressive polyploidization and further acquisition of lineage-specific markers in the later stages of megakaryopoiesis [1]. Polyploidization is a unique feature of megakaryocytes in which repeated rounds of DNA replication occur without concomitant cell division [2]. The ploidy of megakaryocytes increases progressively from 8N up to 128N. A direct correlation between DNA content, megakaryocyte size, and platelet production has Offprint requests to: George F. Atweh, M.D., Division of Hematology, Box 1079, Mount Sinai School of Medicine, One Gustave Levy Place, New York, NY 10029; E-mail: [email protected] 0301-472X/03 $–see front matter. Copyright 2003 International Society for Experimental Hematology. Published by Elsevier Science Inc. doi: 10.1016/S0301-472X(03)00043-2 been demonstrated [3,4]. Megakaryocytes with high levels of ploidy release more platelets than those with lower ploidy. Alterations in polyploidy in several pathological conditions (i.e., myeloproliferative disorders and myelofibrosis) are as- sociated with either ineffective or excessive platelet produc- tion [5–8]. The process of polyploidization, also known as endomitosis, is a consequence of abortive mitosis which is characterized by the failure of cells to exit mitosis and undergo cytokinesis after completing their DNA synthesis [9,10]. Since the late phases of mitosis and cytokinesis do not take place in megakaryocytes undergoing endomitosis, it was suggested that proteins that are involved in the regula- tion of the mitotic spindle late in mitosis may play a key role in the process of polyploidization [9,10]. Microtubules that make up the mitotic spindle are nor- mally in a state of dynamic equilibrium between phases
Stathmin expression and megakaryocyte differentiation:A potential role in polyploidy
Jan 12, 2023
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
doi:10.1016/S0301-472X(03)00043-2Stathmin expression and megakaryocyte differentiation:A potential role in polyploidy
Camelia Iancu Rubin, Deborah L. French, and George F. Atweh Division of Hematology, Mount Sinai School of Medicine, New York, NY, USA
(Received 21 October 2002; revised 23 January 2003; accepted 4 February 2003)
Objective. Megakaryopoiesis is characterized by two major processes, acquisition of lineage- specific markers and polyploidization. Polyploidy is a result of endomitosis, a process that is characterized by continued DNA replication in the presence of abortive mitosis. Stathmin is a major microtubule-regulatory protein that plays an important role in the regulation of the mitotic spindle. Our previous studies had shown that inhibition of stathmin expression in human leukemia cells results in the assembly of atypical mitotic spindles and abnormal exit from mitosis. We hypothesized that the absence of stathmin expression in megakaryocytes might be important for their abortive mitosis.
Materials and Methods. The experimental models that we used were human K562 and HEL cell lines that can be induced to undergo megakaryocytic differentiation and primary murine megakaryocytes generated by in vitro culture of bone marrow cells. The megakaryocytic phenotype was evaluated by flow cytometry and light microscopy. The DNA content (ploidy) was analyzed by flow cytometry. Stathmin expression was analyzed by Western and Northern blotting and by RT-PCR.
Results. Our studies showed an inverse correlation between the level of ploidy and the level of stathmin expression in megakaryocytic cell lines and in primary cells. More importantly, inhibition of stathmin expression in K562 cells enhanced the propensity of these cells to undergo endomitosis and to become polyploid upon induction of megakaryocytic differentiation. In contrast, inhibition of stathmin expression interfered with the ability of the cells to acquire megakaryocyte-specific markers of differentiation.
Conclusion. Based on these observations, we propose a model of megakaryopoiesis in which stathmin expression is necessary for the proliferation and differentiation of early megakary- oblasts and its suppression in the later stages of megakaryocytic maturation is necessary for polyploidization. 2003 International Society for Experimental Hematology. Published by Elsevier Science Inc.
Megakaryopoiesis is a complex process that consists of cellular proliferation and acquisition of specific markers of differentiation in the early stages of megakaryocyte devel- opment [1]. This is followed by progressive polyploidization and further acquisition of lineage-specific markers in the later stages of megakaryopoiesis [1]. Polyploidization is a unique feature of megakaryocytes in which repeated rounds of DNA replication occur without concomitant cell division [2]. The ploidy of megakaryocytes increases progressively from 8N up to 128N. A direct correlation between DNA content, megakaryocyte size, and platelet production has
Offprint requests to: George F. Atweh, M.D., Division of Hematology, Box 1079, Mount Sinai School of Medicine, One Gustave Levy Place, New York, NY 10029; E-mail: [email protected]
0301-472X/03 $–see front matter. Copyright 2003 International Society for Experimental Hematology. Published by Elsevier Science Inc. doi: 10.1016/S0301-472X(03)00043-2
been demonstrated [3,4]. Megakaryocytes with high levels of ploidy release more platelets than those with lower ploidy. Alterations in polyploidy in several pathological conditions (i.e., myeloproliferative disorders and myelofibrosis) are as- sociated with either ineffective or excessive platelet produc- tion [5–8]. The process of polyploidization, also known as endomitosis, is a consequence of abortive mitosis which is characterized by the failure of cells to exit mitosis and undergo cytokinesis after completing their DNA synthesis [9,10]. Since the late phases of mitosis and cytokinesis do not take place in megakaryocytes undergoing endomitosis, it was suggested that proteins that are involved in the regula- tion of the mitotic spindle late in mitosis may play a key role in the process of polyploidization [9,10].
Microtubules that make up the mitotic spindle are nor- mally in a state of dynamic equilibrium between phases
C. Iancu Rubin et al. /Experimental Hematology 31 (2003) 389–397390
of polymerization and depolymerization [11,12]. Stathmin, also known as oncoprotein 18 or Op18/Stathmin, is a highly conserved cytosolic phosphoprotein that regulates the dynamic equilibrium of microtubules during cell cycle pro- gression by promoting depolymerization [13–17]. When cells enter mitosis, stathmin is inactivated by phosphorylation. This allows microtubules to polymerize and the mitotic spindle to assemble [14,18]. Late in mitosis, stathmin must be reactivated by dephosphorylation for microtubules to de- polymerize and the mitotic spindle to disassemble [18,19]. We had previously shown that inhibition of stathmin ex- pression in leukemic cells results in accumulation of cells in mitosis due to the formation of atypical mitotic spindles and the resulting difficulty in exit from mitosis [20]. As mentioned above, endomitosis in megakaryocytes has been attributed to the formation of an atypical mitotic spindle and inability to exit mitosis. Interestingly, mature megakaryo- cytes and circulating platelets were previously shown to have undetectable levels of stathmin [21,22]. Thus, we hypoth- esized that downregulation of stathmin expression in mega- karyocytes undergoing DNA synthesis may be important for polyploidization. We investigated the potential role of stathmin in megakaryopoiesis both in human megakaryo- cytic cell lines and in primary murine megakaryocytes. Based on the studies described below, we propose a model in which stathmin expression in the early stages of megakar- yopoiesis may be important for cell proliferation and dif- ferentiation while its suppression in the later stages may be important for polyploidization.
Materials and methods
Cell lines HEL and K562 human erythroleukemia cell lines were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 100 µg/mL streptomycin at 37ºC in a humidified 5% CO2 incubator. Control K562 cells (K562.C) and stathmin-inhibited K562 cells (K562.AS) were pre- viously described [23]. Briefly, the cells were transfected with an expression vector containing the complete transcription unit for a mutant form of dihydrofolate reductase (DHFR) that has a low affinity for methotrexate. The stathmin-inhibited K562.AS cells were generated by transfecting an expression construct containing full-length stathmin cDNA in an antisense orientation relative to an SV40 promoter. The antisense stathmin cDNA sequences were coamplified with the DHFR sequences by exposing the transfected cells to 1 µM methotrexate (MTX) [23]. The control K562.C cells were transfected with an expression construct without the stathmin cDNA. All experiments described in this report were per- formed with cells in the logarithmic phase of growth (0.5–1 × 105
cells/mL).
Reagents Staurosporine and phorbol ester (TPA, 12-O-tetradecanoylphorbol- 13-acetate) were purchased from Sigma (St. Louis, MO, USA) and dissolved in dimethylsulfoxide at 21.4 × 105 M and 1.6 × 105
M, respectively, and stored at 20ºC. Working solutions were prepared in RPMI medium and added to the cell culture media at the specified concentrations.
Murine megakaryocyte cultures Murine bone marrow cells were harvested by flushing femurs and tibias of 9- to 12-week-old C57BL16 female mice with Iscove’s modified Dulbecco’s medium (IMDM). Red cells were lysed by incubation for 10 minutes at room temperature in hypotonic buffer (150 mM NaCl, 10 mM NaHCO3, 100 mM EDTA). After two washes in phosphate-buffered saline (PBS) containing 2% FBS, cells were plated at a density of 1 × 106/mL in 6-well tissue culture plates in IMDM supplemented with 1% penicillin/streptomycin, 1% L-glutamine, 5 × 105 M β-mercaptoethanol, 1% bovine serum albumin (BSA) Fraction V (Sigma, St. Louis, MO, USA), 30% serum substitute BIT 9500 (Stem Cell Technologies, Vancouver, BC, Canada), 10 ng/mL mouse thrombopoietin (TPO) (R&D Sys- tems, Minneapolis, MN, USA), 10 ng/mL mouse interleukin (IL)- 11 (R&D Systems), and 10 ng/mL human IL-6 (R&D Systems). The tissue culture plates were incubated at 37ºC in a humidified 5% CO2 incubator for six to seven days. Megakaryocytes were isolated on a discontinuous BSA density gradient (0%, 1.5%, 3.0% in PBS) [24]. Nonadherent cells were harvested, centrifuged (1000 rpm, 5 minutes), resuspended in 2 mL PBS, and overlaid on the discontinu- ous BSA gradient. After 30 to 45 minutes, the cells that settled at the bottom of the tube by gravity were harvested separately from those found in the 3% BSA gradient. The two fractions were washed once in PBS and their phenotype analyzed by morphology and cell surface marker expression. Cytospin preparations were stained with the Wright-Giemsa stain or an acetylcholinesterase stain [25]. Flow cytometry was performed for detection of surface αIIbβ3 receptors using a FITC-conjugated anti-mouse CD41 monoclonal antibody (BD Pharmingen, San Diego, CA, USA).
Isolation of murine platelets Citrated whole blood was diluted in PBS (1:2) and mononuclear cells were isolated on a Ficoll density gradient (1.077 g/mL) (Accu- rate Chemical & Scientific Corporation, Westbury, NY, USA). The platelet-rich fraction was concentrated by centrifugation at 1300 rpm for 2 minutes at room temperature.
RNA quantification Total RNA was purified using the guanidine isothiocyanate–based TRIzol reagent (Gibco BRL, Rockville, MD, USA). For Northern blotting, 20 µg RNA were fractionated by electrophoresis under glyoxal denaturing conditions and transferred to nylon membranes. Membranes were hybridized with 32P-labeled 1.2-kb EcoR V/Xba I fragment of human stathmin [26] and 18S ribosomal cDNA probes. The levels of mRNA were quantified using NIH (National Institutes of Health) image software. For S1 nuclease protection assays, 5 µg RNA were analyzed for stathmin expression as de- scribed [23]. For reverse transcriptase polymerase chain reaction (RT-PCR) analysis, 500 ng of total RNA were used for cDNA synthesis using the Cells-to-cDNA kit (Ambion, Austin, TX, USA). One-tenth of the cDNA mixture was used for PCR amplification using oligonucleotide primers specific for mouse stathmin [27], sense: 5′ TCCAGGTGAAAGAGCTGGAG 3′ and antisense: 5′ ACCTCTTCCACGTGCTTGTC 3′, and oligonucleotide primers specific for 18S ribosomal DNA purchased from the manufacturer
C. Iancu Rubin et al. /Experimental Hematology 31 (2003) 389–397 391
(Ambion). For the PCR reaction, the DNA was mixed with 1× PCR reaction buffer (PE Applied Biosystems, Foster City, CA, USA), 2 mM MgCl2, 0.2 mM dNTP, 0.2 µM each primer, and 1.25 units Taq DNA polymerase (AmpliTaq) (PE Applied Biosystems) in a total volume of 50 µL. The reaction tubes were preheated to 94ºC for 5 minutes, followed by successive rounds of denaturation at 94ºC for 1 minute, annealing at 59ºC for 1 minute, and extension at 72ºC for 1 minute for 23 cycles, with a final extension time of 10 minutes at 72ºC. Samples were analyzed on agarose gels containing ethidium bromide, transferred to a nylon membrane, and probed with P32-labeled EcoR V/Xba I fragment of human stathmin cDNA.
Protein quantification Cells were lysed (50 mM Tris-Cl, 15 mM NaCl, 1% Triton-X, 40 mg/mL protease inhibitor cocktail [Roche Molecular Biochemicals, Indianapolis, IN, USA]) and protein concentrations were deter- mined by the Lowry method using a protein assay kit from Bio- Rad (Hercules, CA, USA). One hundred µg of protein were sepa- rated onto 12.5% SDS-PAGE gels followed by transfer to PVDF membrane. Polyclonal anti-stathmin antibody (Calbiochem, San Diego, CA, USA) and monoclonal anti-actin antibody (clone JLA20, Sigma) were used to quantify the proteins of interest by enhanced chemiluminescence detection (ECL, Amersham Phar- macia Biotech, Piscataway, NJ, USA).
Cell cycle analysis DNA content was determined by propidium iodide (PI) staining of fixed cells followed by flow cytometry. The cells were washed two times in PBS, fixed in 100% ethanol at 4ºC overnight, washed twice in 0.5% BSA in PBS, resuspended in 1 mL of staining solution (PBS containing 0.5% BSA, 0.05 mg/mL PI, and 1 mg/mL RNAse), and incubated at 37ºC for 30 minutes. DNA content was analyzed in a FACStar Plus flow cytometer (Becton-Dickinson, Mountain View, CA, USA) at 488 nm single laser excitation. Cell cycle distribution analyses were performed using WinList software (Verity Software House, Topsham, ME, USA).
Proliferation assay Cells were plated at a density of 2 × 104 cells/mL in the presence or absence of staurosporine or TPA at the indicated concentrations. Viable cells were counted daily in a hemocytometer after staining with trypan blue.
Flow cytometry For the detection of surface αIIbβ3 receptor, cells were incubated with the primary monoclonal antibody 10E5 (provided by Dr. B. Coller, Rockefeller University, New York, NY, USA) for 1 hour on ice, washed twice in PBS containing 2% FBS, then incubated with the secondary antibody, FITC-conjugated anti-mouse IgG (Becton-Dickinson, Mountain View, CA, USA). Following two washes in PBS, the cells were analyzed in a FACStar Plus flow cytometer (Becton-Dickinson) and with WinList software (Verity Software House).
Cell sorting Following four days of exposure to 40 nM staurosporine, cells were sorted by size using a MoFlo high-speed cell sorter (Cytoma- tion, Fort Collins, CO, USA). The sorting gates were determined based on the forward scatter (FSC) and the side scatter (SSC)
properties of the cells. The quality of the sorting by size was assessed by measuring DNA content of PI-stained cells and by morphological analysis of Wright-Giemsa–stained cells.
Morphological analysis Cells were cytocentrifuged onto slides, Wright-Giemsa stained, and viewed under a Nikon Eclipse E400 light microscope. The percentage of cells undergoing endomitosis was scored by analyz- ing 300 mitotic figures per experiment. Mitotic cells that contained more than one metaphase plate or multiple groups of chromosomes between the equator and the spindle poles were scored as endomi- totic cells.
Results
Staurosporine induced megakaryocytic differentiation of K562 and HEL cells Human K562 and HEL erythroleukemia cells can be in- duced to differentiate into megakaryocyte-like cells by expo- sure to TPA [28,29]. These megakaryocyte-like cells have an immature phenotype and undergo limited endomitosis resulting in low levels of ploidy [29,30]. We wanted to develop an experimental model for megakaryocyte matura- tion in which cells achieve high levels of ploidy comparable to those of megakaryocytes in vivo. Staurosporine is a micro- bial alkaloid that is a potent inhibitor of protein kinase C [31]. Although staurosporine was previously shown to induce megakaryocytic differentiation of K562 cells at low concentrations, induced cells typically have low levels of ploidy (up to 8N) [30]. To determine if increased concentra- tions of the drug can induce higher levels of ploidy, K562 cells were incubated with increasing concentrations of staur- osporine, ranging from 30 to 100 nM. The DNA content of the induced cells was assessed by flow cytometry during four consecutive days. We found that staurosporine at 40 nM had minimal cytotoxic effects and resulted in efficient poly- ploidization of K562 cells (Fig. 1A). The DNA content of these cells increased progressively from 8N on day 1 to 16N on day 3. A small fraction of cells had a DNA content of 32N at day 4. Since HEL cells in the uninduced state are more megakaryocyte-like than K562 cells [28,32], we predicted that higher levels of ploidy might be achieved in HEL cells following staurosporine induction. When HEL cells were incubated in the presence of 40 nM staurosporine, their DNA content increased progressively from 8N on day 1 to 64N on day 4 (Fig. 1A).
Wright-Giemsa staining of cytospin preparations was performed to analyze the morphology of cells following exposure to staurosporine. In both K562 and HEL cells, ex- posure to staurosporine for three days resulted in an increase in cell size and the appearance of eosinophilic areas in the cytoplasm. Some of the cells developed cytoplasmic exten- sions and the nuclei were large and polylobulated (Fig. 1B). Many of the mitotic cells had multiple metaphase plates and
C. Iancu Rubin et al. /Experimental Hematology 31 (2003) 389–397392
Figure 1. Effect of staurosporine on megakaryocytic differentiation of K562 and HEL cells. (A): K562 and HEL cells were induced (days 1 to 4) with 40 nM staurosporine and their DNA content (2, 4, 8, 16, 32, and 64N) was determined by flow cytometry. (B): Morphology of K562 and HEL cells induced with staurosporine for 3 days and examined by light micros- copy. Cells with megakaryocytic features have polylobulated nuclei, eosino- philic areas in the cytoplasm, and cytoplasmic extensions (arrow heads). An endomitotic cell with multiple groups of segregated chromosomes is shown (vertical arrow). (Original magnification: 500×.)
some were in an anaphase-like stage with multiple groups of segregated chromosomes, suggestive of endomitosis (Fig. 1B).
We also investigated the effect of staurosporine on the acquisition of megakaryocyte-specific markers. K562 and HEL cells were induced with 40 nM staurosporine for three days and analyzed for the expression of surface αIIbβ3 receptor by flow cytometry. As previously reported by Yen et al. [30], exposure of K562 cells to staurosporine re- sulted in marked upregulation of αIIbβ3 expression. How- ever, HEL cells which express high levels of αIIbβ3 in the uninduced state did not increase their level following induc- tion with staurosporine (data not shown). Thus, stauro- sporine-induced K562 and HEL cells provide a good in vitro model for the study of megakaryopoiesis.
Downregulation of stathmin expression in staurosporine induced K562 and HEL cells To assess stathmin mRNA levels in staurosporine-induced cells undergoing polyploidization, Northern blots were performed using total RNA purified from cells exposed to staurosporine from one to four days (Fig. 2A). After one day of induction of K562 cells with staurosporine, stathmin mRNA levels were drastically reduced and remained at very low levels for the next three days. When HEL cells were induced with staurosporine, stathmin mRNA levels were also reduced after one day of treatment and continued to decline over four days to less than half the baseline level. Downregu- lation of stathmin expression following induction of K562 and HEL cells with staurosporine was also confirmed at the protein level by Western blotting (Fig. 2B). To correlate
Figure 2. Stathmin expression in staurosporine-induced K562 and HEL cells. (A): Total RNA (20 µg) isolated from cells induced with 40 nM staurosporine (days 1 to 4) were subjected to Northern blot analysis. Membranes were hybridized with human stathmin and 18S ribosomal cDNA probes and the bands were visualized by autoradiography. (B): 100 µg protein lysate from K562 and HEL cells uninduced (0) or induced () with staurosporine for 3 days were analyzed by Western blotting using an anti-stathmin polyclonal antibody. Anti-actin monoclonal antibodies were used as a control for protein loading.
levels of ploidy with the levels of stathmin mRNA, stauro- sporine-induced cells were analyzed for DNA content by flow cytometry and stathmin mRNA by Northern blotting. The percentage of induced cells that were polyploid was calculated from DNA histograms as the fraction of cells with a DNA content greater than 4N. In uninduced K562 and HEL cells, the fraction of polyploid cells was low and stathmin levels were high (Fig. 3). As the fraction of polyploid cells increased, stathmin mRNA levels decreased, demonstrating an inverse correlation between ploidy and stathmin expres- sion. To determine whether stathmin expression was reduced
Figure 3. Relationship between stathmin mRNA expression and polyploidy in K562 and HEL cells. Aliquots of uninduced (day 0) or staurosporine- induced (days 1 to 4) cells were analyzed for stathmin mRNA expression and DNA content. Relative levels of stathmin mRNA expression (stippled bars) were quantified using NIH image software, normalized to the level of 18S ribosomal mRNA, and plotted on the left y-axis. The percent of polyploid cells (solid bars) was calculated from the DNA histograms as the fraction of cells with a DNA content greater than 4N and plotted on the right y-axis.
C. Iancu Rubin et al. /Experimental Hematology 31 (2003) 389–397 393
in the polyploid fraction, we sorted staurosporine-induced K562 cells by size and compared stathmin expression in two populations of cells with different size and DNA content. Thus, a population of cells with normal DNA content (i.e., 2N–4N) and another population with polyploid DNA content (i.e., 8N and greater) were sorted and designated P1 and P2, respectively (Fig. 4). Morphological analysis of these cells confirmed that the P1 population consisted of small, mono- nucleated cells while the P2 population consisted of large cells with polylobulated nuclei. Of interest, cells in both populations expressed the αIIbβ3 surface marker at similar levels. S1 nuclease protection assays were performed on RNA isolated from these two populations. As illustrated in the autoradiograph in Figure 4, stathmin mRNA level in the pop- ulation with polyploid DNA content was markedly lower than that in the population with 2N–4N DNA content.
Downregulation of…
Camelia Iancu Rubin, Deborah L. French, and George F. Atweh Division of Hematology, Mount Sinai School of Medicine, New York, NY, USA
(Received 21 October 2002; revised 23 January 2003; accepted 4 February 2003)
Objective. Megakaryopoiesis is characterized by two major processes, acquisition of lineage- specific markers and polyploidization. Polyploidy is a result of endomitosis, a process that is characterized by continued DNA replication in the presence of abortive mitosis. Stathmin is a major microtubule-regulatory protein that plays an important role in the regulation of the mitotic spindle. Our previous studies had shown that inhibition of stathmin expression in human leukemia cells results in the assembly of atypical mitotic spindles and abnormal exit from mitosis. We hypothesized that the absence of stathmin expression in megakaryocytes might be important for their abortive mitosis.
Materials and Methods. The experimental models that we used were human K562 and HEL cell lines that can be induced to undergo megakaryocytic differentiation and primary murine megakaryocytes generated by in vitro culture of bone marrow cells. The megakaryocytic phenotype was evaluated by flow cytometry and light microscopy. The DNA content (ploidy) was analyzed by flow cytometry. Stathmin expression was analyzed by Western and Northern blotting and by RT-PCR.
Results. Our studies showed an inverse correlation between the level of ploidy and the level of stathmin expression in megakaryocytic cell lines and in primary cells. More importantly, inhibition of stathmin expression in K562 cells enhanced the propensity of these cells to undergo endomitosis and to become polyploid upon induction of megakaryocytic differentiation. In contrast, inhibition of stathmin expression interfered with the ability of the cells to acquire megakaryocyte-specific markers of differentiation.
Conclusion. Based on these observations, we propose a model of megakaryopoiesis in which stathmin expression is necessary for the proliferation and differentiation of early megakary- oblasts and its suppression in the later stages of megakaryocytic maturation is necessary for polyploidization. 2003 International Society for Experimental Hematology. Published by Elsevier Science Inc.
Megakaryopoiesis is a complex process that consists of cellular proliferation and acquisition of specific markers of differentiation in the early stages of megakaryocyte devel- opment [1]. This is followed by progressive polyploidization and further acquisition of lineage-specific markers in the later stages of megakaryopoiesis [1]. Polyploidization is a unique feature of megakaryocytes in which repeated rounds of DNA replication occur without concomitant cell division [2]. The ploidy of megakaryocytes increases progressively from 8N up to 128N. A direct correlation between DNA content, megakaryocyte size, and platelet production has
Offprint requests to: George F. Atweh, M.D., Division of Hematology, Box 1079, Mount Sinai School of Medicine, One Gustave Levy Place, New York, NY 10029; E-mail: [email protected]
0301-472X/03 $–see front matter. Copyright 2003 International Society for Experimental Hematology. Published by Elsevier Science Inc. doi: 10.1016/S0301-472X(03)00043-2
been demonstrated [3,4]. Megakaryocytes with high levels of ploidy release more platelets than those with lower ploidy. Alterations in polyploidy in several pathological conditions (i.e., myeloproliferative disorders and myelofibrosis) are as- sociated with either ineffective or excessive platelet produc- tion [5–8]. The process of polyploidization, also known as endomitosis, is a consequence of abortive mitosis which is characterized by the failure of cells to exit mitosis and undergo cytokinesis after completing their DNA synthesis [9,10]. Since the late phases of mitosis and cytokinesis do not take place in megakaryocytes undergoing endomitosis, it was suggested that proteins that are involved in the regula- tion of the mitotic spindle late in mitosis may play a key role in the process of polyploidization [9,10].
Microtubules that make up the mitotic spindle are nor- mally in a state of dynamic equilibrium between phases
C. Iancu Rubin et al. /Experimental Hematology 31 (2003) 389–397390
of polymerization and depolymerization [11,12]. Stathmin, also known as oncoprotein 18 or Op18/Stathmin, is a highly conserved cytosolic phosphoprotein that regulates the dynamic equilibrium of microtubules during cell cycle pro- gression by promoting depolymerization [13–17]. When cells enter mitosis, stathmin is inactivated by phosphorylation. This allows microtubules to polymerize and the mitotic spindle to assemble [14,18]. Late in mitosis, stathmin must be reactivated by dephosphorylation for microtubules to de- polymerize and the mitotic spindle to disassemble [18,19]. We had previously shown that inhibition of stathmin ex- pression in leukemic cells results in accumulation of cells in mitosis due to the formation of atypical mitotic spindles and the resulting difficulty in exit from mitosis [20]. As mentioned above, endomitosis in megakaryocytes has been attributed to the formation of an atypical mitotic spindle and inability to exit mitosis. Interestingly, mature megakaryo- cytes and circulating platelets were previously shown to have undetectable levels of stathmin [21,22]. Thus, we hypoth- esized that downregulation of stathmin expression in mega- karyocytes undergoing DNA synthesis may be important for polyploidization. We investigated the potential role of stathmin in megakaryopoiesis both in human megakaryo- cytic cell lines and in primary murine megakaryocytes. Based on the studies described below, we propose a model in which stathmin expression in the early stages of megakar- yopoiesis may be important for cell proliferation and dif- ferentiation while its suppression in the later stages may be important for polyploidization.
Materials and methods
Cell lines HEL and K562 human erythroleukemia cell lines were grown in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 100 units/mL penicillin, and 100 µg/mL streptomycin at 37ºC in a humidified 5% CO2 incubator. Control K562 cells (K562.C) and stathmin-inhibited K562 cells (K562.AS) were pre- viously described [23]. Briefly, the cells were transfected with an expression vector containing the complete transcription unit for a mutant form of dihydrofolate reductase (DHFR) that has a low affinity for methotrexate. The stathmin-inhibited K562.AS cells were generated by transfecting an expression construct containing full-length stathmin cDNA in an antisense orientation relative to an SV40 promoter. The antisense stathmin cDNA sequences were coamplified with the DHFR sequences by exposing the transfected cells to 1 µM methotrexate (MTX) [23]. The control K562.C cells were transfected with an expression construct without the stathmin cDNA. All experiments described in this report were per- formed with cells in the logarithmic phase of growth (0.5–1 × 105
cells/mL).
Reagents Staurosporine and phorbol ester (TPA, 12-O-tetradecanoylphorbol- 13-acetate) were purchased from Sigma (St. Louis, MO, USA) and dissolved in dimethylsulfoxide at 21.4 × 105 M and 1.6 × 105
M, respectively, and stored at 20ºC. Working solutions were prepared in RPMI medium and added to the cell culture media at the specified concentrations.
Murine megakaryocyte cultures Murine bone marrow cells were harvested by flushing femurs and tibias of 9- to 12-week-old C57BL16 female mice with Iscove’s modified Dulbecco’s medium (IMDM). Red cells were lysed by incubation for 10 minutes at room temperature in hypotonic buffer (150 mM NaCl, 10 mM NaHCO3, 100 mM EDTA). After two washes in phosphate-buffered saline (PBS) containing 2% FBS, cells were plated at a density of 1 × 106/mL in 6-well tissue culture plates in IMDM supplemented with 1% penicillin/streptomycin, 1% L-glutamine, 5 × 105 M β-mercaptoethanol, 1% bovine serum albumin (BSA) Fraction V (Sigma, St. Louis, MO, USA), 30% serum substitute BIT 9500 (Stem Cell Technologies, Vancouver, BC, Canada), 10 ng/mL mouse thrombopoietin (TPO) (R&D Sys- tems, Minneapolis, MN, USA), 10 ng/mL mouse interleukin (IL)- 11 (R&D Systems), and 10 ng/mL human IL-6 (R&D Systems). The tissue culture plates were incubated at 37ºC in a humidified 5% CO2 incubator for six to seven days. Megakaryocytes were isolated on a discontinuous BSA density gradient (0%, 1.5%, 3.0% in PBS) [24]. Nonadherent cells were harvested, centrifuged (1000 rpm, 5 minutes), resuspended in 2 mL PBS, and overlaid on the discontinu- ous BSA gradient. After 30 to 45 minutes, the cells that settled at the bottom of the tube by gravity were harvested separately from those found in the 3% BSA gradient. The two fractions were washed once in PBS and their phenotype analyzed by morphology and cell surface marker expression. Cytospin preparations were stained with the Wright-Giemsa stain or an acetylcholinesterase stain [25]. Flow cytometry was performed for detection of surface αIIbβ3 receptors using a FITC-conjugated anti-mouse CD41 monoclonal antibody (BD Pharmingen, San Diego, CA, USA).
Isolation of murine platelets Citrated whole blood was diluted in PBS (1:2) and mononuclear cells were isolated on a Ficoll density gradient (1.077 g/mL) (Accu- rate Chemical & Scientific Corporation, Westbury, NY, USA). The platelet-rich fraction was concentrated by centrifugation at 1300 rpm for 2 minutes at room temperature.
RNA quantification Total RNA was purified using the guanidine isothiocyanate–based TRIzol reagent (Gibco BRL, Rockville, MD, USA). For Northern blotting, 20 µg RNA were fractionated by electrophoresis under glyoxal denaturing conditions and transferred to nylon membranes. Membranes were hybridized with 32P-labeled 1.2-kb EcoR V/Xba I fragment of human stathmin [26] and 18S ribosomal cDNA probes. The levels of mRNA were quantified using NIH (National Institutes of Health) image software. For S1 nuclease protection assays, 5 µg RNA were analyzed for stathmin expression as de- scribed [23]. For reverse transcriptase polymerase chain reaction (RT-PCR) analysis, 500 ng of total RNA were used for cDNA synthesis using the Cells-to-cDNA kit (Ambion, Austin, TX, USA). One-tenth of the cDNA mixture was used for PCR amplification using oligonucleotide primers specific for mouse stathmin [27], sense: 5′ TCCAGGTGAAAGAGCTGGAG 3′ and antisense: 5′ ACCTCTTCCACGTGCTTGTC 3′, and oligonucleotide primers specific for 18S ribosomal DNA purchased from the manufacturer
C. Iancu Rubin et al. /Experimental Hematology 31 (2003) 389–397 391
(Ambion). For the PCR reaction, the DNA was mixed with 1× PCR reaction buffer (PE Applied Biosystems, Foster City, CA, USA), 2 mM MgCl2, 0.2 mM dNTP, 0.2 µM each primer, and 1.25 units Taq DNA polymerase (AmpliTaq) (PE Applied Biosystems) in a total volume of 50 µL. The reaction tubes were preheated to 94ºC for 5 minutes, followed by successive rounds of denaturation at 94ºC for 1 minute, annealing at 59ºC for 1 minute, and extension at 72ºC for 1 minute for 23 cycles, with a final extension time of 10 minutes at 72ºC. Samples were analyzed on agarose gels containing ethidium bromide, transferred to a nylon membrane, and probed with P32-labeled EcoR V/Xba I fragment of human stathmin cDNA.
Protein quantification Cells were lysed (50 mM Tris-Cl, 15 mM NaCl, 1% Triton-X, 40 mg/mL protease inhibitor cocktail [Roche Molecular Biochemicals, Indianapolis, IN, USA]) and protein concentrations were deter- mined by the Lowry method using a protein assay kit from Bio- Rad (Hercules, CA, USA). One hundred µg of protein were sepa- rated onto 12.5% SDS-PAGE gels followed by transfer to PVDF membrane. Polyclonal anti-stathmin antibody (Calbiochem, San Diego, CA, USA) and monoclonal anti-actin antibody (clone JLA20, Sigma) were used to quantify the proteins of interest by enhanced chemiluminescence detection (ECL, Amersham Phar- macia Biotech, Piscataway, NJ, USA).
Cell cycle analysis DNA content was determined by propidium iodide (PI) staining of fixed cells followed by flow cytometry. The cells were washed two times in PBS, fixed in 100% ethanol at 4ºC overnight, washed twice in 0.5% BSA in PBS, resuspended in 1 mL of staining solution (PBS containing 0.5% BSA, 0.05 mg/mL PI, and 1 mg/mL RNAse), and incubated at 37ºC for 30 minutes. DNA content was analyzed in a FACStar Plus flow cytometer (Becton-Dickinson, Mountain View, CA, USA) at 488 nm single laser excitation. Cell cycle distribution analyses were performed using WinList software (Verity Software House, Topsham, ME, USA).
Proliferation assay Cells were plated at a density of 2 × 104 cells/mL in the presence or absence of staurosporine or TPA at the indicated concentrations. Viable cells were counted daily in a hemocytometer after staining with trypan blue.
Flow cytometry For the detection of surface αIIbβ3 receptor, cells were incubated with the primary monoclonal antibody 10E5 (provided by Dr. B. Coller, Rockefeller University, New York, NY, USA) for 1 hour on ice, washed twice in PBS containing 2% FBS, then incubated with the secondary antibody, FITC-conjugated anti-mouse IgG (Becton-Dickinson, Mountain View, CA, USA). Following two washes in PBS, the cells were analyzed in a FACStar Plus flow cytometer (Becton-Dickinson) and with WinList software (Verity Software House).
Cell sorting Following four days of exposure to 40 nM staurosporine, cells were sorted by size using a MoFlo high-speed cell sorter (Cytoma- tion, Fort Collins, CO, USA). The sorting gates were determined based on the forward scatter (FSC) and the side scatter (SSC)
properties of the cells. The quality of the sorting by size was assessed by measuring DNA content of PI-stained cells and by morphological analysis of Wright-Giemsa–stained cells.
Morphological analysis Cells were cytocentrifuged onto slides, Wright-Giemsa stained, and viewed under a Nikon Eclipse E400 light microscope. The percentage of cells undergoing endomitosis was scored by analyz- ing 300 mitotic figures per experiment. Mitotic cells that contained more than one metaphase plate or multiple groups of chromosomes between the equator and the spindle poles were scored as endomi- totic cells.
Results
Staurosporine induced megakaryocytic differentiation of K562 and HEL cells Human K562 and HEL erythroleukemia cells can be in- duced to differentiate into megakaryocyte-like cells by expo- sure to TPA [28,29]. These megakaryocyte-like cells have an immature phenotype and undergo limited endomitosis resulting in low levels of ploidy [29,30]. We wanted to develop an experimental model for megakaryocyte matura- tion in which cells achieve high levels of ploidy comparable to those of megakaryocytes in vivo. Staurosporine is a micro- bial alkaloid that is a potent inhibitor of protein kinase C [31]. Although staurosporine was previously shown to induce megakaryocytic differentiation of K562 cells at low concentrations, induced cells typically have low levels of ploidy (up to 8N) [30]. To determine if increased concentra- tions of the drug can induce higher levels of ploidy, K562 cells were incubated with increasing concentrations of staur- osporine, ranging from 30 to 100 nM. The DNA content of the induced cells was assessed by flow cytometry during four consecutive days. We found that staurosporine at 40 nM had minimal cytotoxic effects and resulted in efficient poly- ploidization of K562 cells (Fig. 1A). The DNA content of these cells increased progressively from 8N on day 1 to 16N on day 3. A small fraction of cells had a DNA content of 32N at day 4. Since HEL cells in the uninduced state are more megakaryocyte-like than K562 cells [28,32], we predicted that higher levels of ploidy might be achieved in HEL cells following staurosporine induction. When HEL cells were incubated in the presence of 40 nM staurosporine, their DNA content increased progressively from 8N on day 1 to 64N on day 4 (Fig. 1A).
Wright-Giemsa staining of cytospin preparations was performed to analyze the morphology of cells following exposure to staurosporine. In both K562 and HEL cells, ex- posure to staurosporine for three days resulted in an increase in cell size and the appearance of eosinophilic areas in the cytoplasm. Some of the cells developed cytoplasmic exten- sions and the nuclei were large and polylobulated (Fig. 1B). Many of the mitotic cells had multiple metaphase plates and
C. Iancu Rubin et al. /Experimental Hematology 31 (2003) 389–397392
Figure 1. Effect of staurosporine on megakaryocytic differentiation of K562 and HEL cells. (A): K562 and HEL cells were induced (days 1 to 4) with 40 nM staurosporine and their DNA content (2, 4, 8, 16, 32, and 64N) was determined by flow cytometry. (B): Morphology of K562 and HEL cells induced with staurosporine for 3 days and examined by light micros- copy. Cells with megakaryocytic features have polylobulated nuclei, eosino- philic areas in the cytoplasm, and cytoplasmic extensions (arrow heads). An endomitotic cell with multiple groups of segregated chromosomes is shown (vertical arrow). (Original magnification: 500×.)
some were in an anaphase-like stage with multiple groups of segregated chromosomes, suggestive of endomitosis (Fig. 1B).
We also investigated the effect of staurosporine on the acquisition of megakaryocyte-specific markers. K562 and HEL cells were induced with 40 nM staurosporine for three days and analyzed for the expression of surface αIIbβ3 receptor by flow cytometry. As previously reported by Yen et al. [30], exposure of K562 cells to staurosporine re- sulted in marked upregulation of αIIbβ3 expression. How- ever, HEL cells which express high levels of αIIbβ3 in the uninduced state did not increase their level following induc- tion with staurosporine (data not shown). Thus, stauro- sporine-induced K562 and HEL cells provide a good in vitro model for the study of megakaryopoiesis.
Downregulation of stathmin expression in staurosporine induced K562 and HEL cells To assess stathmin mRNA levels in staurosporine-induced cells undergoing polyploidization, Northern blots were performed using total RNA purified from cells exposed to staurosporine from one to four days (Fig. 2A). After one day of induction of K562 cells with staurosporine, stathmin mRNA levels were drastically reduced and remained at very low levels for the next three days. When HEL cells were induced with staurosporine, stathmin mRNA levels were also reduced after one day of treatment and continued to decline over four days to less than half the baseline level. Downregu- lation of stathmin expression following induction of K562 and HEL cells with staurosporine was also confirmed at the protein level by Western blotting (Fig. 2B). To correlate
Figure 2. Stathmin expression in staurosporine-induced K562 and HEL cells. (A): Total RNA (20 µg) isolated from cells induced with 40 nM staurosporine (days 1 to 4) were subjected to Northern blot analysis. Membranes were hybridized with human stathmin and 18S ribosomal cDNA probes and the bands were visualized by autoradiography. (B): 100 µg protein lysate from K562 and HEL cells uninduced (0) or induced () with staurosporine for 3 days were analyzed by Western blotting using an anti-stathmin polyclonal antibody. Anti-actin monoclonal antibodies were used as a control for protein loading.
levels of ploidy with the levels of stathmin mRNA, stauro- sporine-induced cells were analyzed for DNA content by flow cytometry and stathmin mRNA by Northern blotting. The percentage of induced cells that were polyploid was calculated from DNA histograms as the fraction of cells with a DNA content greater than 4N. In uninduced K562 and HEL cells, the fraction of polyploid cells was low and stathmin levels were high (Fig. 3). As the fraction of polyploid cells increased, stathmin mRNA levels decreased, demonstrating an inverse correlation between ploidy and stathmin expres- sion. To determine whether stathmin expression was reduced
Figure 3. Relationship between stathmin mRNA expression and polyploidy in K562 and HEL cells. Aliquots of uninduced (day 0) or staurosporine- induced (days 1 to 4) cells were analyzed for stathmin mRNA expression and DNA content. Relative levels of stathmin mRNA expression (stippled bars) were quantified using NIH image software, normalized to the level of 18S ribosomal mRNA, and plotted on the left y-axis. The percent of polyploid cells (solid bars) was calculated from the DNA histograms as the fraction of cells with a DNA content greater than 4N and plotted on the right y-axis.
C. Iancu Rubin et al. /Experimental Hematology 31 (2003) 389–397 393
in the polyploid fraction, we sorted staurosporine-induced K562 cells by size and compared stathmin expression in two populations of cells with different size and DNA content. Thus, a population of cells with normal DNA content (i.e., 2N–4N) and another population with polyploid DNA content (i.e., 8N and greater) were sorted and designated P1 and P2, respectively (Fig. 4). Morphological analysis of these cells confirmed that the P1 population consisted of small, mono- nucleated cells while the P2 population consisted of large cells with polylobulated nuclei. Of interest, cells in both populations expressed the αIIbβ3 surface marker at similar levels. S1 nuclease protection assays were performed on RNA isolated from these two populations. As illustrated in the autoradiograph in Figure 4, stathmin mRNA level in the pop- ulation with polyploid DNA content was markedly lower than that in the population with 2N–4N DNA content.
Downregulation of…
Related Documents
