Top Banner
HOLY MASSES Sunday 7:30 AM and 10:00 AM Wednesday, Thursday, Friday 8:00 AM Saturday 4:30 PM HOLY DAYS OF OBLIGATION Please consult the bulletin. SACRAMENT OF MATRIMONY Please contact parish priest 9 months in advance before making any other wedding plans. Rectory: 603 745 2266 Email: [email protected] Website: www.stjosephlincoln.org Office Hours: Monday, Tuesday and Wednesday 9am-2pm. St. Joseph Church Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond P.O. Box 128, Church Street, Lincoln, NH 03251 Our Parish Mission Statement Centered in the living presence of Jesus in the Eucharist, we, the Parishioners of St. Joseph’s Catholic Church, are a welcoming Catholic Community. Guided by the Holy Spirit and inspired by the Word of God, we are committed to the spiritual growth and faith formation of all the community. We come together under Christ, our Lord, His Blessed Mother Mary, and our Patron Saint Joseph to promote the truths of our faith, to sanctify them through the sacraments, and to serve our loving God and one another through worship, witness, and works of charity. Welcome to our loving community of faith! “Your church away from home” PASTOR: REV. JOHN J. MAHONEY, Jr., MA, MDiv, JCL, LCMHC, MLADC BAPTISMS Call for an appointment at your convenience. CONFESSION Saturday 3:50-4:20 PM
6

St. Joseph Church - jppc.netSt. Joseph Church Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond P.O. Box 128, Church Street, Lincoln, NH 03251

Jul 13, 2020

Download

Documents

dariahiddleston
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: St. Joseph Church - jppc.netSt. Joseph Church Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond P.O. Box 128, Church Street, Lincoln, NH 03251

HOLY MASSES Sunday 7:30 AM and 10:00 AM Wednesday, Thursday, Friday 8:00 AM Saturday 4:30 PM

HOLY DAYS OF OBLIGATION Please consult the bulletin.

SACRAMENT OF MATRIMONY Please contact parish priest 9 months in advance before making any other wedding plans.

Rectory: 603 745 2266 Email: [email protected] Website: www.stjosephlincoln.org

Office Hours: Monday, Tuesday and Wednesday 9am-2pm.

St. Joseph Church

Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond

P.O. Box 128, Church Street, Lincoln, NH 03251

Our Parish Mission Statement

Centered in the living presence of Jesus in the Eucharist, we, the Parishioners of St. Joseph’s Catholic Church, are a welcoming Catholic Community. Guided by the Holy Spirit and inspired by the Word of God, we are committed to the spiritual growth and faith formation of all the community. We come together under Christ, our Lord, His Blessed Mother Mary, and our Patron Saint Joseph to promote the truths of our faith, to sanctify them through the sacraments, and to serve our loving God and one another through worship, witness, and works of charity.

Welcome to our loving community of faith!

“Your church away from home”

PASTOR: REV. JOHN J. MAHONEY, Jr., MA, MDiv, JCL, LCMHC, MLADC

BAPTISMS Call for an appointment at your convenience.

CONFESSION Saturday 3:50-4:20 PM

Page 2: St. Joseph Church - jppc.netSt. Joseph Church Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond P.O. Box 128, Church Street, Lincoln, NH 03251

21ST SUNDAY IN ORDINARY TIME AUGUST 23, 2020

Pastoral Staff and Volunteers

Pastor Rev. John J. Mahoney, Jr., JCL, LCMHC, MLADC [email protected] Office Manager Maria Schirduan

Office Aid Nancy Sweeney

Finance Committee Christopher Thompson, Chairman Marty Nastasia Fred Mehrmann Margaret Sweeney

Pastoral Council Paula King, Chairperson Delia Sullivan Annie Anderson David Paradis Betty Webster Millie Berry Eddie Rush Michael Iarocci Nancy Sweeney Maria Schirduan

Coordinator of Adoration Susan Whitman 603 745 3331

Coordinator of Faith Formation Paula King 603 348 8166 [email protected]

Wedding Coordinator Delia Sullivan [email protected]

Music Ministry Margaret Sweeney [email protected]

The Parish Knights of Columbus Peter Eisenhauer, Grand Knight [email protected] P.O. Box 733, Lincoln, NH 03251

Bereavement Committee Director Betty Webster 603 728 6010

Coordinator of Homebound Visits Nancy Sweeney 603-745-5611

Welcome

St. Joseph’s Church extends a warm welcome to

all who are visiting. May God Bless you in your

travels and guide you safely home. We hope you

will make our church your church away from

home. We look forward to celebrating Mass with

you again.

Holy Mass schedule:

Sunday 7:30AM and 10:00AM Wednesday, Thursday, Friday 8:00AM Saturday 4:30PM

Please keep 6 ft apart from your fellow parishioners

and visitors at all times. Masks are required.

If you are experiencing or experienced in the past 14 days

fever; OR sore throat, cough, or shortness of breath; OR change in sense of smell or taste; OR if you travelled outside of the U.S.; OR outside of New England (NH, VT, ME, MA, RI or CT) in the past 14 days; OR if you have been in close contact with someone suspected or confirmed to have Covid-19 in the past 14 days

please DO NOT ENTER. (Healthcare workers caring for Covid-19 patients while wearing

appropriate personal protective equipment can attend.)

Links to online streaming Masses:

EWTN (Eternal Word Television Network)

Daily Mass with Bishop Robert Barron

Www.stlawrencegoffstown.org (Please check out weekly streamed Masses)

http://www.catholictv.org/masses/notre-dame-mass (Sunday Mass)

http://www.catholictv.org/masses/catholictv-mass (Daily Mass)

https://www.ourladyofthemountainsnh.org/

https://strosehomilies.org (St. Rose of Lima masses are also televised on youtube.com )

https://adw.org/parishes-masses/sunday-tv-mass/

https://saltandlighttv.org/thesundaymass/

Page 3: St. Joseph Church - jppc.netSt. Joseph Church Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond P.O. Box 128, Church Street, Lincoln, NH 03251

21ST SUNDAY IN ORDINARY TIME AUGUST 23, 2020

Saturday, August 22 4:30 PM Mary Jane & Clement Comesana Sr. By Ronnie Comesana Sunday, August 23 7:30 AM For the Intentions of all Parishioners 10:00 AM Robert & Marianne Loranger By Margaret & Doug Sweeney Wednesday, August 26 8:00 AM Lt. John Roche Nancy Sweeney Thursday, August 27 8:00 AM Patricia Benza By her husband Buz Benza Friday, August 28 8:00 AM Barbara Marion Hadley By Shelley Thompson Saturday, August 29 4:30 PM Mary Jane & Clement Comesana Sr. By Ronnie Comesana Sunday, August 30 7:30 AM For the Intentions of all Parishioners 10:00 AM Violet Christine Schirduan (Living) By her mom

Monday: Rv 21:9b-14; Ps 145:10-11, 12-13, 17-18; Jn 1:45-51 Tuesday: 2 Thes 2:1-3a, 14-17; Ps 96:10, 11-12, 13; Mt 23:23-26 Wednesday: 2 Thes 3:6-10, 16-18; Ps 128:1-2, 4-5; Mt 23:27-32 Thursday: 1 Cor 1:1-9; Ps 145:2-3, 4-5, 6-7; Mt 24:42-51 Friday: 1 Cor 1:17-25; Ps 33:1-2, 4-5, 10-11; Mt 25:1-13 Saturday: 1 Cor 1:26-31; Ps 33:12-13, 18-19, 20-21; Mk 6:17-29 Sunday: Jer 20:7-9; Ps 63:2, 3-4, 5-6, 8-9; Rom 12:1-2; Mt 16:21-27

Week of August 23, 2020

Reading I: Isaiah 22: 19-23 The prophet denounces Shebna, a high court official, for obstructing his message. Then Isaiah chooses Eliakim to succeed Shebna. He gives Eliakim “the key” for entrance to the royal presence, a badge of his newfound authority. Reading II: Romans 11: 33-36 Paul composes a hymn of admiration and thanksgiving for God’s amazing providence. God is nobody’s debtor. Nor does He need consultants before acting. Paul ends the section with a doxology. The Gospel: Matthew 16: 13-20 Against the backdrop of the sophisticated, mostly Gentile city built by tetrarch Philip to honor Caesar, Jesus conducts “an opinion poll” of His chosen disciples. Simon Peter (retaining here part of his old name) confesses the right response to Jesus’ question, and receives both praise and “the keys” to the kingdom of heaven and all that implies.

Papal Intention for August 2020

The Maritime World

We pray for all those who work and live from the sea,

among them sailors, fishermen and their

families.

Page 4: St. Joseph Church - jppc.netSt. Joseph Church Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond P.O. Box 128, Church Street, Lincoln, NH 03251

21ST SUNDAY IN ORDINARY TIME AUGUST 23, 2020

941

“ Who has known the mind of the Lord?”

Through prayer our minds become better aligned with the mind of Christ and His will for us. If the Spirit is prompting you to know Christ as a priest, or in the consecrated life, Call Father Matthew Mason 663-0196, or write: [email protected]

By Carlos Martín Cinto, LCMHC, Catholic Charities NH: Being quarantined, I recently received a beautiful video through WhatsApp that started something like this: “There is an annual plant originally from Peru that for her to mature seeks to have the sun in front.” It came with beautiful photos of its flower, which is a great dish, with very colorful colors, and which produces the famous sunflower pipes and its oil. The interesting thing is that its flower, like a huge satellite dish, follows the sun daily on its way east to west. And the next morning she’s waiting for him again on its way out on the east. In Greek mythology, a nymph named Clytie followed the god Apollo daily from his palace to the west. She took root, turned into a sunflower, and thus follows his love every day. Very nice, isn’t it? But right away, the impertinent question arises: what happens when it’s cloudy? It is said that the sunflower turns to their neighbor and they look at each other face-to-face. The love and energy they cannot receive from the sun are given and received by each other, teaching us in passing the importance of loving each other. I count this because while it is true that COVID-19 is like a gigantic cloud that has isolated us from our source of life, so it is that the sunflower taught me that if we don’t have our usual life – if we can’t be in the sun – we have each other to remain being until it is camped. This pandemic, like a tremendous cloud, separates us from our routine and separates (or modifies) us from our work so that we are alone, behind a mask and with gloves so as not to touch us. In a way, he locks us up at home and forbids us from the street. For our sake, they tell us, but we find it hard to understand. And it does so on a planetary level. But it is in that lockdown, within that loneliness, that I decided to find others, connect with the members of my tribe. Because we humans are one tribe, no matter how hard it is for us to speak English and to them to speak Spanish. And to all speak Chinese, except to the Chinese. The differences seem huge, but they are of clothing, of the secondary. When the virus attacks, it attacks humanity, which we are all. And as a single organism, we respond, isolating ourselves in therapeutic quarantines. And that’s why we must imitate the sunflower and seek the face, love and energy of others and God.

Please Pray for the Sick Lynn Henningsen, Marie Corbeil, Tara Lydon, Amy Maki, Arnold Parker, Louise Sewell, Darlene Pitcher, Evelyn Crisp Decker, Johnny Pironti, Laurie Mason, Anne Paino, Lynn Wiley, Marion Cloutier, Gillie Bossie, Patty Papio, Charlie Harrington, Maria Araiyo, Tom Sheehan, Merle Richards, Marty Tarnok, Declan Peters, Jack & Martha Lynch, Judy Germaine, Gary Cox, Ed Peterson, Krissy Thompson, Tom Sherbinski, Elaine Eisenhauer, Edward Pieroni. To add or remove a person please call the rectory.

Cont. by C. M. Cinto, LCMHC: And for that, I have used and used as many resources as I can. I use the phone, use video calls, books, music, letters that today are emails or messages and social networks. And I grow and grow with those, with my people and with those who are added on the way, on this journey forced by the tremendous cloud, but which we guess will soon end. And then I will be as before, and very grateful for such good company, that has allowed me to spend this fear, endure this loneliness and remain being me, while the sun was hidden. Hispanics who are in the United States, seek the warmth, energy and love of others. And there’s no better way than to emulate a sunflower.

Wedding Banns Margaret Aranyosi

And Justin LaBarge

Are getting married

September 12, 2020.

Page 5: St. Joseph Church - jppc.netSt. Joseph Church Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond P.O. Box 128, Church Street, Lincoln, NH 03251

941 St. Joseph Church, Lincoln, NH (I) John Patrick Publishing Company • (800) 333-3166 • www.jppc.net

Warm and Inviting AtmosphereINNOVATIVE LUNCH& DINNER ENTREES

Salads • Homemade DessertsOutdoor Patio

GypsyCafeRestaurant.com603-745-4395

117 Main St. Lincoln

www.polimenorealty.comA Full Service Community

Real Estate CompanyMaureen Polimeno

Managing Broker137 Main St., N.Woodstock, NH

(603) 745-8289

Rosaries From Flowers“Handmade from the Flowers

of your Loved One”

841 MAIN STREETTEWKSBURY, MA 01876

www.rosariesfromfl owers.com(978) 851-9103

24 HR. EMERGENCY SVC.MASTER PLUMBER #5003

MDW PLUMBING & HEATING LLC

603-745-7055

B U I L DB U I L DY O U R Y O U R

C O M M U N I T YC O M M U N I T Y- Shop Local -

P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !P A T R O N I Z E T H E A D V E R T I S E R S W H O M A K E T H I S B U L L E T I N P O S S I B L E !

Mallory’s Army FoundationUnited Together In The Fight Against Bullying...

Don’t Just Teach Kindness... BE KINDNESS!www.MallorysArmy.com

(973) 440-8657 [email protected]

It’s easy to join our mailing list! Just send your email address by text message:

Text MALLORYSARMY to 22828 to get started.

Message and data rates may apply.

What’s My Name?The #WHATSMYNAME Movement asks everyone to simply ask drivers “What’s my name?” before entering

their vehicle to make sure it is the car they are supposed to enter.

In Remembrance of Samantha Josephson

#WHATSMYNAME

Specializing in the White Mountains & Surrounding Towns

Our Interactive Map Search allows you to view properties on a map or refi ne your search by drawing the boundaries around

the area you desire. Click on our easy to use website: www.riverstonerealtynh.com

Considering selling or refi nancing your home? Get an INSTANT property valuation now!Contact us today to fi nd out how we can be of assistance to you!

Mike Huff , Principal Broker • Riverstone Realty, LLC773 Tenney Mountain Highway, Plymouth, NH 03264

603-991-3167

Woodstock Building Co.

603-348-3211www.woodstockbuild.com

Local, trusted, proven, effective, supportive, referrals, relationships, affordable, repetitious, versatile, lasting.

This describes the power of...

Placing an ad in the parish bulletin supports the parish while building your business - THAT’S A WIN WIN!

Call 1.800.333.3166 TODAY!

Page 6: St. Joseph Church - jppc.netSt. Joseph Church Serving communities of Lincoln, Woodstock, North Woodstock, Thornton, Campton and beyond P.O. Box 128, Church Street, Lincoln, NH 03251

941 St. Joseph Church, Lincoln, NH (B) John Patrick Publishing Company • (800) 333-3166 • www.jppc.net

JOIN US FOR SUNDAYBREAKFAST AFTER CHURCH

Woodstock InnRte. 3, Main St.North Woodstock, NH

603-745-3951“The Areas Favorite Neighborhood Bar & Restaurant

New Hampshire’s Premier White Mountain Brewery

&&

Fournier-HaleFuneral Home

(603) 745-3925144 Main Street, PO Box 572North Woodstock NH 03262Serving Lincoln - Woodstock

and Surrounding Areas“Commitment to Excellence”

www.fournier-hale.com

Your VacationRental Specialistswww.loonres.com

[email protected]

(800) 745-5666(603) 745-5666

264 Main St. #12, Lincoln, NH

CENTRALCENTRALASPHALT PAVING CO.

COMMERCIAL & RESIDENTIALDRIVEWAYS • PARKING LOTS

Edward Stanley, Owner603-586-4554 • Rt. 2, Jefferson, NH

Call for Free Estimate1-800-287-6007

www.CentralPavingNH.com~ “All Work Guaranteed” ~

603.745.8200DaydreamsHairSalon.com

264 Main St., Depot PlazaLincoln, NH 03251

ORCHARD& Christmas Tree Farm

Rt. 116, No. Haverhill, NH(603)787-6377

Richard & Ann

Fabrizio

Condominium Rentaland Sales

227 Main St.Lincoln, NH 03251

603-745-2230www.nordic-inn.com

alba architects llpINNOVATION FOR THE BUILT ENVIRONMENT

North Woodstock, NHMember

American Institute of Architectspartner / owner

Stuart J. Anderson603.745.4770

albaarchitects.com

227 Main Street, Lincoln, NH 03251

603-745-8866www.thenordicclub.com

664 US Rte. 3 • Exit 33 off 1-93 • Lincoln, NH 03251603-745-8000

Serving Breakfast and Dinner DailyLunch in Season

Daily Specials, Special Holiday MenusLarge Gift Shop • Open Daily from 7AM

Awarded “Best Restaurant in Lincoln Woodstock area” by Best of Chef’s

Best Deli & Butcher ShopWe specialize in made-to-order

SANDWICHES & SUBS173 Main Street

No. Woodstock, NH 03262603-745-8819

www.lincolnwoodstockmarket.com

OPENDAILY

from5A-10P

Auto - Home - Life - Business

Lynne WarrenAgent

603-745-4700264 Main Street

Lincoln, NH (Depot Plaza)www.InsuredByWarren.com

DARLENE KING-JENNINGS

Tel (603) 726-8642 • (603) 726-8941Cell (603) 254-7037

[email protected] Box 1208, 250 Route 49

Campton, NH 03223(At Exit 28 off I-93)

www.kingrealtynh.com

NANCY K. BROWNCERTIFIED FAMILY MEDIATOR

20 WEST PARK STREET SUITE 422

LEBANON, NH 03766

T: (603) 398-2391F: (603) 443-9904

[email protected]

See what color can do for you!

John Patrick Publishing

800-333-3166

to advertise in color, please call us at

Advertise Your Business

Here800-333-3166

ext. 161www.jppc.net

Commercial Rates are at an All Time Low. Contact us today to get a free analysis to see if we can help Save you moneywith your monthly payments on your

commercial property. Multi-Family, Retail, Offi ce Building, Apartment and Condos.

Can close in as little as 45 days! Four season customer service is our top priority.

www.duqfunding.com1650 Market Street - Suite 3600

Philadelphia, PA 19103

CHRYSTAL LAW, P L L C

DEANNE M. CHRYSTAL, Esquire

®

1 Bridge Street, Unit 104, Plymouth, NH 03264

Phone: 603.745.8329 • Fax: [email protected]

Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agri-culture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Workers - Critical Man-ufacturing - Chemical & Hazardous Materials Financial Services - Defense Industrial Base - Commercial Facili-ties Workers - Residential & Shelter Services & Facilities - Hygiene Prod-ucts & Services - Private & Public Healthcare - Law Enforcement, Public Safety - Offi cers & First Responders - Food & Agriculture - Energy Sec-tor - Waste & Waterwaste - Trans-portation & Logistics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & Government Work-ers - Critical Manufacturing - Chemi-cal & Hazardous Materials Financial Service - Private & Public Healthcare - Law Enforcement, Public Safety - Of-fi cers & First Responders - Food & Agriculture - Energy Sector - Waste & Waterwaste - Transportation & Logis-tics - Public Works & - Infrastructure - Communications & Information Technology Workers - Community & G W k C i i l M

To all those essential workers keeping us safe,

yourservice is

invaluable & appreciated.

afety --- OffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOffiOf cercercercercececeFirst Responders - Food & d & d & d &d &d &d &d &d &d d d d d d AgAgAAAAgAgAgAgrAgrAgrAgAgAgrAg

y Sector - WaWaWaWaWaWaWaWaWaWaWaWaWaWaWastestestestestesteteestestestestestestest &Waterwaste - Transportatatatttttttttion ionion ionioionion ioniononion onion & L& L& L& L& L& L& L& Lo& L& L& L& L& & gis

cs - Public Works & - Infrnfrnfrnfrnfrnfrnfnfnfnfnfrnfrnfrnfrnfrastructuucucucucucucuc rCommunications & IIIIIIIIIIIIIIInfornfornfornfornfornfornfornfonfornfornfornfornfornfornformatimammmmmmammmmmm o

echnology Workers - ComComComComComComComComComComComComComComCommunimumumummmmmmm ty &Workers -s -s -s -s -s -s -s -s -s -s --- CriCriCriririririiiiriiticacaticacacaticaticaticaticaticaticaticaticaticatical Ml Ml Ml Ml Ml Ml Ml Ml Ml Ml Mal l Ml M n

acturing - Chemical &&&&&&&&&&&l & l & l &l & HazaHazaHazaHazaHazaHazaHazaHazaHazaHazaHHHH rdourdrdrdrdrdrdrrdrdrdrdncial Services - DDDDDDDDDefeeeeeeefefens

dustrial Base - Commercial Faciles Workerssrssssss - RResidesidesidesidesidesidesidesididesidesidesidesideentientientientientientientientientiential &aaaaaaaa Shelteervices & FFFFFFFFFFFFFFFaciaciacilacilacilacilacilacilacilcilaciacilacilacilacilitieitieitieitieitieitietieitietieitieies -s -s - - - - - HyHyHygiHyHyHyHyHyHyHyHyHH ene Prodcts & Services es esesesesesesesesessss - Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Pr- Priiiiivivivivivivivaivaivativ e & Publiealthcare - Lawawawawawawawawawaw EnfEnfEnfnfnfnffnfnffffffforcorcorcorcorcorcorcorcorcorcorcorceorc ment, Publiafety - Officercercercercerererercercers &&&s &s &s &s &s &s &s &s &s &s &s &s & FiFiFiFFirsFFFFFFFFF t ResponderFood & Agrgrgrgrrrrriculiculiculiculiculiculiculiculiculiculicuiculiculicic turturturturturturureturturturturturtutut - Energy Secr - Waste e eee ee & Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& Wa& ttttterwtttettt aste - Trans

ortation &&&&& & & & & &&&&&& LogiLogiLogiLogiLogiogiogiogiLogiLogLogLogiLogLogLog stististststststisticststststsss s - Public Work- Infrastrtrrrrrrrrrrrrrrucucucucucuctctctuucucucucuctucuc re -e e e ee e CommunicationInformatioatioatioiooooooioooooonnn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Tn Technology Worker

CoCoCoCoCoCoCoCoCoCoCoCoCoCoCommunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunmmunity ity ity ity ity ity ity ity ity ity ity ity ityityity & Go&&&&&&&&&&& vernment Works - CrCrCrCrCrCrCrCrCrCrCrCrCrCrCriticiticiticticiticiticticiticiticticiiticiticiticitical al Mal Mal Mal Mal Mal Mal Mal a anufacturing - Cheml l ll & Ha& Ha& H& H& H& H& H& H& H& H&&&&& zardzardzardzardzardzardardardardardardardzardardardooooooous ooooooo Materials Financia

ervrvrvvvvice ice ice ice ice iceicicice icicicicicic - P- Pr- Pr- P- P- P- P- - - P- - - - ivativaivivvvvvvv e & Public HealthcarLaw EnEEE forcforcforcffforcforcforforcforcforcforceement, Public Safety - O

To all those nforcement, Public Sanforcement, Public Sa

essentiallture - Energylture - EnergyWater aste TraWater aste Tra

workerscs - Public Wors - Public WorCommunicatioCommunicatio

keeping echnology Wochnology Woovernment Wovernment W

us safe,acturing Caterials Finanaterials Finan

yournicationnicationWorkerWorke

service isovernment Workovernment Workacturing Chemacturing Chem

invaluable &us Materials Financiaus Materials Financiae & Public Healthcare & Public Healthcar

ment, Public Safety - OSafety - Othan

k yo

u

g gyWatateatttatatatattaaaaaa rwaswaswawaswwaswwwwaswwaswwwwasswasawawaw ste -tettttttttettee Transportation & Log

cccscccccc - PPPPPPPPPPPPPPPubliubliubliubliublililublibubbliubuubuuubu c c WoWoc WoWWWoWoWoWWoWWWoWc oc WoWWc Woc WWc WWWWccc rks rksrrksrkskrrkkkkrrk & - & -& -&& -&& -&&&&&&& --&&&& -&&& -&&& InfrInfInfrnfrInfInfrnfrII ffI ffInI fnfI fInfnfInnfnfn astructuCCoCoCoCoCoCoCCoCCoCCCCoooCCCCCCC mmunmmunmmmmmmunmm nmmmm nmmmmm nmmmm nnm nm nmmmm nicaticacaticaticatcatcatcatcattcatcatcatcattcatcatcatccacatcccatcc ionsionsionsnsionononsonsiooionssonsonsonsionoonoooon & I&&& I&& I&&& I& II& I& I& I&& nfornfornfornfornfornforforfornfornfoforfnfnfornfornfornfornforfofornfornforrrrnnffforrrmatimatimatmatmatiamatimatmattimatiatitimatiattatmatmatimattattmattmmmati

echhhhhhhhhnolonononoonnoloonolonnoln lonnolonooolonolonolonnnn on oonoo ggy Wgggg orkers - Community

Wedding Invitations Wedding Invitations & Holiday Cards& Holiday Cards

Log onto Log onto www.jppc.netwww.jppc.net conveniently from yourconveniently from your

home or office.home or office.Online Catalog • Online OrderingOnline Catalog • Online Ordering

Online Proo ngOnline Proo ngAll Major Credit Cards AcceptedAll Major Credit Cards AcceptedFREE UPS GROUND SHIPPINGFREE UPS GROUND SHIPPING!