MARCH 22, 2016 \ NEWS + SPORT + PROPERTY GUIDE By Matt Crossman Decision-makers have been urged to take a long-term view, doing more to plan and invest in local jobs and roads, amid revelations that Sunbury has one of the least accessible job markets in Melbourne’s north. A statewide 250-page study by urban planners SGS found jobs are increasingly located in or near the CBD, leading to a widening gulf between those able to afford inner city housing and those forced to take a long and frustrating commute from outer suburbs. Melbourne’s worst social and economic disadvantage is also on these fringes, with higher rates of chronic disease, mental health problems, domestic violence and other crime. Sunbury was rated as having the second-worst access to jobs within a 30-minute radius of the CBD, with only Nillumbik faring poorer. e detailed study will be used by Infrastructure Victoria to rank the state’s most-needed major projects. Sunbury-based Hume councillor Jack Medcraſt said the city-centric nature of modern employment was due to a lack of vision by successive governments in the wake of the collapse of manufacturing. ‘‘e trouble with all governments is they only plan for an election period,’’ he said. ‘‘ey just don’t have the long-term vision of our forefathers.’’ Cr Medcraſt said leaders should plan and invest in projects to tap into what towns like Sunbury already had to offer. ‘‘Look at tourism, all of Sunbury’s history – what Hume has got in its city isn’t really being exploited.’’ Cr Medcraſt said a major Aboriginal arts and culture centre offering guided tours to tourists getting off planes at Melbourne Airport was among ideas worth exploring. Links with China, including closer sister city arrangements, should also be pursued, he said. ‘‘What is happening within the service industry, tourism, technology and IT – they’re the things that are going to be the businesses of tomorrow,’’ he said. ‘‘It can be done. We’ve just got to be a bit smarter.’’ Sunbury Business Association president Michael Osborne wants more proactive planning of employment centres, carparks and roads. ‘‘We’ve got to do more to encourage people to shop locally because that will bring more employers, leading to more local jobs,’’ he said. ‘‘With our projected growth, they’ve gotta start creating the infrastructure now, instead of always playing catch up.’’ Hume council will write to the state government, urging it to build the long- mooted Bulla bypass, aſter a motion moved by Cr Jack Ogilvie last week. e state government has previously said VicRoads has plans to reserve land to link Melbourne Airport and a future outer metro ring road, including a bypass of Bulla. But Cr Ogilvie said that aſter a spate of recent incidents, including at Bulla’s crash-prone bridge, the time to act was now. ‘‘It’s no good looking at it aſter all this growth in 10 years,’’ he said. ‘‘e Macedon Ranges is growing, too, and all that traffic comes past Sunbury.’’ e council has urged motorists to vent their frustrations in the RACV’s outer metropolitan Growing Pains survey before its March 30 deadline. More than 23,000 vehicles use the single-lane road to and from Melbourne Airport daily, with more to come as new housing comes online around the town. Sunbury hurt by no vision Three men from Sunbury and the Macedon Ranges have been recognised for their bravery after putting the safety of others before their own. David Key (pictured) helped rescue four people as a member of a police air wing crew on Black Saturday. Chris Meacham and Lucas Dowson were awarded bravery medals after saving the life of Mr Meacham’s young son in the face of an out-of- control vehicle. All three say they acted on instinct. Mr Key, who was involved in 1500 rescues during a 28-year career, says experience also played a large part in his responses. ‘‘You just concentrate on your job, go back to your training and your drills,’’ he says. ‘‘You tell yourself to focus, stay calm … you can’t be there running around in circles.’’ ■ Stories: page 8 (Luke Hemer) Bravehearts act on instinct
Sunbury & Macedon Ranges Star Weekly Community News 20160322
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
MARCH 22, 2016 \ STARWEEKLY.COM.AU
NEWS + SPORT + PROPERTY GUIDE
By Matt Crossman
Decision-makers have been urged to take a long-term view, doing more to plan and invest in local jobs and roads, amid revelations that Sunbury has one of the least accessible job markets in Melbourne’s north.
A statewide 250-page study by urban planners SGS found jobs are increasingly located in or near the CBD, leading to a widening gulf between those able to a�ord inner city housing and those forced to take a long and frustrating commute from outer suburbs.
Melbourne’s worst social and economic disadvantage is also on these fringes, with higher rates of chronic disease, mental health problems, domestic violence and other crime.
Sunbury was rated as having the second-worst access to jobs within a 30-minute radius of the CBD, with only Nillumbik faring poorer.
�e detailed study will be used by Infrastructure Victoria to rank the state’s most-needed major projects.
Sunbury-based Hume councillor Jack Medcra� said the city-centric nature of modern employment was due to a lack of vision by successive governments in the wake of the collapse of manufacturing.
‘‘�e trouble with all governments is they only plan for an election period,’’ he said. ‘‘�ey just don’t have the long-term vision of our forefathers.’’
Cr Medcra� said leaders should plan and invest in projects to tap into what towns like Sunbury already had to o�er.
‘‘Look at tourism, all of Sunbury’s history – what Hume has got in its city isn’t really being exploited.’’
Cr Medcra� said a major Aboriginal arts and culture centre o�ering guided tours to tourists getting o� planes at
Melbourne Airport was among ideas worth exploring. Links with China, including closer sister city arrangements, should also be pursued, he said.
‘‘What is happening within the service industry, tourism, technology and IT – they’re the things that are going to be the businesses of tomorrow,’’ he said.
‘‘It can be done. We’ve just got to be a bit smarter.’’
Sunbury Business Association president Michael Osborne wants more proactive planning of employment centres, carparks and roads.
‘‘We’ve got to do more to encourage people to shop locally because that will bring more employers, leading to more local jobs,’’ he said.
‘‘With our projected growth, they’ve gotta start creating the infrastructure now, instead of always playing catch up.’’
Hume council will write to the state government, urging it to build the long- mooted Bulla bypass, a�er a motion moved by Cr Jack Ogilvie last week.
�e state government has previously said VicRoads has plans to reserve land to link Melbourne Airport and a future outer metro ring road, including a bypass of Bulla. But Cr Ogilvie said that a�er a spate of recent incidents, including at Bulla’s crash-prone bridge, the time to act was now.
‘‘It’s no good looking at it a�er all this growth in 10 years,’’ he said. ‘‘�e Macedon Ranges is growing, too, and all that tra�c comes past Sunbury.’’
�e council has urged motorists to vent their frustrations in the RACV’s outer metropolitan Growing Pains survey before its March 30 deadline.
More than 23,000 vehicles use the single-lane road to and from Melbourne Airport daily, with more to come as new housing comes online around the town.
Sunbury hurt by no vision
Three men from Sunbury and the Macedon Ranges have been recognised for their bravery after putting the safety of others before their own. David Key (pictured) helped rescue four people as a member of a police air wing crew on Black Saturday. Chris Meacham and Lucas Dowson were awarded bravery medals after saving the life of Mr Meacham’s young son in the face of an out-of- control vehicle. All three say they acted on instinct. Mr Key, who was involved in 1500 rescues during a 28-year career, says experience also played a large part in his responses. ‘‘You just concentrate on your job, go back to your training and your drills,’’ he says. ‘‘You tell yourself to focus, stay calm … you can’t be there running around in circles.’’ ■ Stories: page 8
(Luk
e H
emer
)
Bravehearts act on instinct
\ STARWEEKLY.COM.AU
2 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
STARWEEKLY.COM.AU NEWS
3 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
When experience matters most….....
We know what to do.
For over 75 years the Scott family have been here, guiding and supporting grieving families
www.tjscottandson.com.auwww.tjscottandson.com.au‘Since 1938 Our Family caring for Yours’
1174
378.
-CG
08-1
5
SUNDAY MARKET
THIS SUNDAY27th March8.30am-2pm8.30am-2.00pm
(at historic Trentham railway station)
Variety of stalls and produceVariety of stalls and produceVariety of stalls and produceVariety of stalls and produceVariety of stalls and produceVariety of stalls and produce
NEXT MARKETNEXT MARKET
New stall holders/New stall holders/buskers welcome.buskers welcome.ENQUIRIES:ENQUIRIES:KayeKayeor Leigh5424 1466
1221
473-
AM11
-16
100
3643
8-02
EVERY DAY LOW PRICES(SPECIALS from Monday - Saturday)
Beef & Lamb Australian Grown
AUSTRALIAN FISH AVAILABLESPECIALS
$12.99kg $7.99kg
$12.99kg $6.99kg $8.99kg
Whole Topside $8.99kg
Sliced Porterhouse $16.99kg
Whole Rump $9.50kg
BBQ Chops $6.99kg
Lamb Racks Unfrenched $14.99kg
1221
428-
AM12
-16
100
3700
5-07
Trading Easter Saturday • Closed Good Friday & Easter Monday
A new lobby group has put Macedon Ranges councillors on notice ahead of October’s local government elections.
Ranges Citizens for Open Government cites public anger over planning decisions as sparking an unprecedented appetite in the community for change.
Formed late last year, the group wants to give prospective candidates the support they need to run e�ective campaigns.
Group member and prospective south ward candidate Jamie Byron said there was a never-before-seen level of angst fuelled by the council’s recent record, especially in relation to planning.
‘‘�ere’s been a real lack of consistency,’’ he said.
‘�ere’s been a range of decisions that have been pretty outrageous over the past four years.
“�e fact it took the formation of a community group to stop development at Hanging Rock is a disgrace in itself. �e proposed development in Macedon behind the pub again had to be shut down by the community.
“Coles Express in Woodend is another example.’’
Mr Byron said people were also alarmed by the council’s processes for community consultation, which he said o�en amounted to the council ‘‘hand-picking’’ certain community groups for talks.
‘‘�ey seem to only be prepared to do the bare minimum,’’ he said.
‘‘People are now coming together and saying we can do better for our community. Instead of standing on the sidelines, they are prepared to stand up.’’
Matt Crossman
Ranges council under pressure
By Matt Crossmanand Alexandra Laskie
�e� from motor vehicles, drug use and possession, and breaches of court orders continue to be major drivers of crime in Sunbury and the Macedon Ranges, new Crime Statistics Agency data reveals.
But annual �gures released on �ursday show the rate of family violence in the Macedon Ranges dropped almost 10 per cent last year, continuing a recent trend.
�e area’s family violence rate fell from 916 o�ences per 100,000 people to 827. However, the number of orders being breached went up
18 per cent, to 267. Police inspector Ryan Irwin said police hoped that a zero tolerance approach was paying o�.
‘‘If it continues that way, it’s great,’’ Inspector Irwin said. ‘‘Quite o�en, family violence involves repeat o�enders. Hopefully, by charging people with breaches of orders and bringing them before the courts, we’re stopping them before it gets to the stage of assault.’’
Overall crime in the Macedon Ranges was up 4.7 per cent to 2273 o�ences.
Drug use and possession �gures remained relatively stable, while those for property damage (220 to 188) and arson, including illegal burno�s, went down (49 to 32). �e number of
burglaries jumped from 221 to 242. Assaults went up from 187 to 214, and weapons o�ences from 85 to 101.
�ere were 33 reports of number plates being stolen in the Macedon Ranges, up from 17, which re�ected a statewide trend.
In Hume, overall crime went up 14.9 per cent to 20,536 o�ences. Arrests for drug use and possession leapt 55 per cent to 959, while for dealing and tra�cking they rose 50 per cent to 184. Weapons and explosives arrests increased from 2116 to 2635.
Acting Inspector Phil Nash said Hume police were cracking down on drug o�enders, especially in and around Sunbury.
‘‘Hume is a fast-growing area and the statistics are re�ective of that growth,’’ he said. “[In relation to drugs] we’re arresting more people and doing some great work, especially in Sunbury under Senior Sergeant Tim Douglas.”
Hume’s assault, arson and property damage �gures remained stable, but burglary increased 16.7 per cent to 2186 incidents. �e number of the�s from motor vehicles went up almost 20 per cent to 2387. Total the�s jumped from 5796 to 6517.
�e family violence rate in Hume went up 3.4 per cent to 1565 per 100,000 people. Breaches of orders in Hume increased 24 per cent to 2635.
Fall in family violence continues
Hundreds of cars ranging from vintage classics to contemporary racers will be put on show at Sunbury’s Langama Park on Good Friday to raise money for the Royal Children’s Hospital appeal.
A�er collecting more than $8000 last year, organisers of the annual Kruze 4 Kids family fun day hope to smash the $10,000 barrier this time around.
Spokesman Brad Radcly�e says Australia’s only Transformers Camaro and a seven-foot-tall Optimus Prime will attract the attention of children, who will also enjoy pony rides, a petting zoo, jumping castle and face-painting for a gold coin donation.
Mr Radcly�e says the event has grown considerably since starting in 2011.
‘‘Our �rst event we had about 19 cars, now we’re targeting 800,’’ he said.
Having spent a lot of time in the hospital as a child with diabetes, he says the appeal is a great way to help kids a�ected by a range of conditions.
‘‘�ere’s so many charities out there, but this is probably the one cause where you can help them all,’’ he said.
For the same cause, Gisborne’s Listen to Your Body gym, in Brantome Street, will hold a ‘‘super session’’ from 8.30am. Members and guests will take part in a one-hour �tness class, inspired by Gisborne’s Harrison McDonald, 8, who was born with congenital heart problems and has regular tests at the hospital. Registration is from 8.15am. Cost: $10 members; $20 non-members.
Details: 5420 7727As well, �re�ghters and SES members will
hit the streets of towns including Sunbury, Gisborne, Macedon, Woodend, Romsey, Kyneton and Newham to rattle tins for the appeal.
Sunbury �re�ghters will be at Galaxy Land Park in Jacksons Hill, handing out Easter eggs from 1-2pm.
Matt Crossman
Town revs up for hospital appeal
Tahlia, 5, polishes the Jag in readiness for the fun day. (Joe Mastroianni)
4 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
HIT THE ROADWITH HONDA.
Subject to availability, all prices include GST. *4 year warranty applies for domestic use only and does not apply to engines sold as separate units. Savings on selected models.use only and does not apply to engines sold as separate units. Savings on selected models.
GISBORNE POWER PRODUCTS 42 BARRY ROAD NEW GISBORNE VIC, 3438 PH: 5428 8844
For planning your next trip, you need ultimate reliability and convenience. So wherever you are, Honda’s got you - and your generator - covered.
Head mechanic Justin Neyland, formerly in Romsey area has moved to Sunbury
Located at 3, 18-20 McDougall Road Sunbury.Bookings Phone 8746 8966
1219
530-
RC
10-1
6
Head mechanic Justin Neyland, formerly in Romsey area has now moved to Sunbury:
Satellite images are being used to help detect leaking water mains as part of a Victorian-�rst trial supported by Western Water.
Initially developed to search for water on other planets, the technology involves photographs taken from 650 kilometres above the earth over several weeks.
Experts then analyse the images, laying them over maps of water networks to reveal pipes that may be leaking.
�e state government trial, which covers more than 3000 square kilometres, also involves City West Water and Yarra Valley Water.
Validation of leak sites started last month a�er almost two months of photographic work.
Intelligent Water Networks chairman Neil Brennan, who is also Western Water managing director, said a preliminary report was likely to be handed to the government later this month.
‘‘If it meets the pilot objectives, it could have widespread bene�ts for the water industry and our customers,’’ he said.
State Water Minister Lisa Neville said millions of litres of precious drinking water could be saved.
‘‘�is project is one of many currently under way to investigate how we can use new technologies for greater e�ciency in the water industry,’’ she said.
Western Water estimates 460 million litres of water, valued at about $750,000, is lost to leaks in its region each year.
Matt Crossman
Eye in the sky to plug leaks
By Matt Crossman
Sunbury residents are being urged to sign a petition calling on the state government to reacquire the town’s decommissioned university site at Jacksons Hill.
�e Sunbury Asylum Alliance, which hopes to turn the former Victoria University (VU) site into a thriving community hub with space for jobs training, youth programs and artists, has joined the Sunbury Community Progress Association to urge the government to stop the land being sold o� for housing.
Residential development has been among the possibilities �oated for the site, which was the historic home of Sunbury’s 19th century asylum for people deemed to be mentally impaired.
�e land and buildings were handed over to VU in the 1990s. �e university closed its Sunbury campus in 2009.
Parts of the site are being used by community groups including radio station 3NRG and Boilerhouse �eatre Company.
Alliance spokeswoman Alison Cunningham said dozens of people had already requested copies of the petition.
‘‘We want it back in the state’s hands so it can be preserved for community use,” she said. “If they sell it, it could be lost forever. Public pressure is the only way it’s going to end up back in public hands.’’
Opposition leader Matthew Guy, who visited the site on Friday, said if it was not kept as an education facility, the community should be allowed to decide its future use.
Western Metropolitan Liberal MP Bernie Finn has warned state Planning Minister Richard Wynne against changing planning permits or zones for the site.
Earlier this month, Mr Finn told Parliament
Push for community hub
Sunbury Asylum Alliance members Julie Davenport and Alison Cunningham. (Joe Mastroianni)
the former asylum and surrounding land should not be allowed to be carved up.
‘‘One idea the community does not support is the prospect of selling the land for housing and losing the unique opportunity this site o�ers,’’ he said.
VU marketing and external relations executive director Rob Brown said the
university was working with Hume council to determine a use for the site to ‘‘enable a tertiary presence to be retained in Sunbury’’.
A spokeswoman for Mr Wynne did not respond by deadline.
�e alliance hopes to submit thousands of signatures to the Parliament by the end of April.
BRIMBANK STAR WEEKLY BRIMBANK STAR WEEKLY I WYNDHAM STAR WEEKLY WYNDHAM STAR WEEKLYMARIBYRNONG & HOBSONS BAY STAR WEEKLY
MELTON & MOROOBOOL STAR WEEKLYSUNBURY & MACEDON RANGES STAR WEEKLY I NORTHERN STAR WEEKLY
P R I N T I O N L I N E I D I G I T A L D I G I T A L
For advertisingopportunitiesplease call8318 5777
STARWEEKLY.COM.AU NEWS
5 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Scholarship Opportunities
at Overnewton
AAAAAAAAAAAPPPPPPPPPPPPPPLLLLIIIICCCCCCAAAAAAAAATTATATTTTATAATAATAATATATAATAATTATA IIIIOOOOOOOOONNNNNNSSSSSS CCCCCCLLLLOOOOOOOOOSSSSSSEEEE AAAAAAAAAAAPPPPPPPRRRRRRRRRIIIILLLL 6666666666Academic scholarships are being offered for students entering
Year 7 and Year 9 in 2017 – Application and payment can be made online by visitingthe College website. Applications close 4pm Wednesday, April 6, 2016.
Examination Date: Saturday April 16, 2016For further information contact Shirley Seit on 9334 0140.
Picture: Jim Laussen, Principal with 2015 College Dux, Jonah Krznaric ATAR 99.25
SCHOOL ALIVE TOURS 2016I TUESDAY 24 MAY I WEDNESDAY 31 AUGUST I FRIDAY 7 OCTOBER I
See Overnewton in action. Enjoy a tour of the College led by our studentsand experience a normal school day at Overnewton College.
Weekly tours are also available. To book a tour call Diane King on 9334 0141.
BUS SERVICES TO OVERNEWTON SERVICE YOUR AREABUS SERVICES TO OVERNEWTON SERVICE YOUR AREASee website for details. overnewton.vic.edu.au
Two campuses: Keilor and Taylors Lakes. Prep to Year 12 co-educational college.
MELBOURNE’S BIGGEST CLEARANCE CENTRE, NEW, FACTORY SECONDS
AND CARTON DAMAGED APPLIANCES
CHEST FREEZER NEW IN BOX
NOW $247
BEKO 7kg FRONT LOADER NEW IN BOXNOW $498
FRIDGE/ FREEZER NEW IN BOXNOW $382
DISHWASHER NEW IN BOXNOW $334
VERTICAL FREEZER NEW IN BOXNOW $388
1221
263-
RC
11-1
6
Bright young talent, community groups, shiny street machines and emergency service heroes were on parade as thousands of people celebrated SunFest’s 40th anniversary at the weekend.
Big crowds lined central Sunbury for Saturday’s traditional parade, which included many of the festival’s past presidents.
�e quality of local performers who were part of Friday night’s talent shows impressed many, as did the scale of Saturday’s carnival at the Village Green that culminated in a spectacular �reworks display.
Sunday’s Pets on the Green, live concerts and annual fun run were other highlights.
Sunbury the life of the party(P
ictu
res:
Luk
e H
emer
)
9-YEAR-OLDS TARYN AND TARA
ASHLEIGH, 4 DARCY, 4
KIM WILTSHIRE AND LEAH BORG
Picture gallery: www.starweekly.com.au
NEWS STARWEEKLY.COM.AU
6 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
D R ED R ED R ED R ED R E A MA MA M Z ZZ ZZ Z ZZ LU X U R Y B E LU X U R Y B E LU X U R Y B E LU X U R Y B E LU X U R Y B E LU X U R Y B E LU X U R Y B E LU X U R Y B E LU X U R Y B E D DD DD D I N GI N GI N GI N G
SASASALE LE LE EENND DADADAYYDAYDADAYDA 9TH APRIL 2016, 3.30P 9TH APRIL 2016, 3.30P 9TH APRIL 2016, 3.30P 9TH APRIL 2016, 3.30P 9TH APRIL 2016, 3.30P 9TH APRIL 2016, 3.30P
EGGS’TRA EASTER SAVINGSDreamzzz
Luxury Bedding offer
you a wide range of the
highest quality Australian
made mattresses and bases,
plus our exclusive custom
made service, your choice,
your design.
Our mattresses
start from as low
as $130.
Layby’s Welcome
AMBASSADOR DELUXE QB MATTRESS
Mattress only $2999NOW $2599
Full Ensemble $3499NOW $2999
Individually conforms to body shape for max support/comfort and minimum partner
disturbance.Zoned pocket spring system-edge to edge
support for a larger sleep surface.Added plush to offer cloud comfort from head to
toe while you sleep.
Mattress only $1999 Now $1499
Full Ensemble $2500 Now $1999
LAVISH PLUSH QB MATTRESS
10 Year Guarantee
15 Year Warranty
Add 4 draws to your base for an additional $300. Offers a huge amount
of additonal storage without taking up space
BACK CARE CHIROPRACTIC TRUNDLE SET
High Count Pocket Spring End To End Fully Encased In A Foam Box Construction For Superior Side Support And Enhanced aReduced Partner Disturbance. Topped With Natural Pin Core Latex For That
Natural Yet Unparalleled Feel.
SB Set $1199 NOW $999
Set $1399 NOW $1099
10 Year Warranty
High Quality Jacquard System complimented with a premium foam and
insulated blanket for added comfort. Supported by High Count Bonnell Zoned
Spring unit with Extra side supports throughout the full area of Mattressthroughout the full area of Mattress
Published by MMP Star Pty Ltd ACN 168 220 399Head Of�ce Corner Thomsons Road and Keilor Park Drive, Keilor Park, 3042Publisher/General Manager, Colin MossAll material is copyright to MMP Star Pty Ltd.Responsibility for election comment is accepted by Colin Moss.All signi�cant errors will be corrected as quickly as possible. Distribution numbers, areas and coverage are estimates only. For our terms and conditions please visit starweekly.com.au
New Gisborne works startWorks are under way to improve the intersection of the Calder Freeway and Station Road at New Gisborne. The $6.7 million federal and state government project, including two new roundabouts and a new four-lane section of road, is expected to �nish by the end of the year.
Decayed oak ‘has to go’Macedon Ranges council will remove a large oak tree from the corner of Station Road and Wallaby Run at Gisborne. Assets and operations director Dale Thornton said the tree had massive internal decay. Pruning will remove dead wood from another oak on the other side of the road.
MP echoes skate park callMacedon MP Mary-Anne Thomas has called on Sports Minister John Eren to support Lance�eld community’s 20-year push for a skate park. Macedon Ranges council approved designs for the south-east corner of Lance�eld Park, budgeting $130,000 for works.
Japanese traditions on showJapanese consul-general Keiko Haneda was in Kyneton last Wednesday to open the museum’s Culture Bunka exhibition as part of Cultural Diversity Week. The exhibition, featuring kimonos, ceramics and kitsch items, is open until March 27.
FOR BREAKING NEWS, VISIT Web: starweekly.com.au
Sunbury & Macedon Ranges Star Weekly Sunbury & Macedon Ranges Star Weekly @star_weekly @star_weekly
People have a rare chance to see Hanging Rock under the stars as part of Macedon Ranges council’s annual camp-out. Campers can enjoy a barbecue, sit back and take in the picturesque surrounds, even try to spot nocturnal wildlife during a guided night walk. Mayor Graham Hackett expects there will be plenty of interest in the April 2-3 event, especially from young ones. ‘‘[Kids are] amazed by what they can see on night-time walks in the bush,’’ he says. ‘‘At Hanging Rock, you’ve got all sorts of native animals living there. From wombats and echidnas through to possums and kangaroos – campers will have the chance to spot at least one or two.’’ SES members will put on a barbecue dinner and breakfast for a small fee. Fees: $21 adults; $12.50 children; $54 family. Bookings essential. Details: 5421 1468 or www.mrsc.vic.gov.au/CampOut
Ranges rock a good night out
(Joe
Mas
troi
anni
)
PARK RANGER NERISSA
STARWEEKLY.COM.AU NEWS
7 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
1216895-KC7-16
By Matt Crossman
Labor MPs have slammed the federal government’s failure to commit to the �nal two years of Gonski education reforms, saying $39.7 million will be ripped out of Sunbury and Macedon Ranges schools.
McEwen MP Rob Mitchell, Bendigo MP Lisa Chesters and state Macedon MP Mary-Anne �omas said the government’s decision would leave the average state school almost $500,000 worse o�.
“�is is precious funding that pays for things
funding include Sunbury and Macedon Ranges Specialist School ($700,000) and New Gisborne, Sunbury Heights, Goonawarra and Kismet Park primary schools (all $300,000).
Many others stand to lose between $100,000 and $200,000.
In a speech to the Independent Schools Council of Australia last week, federal Education Minister Simon Birmingham blasted state Labor for having the ‘‘gall’’ to complain when it, itself had failed to invest.
‘‘�e federal per-student funding for students in state government schools is 66 per
like extra support for teachers in the classroom and special reading programs for kids falling behind,” Ms Chesters said.
Figures provided by Labor MPs show Sunbury College stands to lose at least $1 million in funding promised under the ��h and sixth years of the national agreement.
Gisborne Secondary College and Sunbury Downs College will be at least $900,000 and $700,000 worse o�, respectively, while Kyneton Secondary College stands to lose at least $600,000.
Other schools a�ected by withdrawn
cent higher, in real terms, than 10 years ago,’’ he said.
Gisborne Secondary College principal Andrew Robertson said while it was hard to quantify how much the school stood to lose, ‘‘the big years were always the ��h and sixth’’.
He said the extra Gonski money would have gone towards more quality maths teachers, extra tuition and reducing class sizes.
‘‘State schools do a lot of heavy li�ing. Any money that does comes through is going to be well used.’’
– with �e Age
Toppling into Gonski black hole
A blessing service, heritage talk, thanksgiving feast and musical performances will be part of celebrations marking the 150th anniversary of Malmsbury’s St John the Evangelist Anglican Church this Saturday. Vicar Ian Howarth says past and present parishioners and people from Malmsbury and local towns, including Drummond, Lauriston and Taradale, will attend events including a sung service, which features a combined Macedon Ranges choir, at 10.30am. Later, Reverend Canon Graham Snell and Robyn Snell, great grand-daughter of the church’s architect, will conduct a tour of St John’s. A village feast at 6pm will be followed by an Easter vigil, lead by Bendigo Bishop Andrew Curnow, at 7.30pm. Details: goo.gl/s8Wrvq
150 years of services
FATHER IAN HOWARTH
(Dam
jan
Jane
vski
)
NEWS STARWEEKLY.COM.AU
8 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
*Finance only available when taking up a Macquarie contract for a vehicle for personal use. Repayments cannot be made weekly. Monthly equivalent repayment is (A)$325.60, (B)$399.75, (C)$428.51 based on a 60 month consumer loan agreement at 7.20% interested rate and includes a 20% deposit (for approved applicants only) and a driveaway price of (A)$18,990, (B)$23,908, (C)$23,392. Total amount payable under contract is (A)$19,536.00, (B)$23,984.79, (C)$25,710.86. Offer ends 31/03/2016. The comparison rate is for a secured fixed rate loan with an amount financed of $30,000 and a term of 5 years. WARNING: This comparison rate is true only for the example and may not include all fees and charges.
Different terms, fees and other loan amounts might result in a different comparison rate. Finance approved by Macquarie Leasing Pty Limited ABN 38 002 674 982. Australian Credit Licence Number 394925. All finance applications are subject to the satisfaction of approval criteria. Terms, conditions, fees and charges apply. LMCT11043 MCK30081
2016 Mazda2 Neo AutomaticHatch or Sedan
First Ever Mazda CX-3Neo Manual
$18,990 $23,392 $23,392 $$23,908$23,908$DRIVE AWAY FROM DRIVE AWAY FROMDRIVE AWAY FROM
Mazda3 Neo AutomaticHatch or Sedan
$
NOW WITH
FREEREGISTRATION,
CTP AND
STAMP DUTY
Essendon M{zd{‘s
EXCLUSIVEMARCH OFFERS
$75 From
PERWEEK*(A)
$92 From
PERWEEK*(B)
$99 From
PERWEEK*(C)
EssendonM{zd{
345 Wirraway Rd, Essendon Fields Ph: 9374 2222
www.essendonmazda.com.au
A Sunbury police sergeant who helped rescue four people trapped in a Kinglake West house on Black Saturday says he was simply doing his job.
David Key, who recently retired a�er almost 30 years with the police air wing service, has been recognised with a medal and bar for acts of bravery in hazardous circumstances.
An air wing crew �ew a helicopter to Coombs Road a�er reports that people were trapped by a �restorm surrounding the property.
‘‘�is property, where there were four people, was surrounded on three sides, but we felt like we had enough time to get one or two out,’’ Mr Key said. “I went down on the winch to get the �rst one out and she said, ‘I’m not leaving without my dog’.’’
Mr Key put the dog between them, but it panicked and ran away a�er they were hit by a strong gust full of embers.
‘‘She jumped o� to get the dog and then the cable I was on went slack,’’ he said. “�e helicopter was actually sinking because there wasn’t enough air.’’
�e helicopter �ew to a safer position, while Mr Key disconnected himself and helped the residents into vehicles. A horse trotted beside a car as the helicopter led the convoy to safety.
‘‘�e �re was pretty much right on the property at this stage,’’ Mr Key said. ‘‘�e helicopter guided us out to a clearing, away from the path of the �re.’’
Matt Crossman
Lowered into the infernoBy Matt Crossman
Two Macedon Ranges mates who pushed a child out of the path of an out-of-control ute have been recognised with bravery medals.
Chris Meacham and Lucas Dowson were about to start cutting �rewood in a paddock near Wallan on May 4, 2014, when they saw the ute careering down a hill and heading towards their children, who were playing nearby.
When Mr Meacham’s son Archie, then 4, froze in the path of the vehicle, the pair raced to sweep him out of harm’s way.
Both Mr Meacham and Mr Dowson were hit by the ute, which had become airborne, and both su�ered serious injuries that continue to have a dramatic impact on their lives.
Mr Meacham, who recently moved to Bullengarook from Sunbury, said while he had been unable to return to work as an electrician and had to quit as coach of his beloved Sunbury Kangaroos, it was impossible to put a price on the life of his boy.
‘‘I just had a feeling that day that something wasn’t right,’’ the father of four said.
‘‘We went anyway and were setting up to start cutting wood … next thing we knew this Hilux was coming straight for us, breaking through trees.
‘‘Archie was just star-struck … he was just frozen, staring at the car.
‘‘We both dropped our chainsaws and sort of swept him up from either side. Archie popped up in the air and the car hit me and Lucas.’’
Mr Meacham sustained serious injuries, including to a shoulder and knee. He continues to have experimental surgery in the hope of regaining proper movement.
Mr Dowson, who lives in Darraweit Guim, received major abdominal injuries, a punctured lung and nerve damage. He was in a wheelchair for three months a�erwards.
Chris Meacham and son Archie with mate Lucas Dowson. (Joe Mastroianni)
Dads save ‘frozen’ boy
Both men said the support of family and friends had been crucial.
‘‘If anyone deserves a medal, it’s my wife and my kids,’’ Mr Dowson said.
Mr Meacham agreed there had been plenty of ‘‘ups and downs’’ along the way.
‘‘I’ve replayed it a lot, but it is what it is,’’ he said. ‘‘We’ll just keep pushing through.’’
‘‘ I just had a feeling that day that something wasn’t right ’’ - Chris Meacham
9 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Chocotalier Asst Choc WAS $12.95 NOW $3.951 Kilo Mini Eggs Asst.
WAS $12.95 NOW $3.95
WAS $20 NOW $10
400gWAS $10.00
Now $3.95180g
WAS $5.00Now $2.00
WAS $8.95 NOW $2.00
NEWS STARWEEKLY.COM.AU
10 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Duneira on showExplore the history of Mount Macedon property Duneira with an autumn garden tour during March. ■ 5426 1490 or www.duneria.com.au
Easter in SunburyJoin the Combined Churches of Sunbury for an Easter celebration at the Village Green from 10am on Good Friday or listen live on 3NRG FM. A collection will support refugees in Greece.
Lance�eld marketPick up a bargain and sample �ne local produce at the next Lance�eld Farmers Market. It’s in High Street from 9am-1pm this Saturday■ 0487 444 090
Kyneton celebrationA sausage sizzle and family day will be held in Kyneton as part of Autism Awareness Month activities. The event will feature face-painting, raf�es, a jumping castle and more. At Mechanics Reserve, Mollison Street, from 11.30am-2pm on Saturday, April 2.■ 0411 444 447
Sunbury outingCheck out plants, produce, hot food, coffee, face-painting and car boot sales at the next Sunbury market, at the community centre in Elizabeth Drive from 9am-2pm on Saturday, April 2.■ 0400 907 793
COMMUNITY CALENDARWANT YOUR EVENT LISTED? Community Calendar is made available free of charge to not-for-pro�t organisations to keep the public informed of special events and activities. Send item details to Star Weekly Community Calendar, Corner Thomsons Road and Keilor Park Drive, Keilor Park, 3042, or email to [email protected]. Deadline for copy and announcements is noon Tuesday.
(iSto
ck)
Macedon Ranges arthritis supportMacedon Ranges Arthritis Peer Support Group meets at Woodend Neighbourhood House from 1-3pm on the �rst Monday of every month. At 47 Forest Street.■ 0411 116 711
African musical magicMasterful drumming, evocative tunes and mind-blowing songs will be on display when the Ubuntu African choir performs in Sunbury on Tuesday, April 12. At Salesian College from 7pm. Cost: $20, children $10.■ www.kwaya.org
Phil Cleary in SunburyFootball identity and domestic violence activist Phil Cleary will speak at the Twilight School in Sunbury on Wednesday, April 20. Rupertswood Mansion, 6pm. Cost: $10■ 9744 0085
Badminton invitationSunbury Ladies Bat’a’rouge Club welcomes new members for badminton. Boardman Stadium, 9.45am-noon every Monday during school terms. First day free; regular cost $8. Child minding available.■ 0409 256 123
Gol�ng fun for kidsKids are invited to a free beginners clinic at Goonawarra Golf Club on Tuesday, April 5. Golf instructor Carol Leaney will walk boys and girls through the basics from 10am. The club is holding one- or two-day workshops on April 5 and 6. Bookings essential.■ 0407 331 399
WIN THIS
BookDepository.com has added more than 25,000 Aussie-penned titles to its world-class selection, representing classic storytellers, contemporary novelists, food writers and celebrities, as well as a wide range of children’s book authors. Star Weekly has four $50 vouchers for readers to spend on their favourite Aussie titles at www.bookdepository.com
To enter, click on the WIN tab at www.starweekly.com.au and follow the prompts. Entries close at 11.59pm on Monday, March 28, and will be drawn at 9am the next day at 380 City Road, Southbank, 3006. Entrants must be over 18 years old and reside in Victoria. See our competition terms and conditions for more details. All winners will be contacted by the prize supplier within seven days of the draw.
Auss-One Training & Education is the trading name of Sunbury College of Hair & Beauty. ABN 68151848341.Training is nationally recognised and delivered under the authority of Australian Skills Quality Authority.
ACCREDITED COURSESHairdressingCertificate III in HairdressingCertificate III in Hairdressing (Barbering)Certificate IV in HairdressingBeautyCertificate II in Nail TechnologyCertificate II in Retail Make-Up & Skin CareCertificate III in Beauty ServicesCertificate IV in Beauty TherapyDiploma of Beauty Therapy
ENROLMENTS OPEN NOW!
Courses delivered with state and federal funding
Applicants with disabilities are encouraged to apply.
UP COMING EVENTS Join us to support the Royal Children’s Hospital – Good Friday Appeal and get a GREAT OFFER!Every Tuesday and Friday until Good Friday$10.00 wash and blow wave – students models onlyAll profits will be donated to the Royals Children’s Hospital – Good Friday appeal.
SunFest 2016 Sunbury FestivalCome and see us at our Stall and learn more about our School of Hair & BeautyTake some ME-TIME and enjoy some pampering with hand, neck and shoulder massagesEnjoy the parade from 12.30 on Saturday 19th March with a special Presentation put together by the creative talents of our students with their very special and colourful Carnivale theme.
Are you a qualified hairdresser and would like a refresher course to get you back into the workforce?Contact us at the college and find out more.
1218
107-
PB08
-16
Ph: 9744 1991 Location: Unit 3/ 49-51 Horne Street Sunbury VIC 3429Auss-One training and
education Sunbury College of Hair and Beauty
11 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
The opening of Lake Imaging’s new practice in Horne Street, Sunbury, is slated for Monday, April 4 … and
manager Chris Proctor and the team – and patients – are very excited.
“We’re moving from Riddell Road,” Chris says, “and the new building will house technology and offer services currently unavailable to the Sunbury community.
“It could be the biggest improvement in local medical services for some time.”
Locals passing along Horne Street towards the end of February may have seen the MRI unit being craned into the new building. The unit is now safely secured in its new home, with the �nishing touches being put on the room housing it.
A �rst for Sunbury, the MRI will complete the range of medical imaging services available, reducing the need for patients to travel to the city for their medical imaging.
The MRI unit will operate alongside a range of new equipment, including the latest 128-slice CT scanner, 3D mammography and digital radiography.
Recently replaced ultrasound and bone densitometry systems will be relocated from the current site, which will close its doors once the new practice opens.
“We just can’t wait to �nally open the doors and show off the fresh, welcoming
new practice to all of our Sunbury patients,” says Chris.
“A community the size of Sunbury has been crying out for a facility and technology such as this for a long time, and we’re excited to be able provide it.”
Imaging clinic takes new place uptown
the biggest improvement in local medical services
Advertising feature
In addition to showcasing the new practice and its state-of-the-art equipment, Chris is looking forward to patients being met by the clinic’s long-term resident, ‘Manuella’ the Mexican walking �sh – her brand-new home is just inside the door.
Lake Imaging, 17 Horne Street, Sunbury.Opens 8.30am-6pm Monday-Friday and 8am-noon Saturday. Inquiries: 9744 5344
CHRIS PROCTOR
(Dam
jan
Jane
vski
)
Opening 4th April Continuing to provide access to the
regions widest range of radiology services, with a full time on-site Radiologist.
Serving the Sunbury Community for over 20 Years
Our Services available:Our Services available:
• CT (Bulk Billed)• CT (Bulk Billed)• MRI
• 3D Mammography• 3D Mammography• Digital X-ray • Digital X-ray
Concession card holders are bulk billed for most services where a Medicare rebate is availableReferrals from all radiology providers accepted.Referrals from all radiology providers accepted.
1220
903-
HM
12-1
6 1
0029
618-
06
Lake Imaging Sunbury • 17-19 Horne Street Sunbury • 9744 5344www.lakeimaging.com.au
Come Visit Us at Our New PracticeTHE HOME OF SUNBURY’S
FIRST MRI SCANNER
12 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Sunbury Carpet Court’s new owners, Peter and Christine Taylor, put The Block’s Darren Palmer on the �oor.
Okay, it’s actually the gorgeously textured Provincial Lane rug collection by Darren. And that’s just one of the many quality offerings from this recently-opened store.
Just as they do in their four other Carpet Court shops in Gisborne, Bendigo, Kyneton and Kerang, this busy pair has everything in stock for a successful foray into new carpet, �oorboards, laminate, vinyl, tiles and blinds.
Christine says they have some beautiful carpets and �oorboards.
“We have a wonderful range that taps into all the new looks and different textures,” she says. “The colour palette is right en pointe, in shades of latte, mocha, soft and deep charcoals, and greys, some with a hint of blue.
“Oak, naturals and deepest charcoal are among the popular looks our hardwood timbers re�ect, and bamboo comes in shades ranging from naturals and limed white to vintage grey and brushed antique. Floorboards and planks are a lovely anchor to many home styles.”
A good selection of vinyl �ooring, the family-practical version of the timber look, couples with a collection of tiles in shades that complement today’s look – as do
blinds and plantation shutters. All installations are done by quali�ed
tradesmen, who have been in the game for more than a decade.
Peter and Christine especially enjoy helping their customers choose wisely and chatting about ideas.
“We both value getting to know our customers and hearing about their
Rug up, it’s the coolest carpet store
a wonderful range that taps into all the new looks
Advertising feature
projects,” Peter says. “Sometimes they know exactly what they want … they’ve done their research and know we can deliver the product.
“Others are happy to be guided and be invited to explore options.
“Every one of our team is people-focused and they have heaps of professional tips to pass on.”
For the rest of March and throughout April, the Carpet Court crew will be giving away vacuum cleaners with any �ooring installations.
Sunbury Carpet Court57-59 Horne Street Sunbury Ph: 9740 7777
*NEW ORDERS - Pay your deposit by 30th April 2016. EXISTING ORDERS - Settle your order in full by 30th April 2016
Book for a Free
Measure & Quote
Pay your deposit
HOOVER CHALLENGER VACUUM GIVE AWAY
*Receive a Free
Vacuum Cleaner
13 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Advertising feature
Aplumber, digging a trench on a construction site, �nds his Godings-purchased Kubota excavator
has broken down. He needs a part replaced in a hurry because the breakdown has brought the whole site to a screeching halt. What can he do to get things moving again – and fast?
The answer, says Goding’s owner Adrian Williams, is their fully equipped service �eet.
“That plumber is a wise man. He not only bought his excavator from us, but he also owns a Kubota, the best machinery around,” he says.
“We can have a fully trained mechanic to the site in no time, solve the issue and have everyone on site back to work.”
Godings crew of mechanics gets ongoing training and they’re right on top of things. They also have access to the full set of diagnostic tools and a complete range of spare parts, along with providing top-notch machinery servicing.
The Kubota label appears on most of the product range – compact track loaders, mowers, generators and excavator buckets and attachments, including auger drive units. Godings is the only authorised Kubota dealer to meet machinery needs in the construction industry located in
Melbourne’s west.Adrian says he and the team are very
customer-focused, before and after a sale. He also values hearing good stories from his customers.
“It could be a concreter who’s just bought his �rst piece of Kubota machinery, perhaps a compact track loader. When we
Kerry Wellwood, Braden Joyce, Jamie Walters and Andrew Manicolo. (Supplied)
Godings and Kubota - a perfect team
That plumber is a wise man … Kubota, the best
machinery brand around
see him down the track he tells us how rapt he is with the machine and how it’s made work on sites just that bit easier. Or a civil contractor whose work on housing estates has been a dream run, with his Kubota machinery proving incredibly reliable and his team pleased with the ef�ciency.”
Adrian intends Godings to be the
construction industry’s destination of choice … and all the right elements are in place to make sure Godings is exactly that place.Godings, 2129 Western Highway, Rockbank. Opens 8am-5pm Monday-Friday and 8am-noon Saturday. Inquiries: 9747 1359 or [email protected]
kubota.com.au
Godings & Kubotaan unbeatable
partnership
Kubota SVL90-2 Compact Track LoaderKubota, a trusted and world-leading manufacturer of construction equipment, introduces the new SVL90-2 Compact Track Loader. The SVL90-2 delivers best-in-class bucket breakout force and lifting capacity, outstanding stability, a wide comfortable operator area, and much more.
Kubota U55-4 ExcavatorNow available with an angle blade, the Kubota U55-4 o�ers customers versatility never seen before in the mid size 5 tonne excavator market. Powered by a reliable Kubota 47.6HP engine, the Kubota U55-4 features a compact and well balanced design, combining exceptional power and the versatility to tackle any job and working condition with ease.
Godings gives you...■ After Sale Service■ Factory Trained Technicians■ All repairs & services are carried
out with genuine Kubota parts■ Bronze & Silver 2014 & 2015
5 star dealership award
Kubota Authorised Dealer
★ ★ ★ ★ ★5 STAR SERVICE
✔■✔■ After Sale Service✔ After Sale Service✔■✔■ Factory Trained Technicians✔ Factory Trained Technicians✔■✔■ All repairs & services are carried ✔ All repairs & services are carried
14 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Change has swept through Djerriwarrh Health Services at Bacchus Marsh.
Newly appointed chief executive Andrew Freeman says there has been a major transformation.
“The list of ‘new’ is a long one,” he says. “We have new leadership, with Health Minister-appointed Dr John Ballard taking the role of administrator, new staff, new clinical governance, new equipment, new capital investment, and new partnerships with Western Health and Royal Women’s Hospital.
“This re�ects rapid change in the growth corridor we service – Melton, Bacchus Marsh and Caroline Springs.”
A new staff line-up has Dr Nisha Khot as the director of obstetrics, and Dr Latika Cilly as the staff specialist in obstetrics and gynaecology.
Impressive new capital investments include the purchase and installation of eight Philips Avalon foetal monitoring machines, and the construction of a $2.9million Central Sterile Supply Unit (CSSU) at Bacchus Marsh and Melton Regional Hospital, along with expanded maternity services.
“We’re also taking a lead role in the development of a $21million health centre in the Melton Health Precinct,” says Mr Freeman.
“It’s funded by the Victorian state government and, once completed to an early-2018 schedule, will have seven different services under the one roof.”
Bacchus Marsh and Melton Regional Hospital, Melton Health, and community health centres in both towns, as well as Caroline Springs, come under the umbrella of Djerriwarrh Health Services.
The hospital is a 42-bed acute hospital
Djerriwarrh Health transforms services
… an expression of community
con�dence in Djerriwarrh
Advertising feature
with 11 maternity beds, and it performs a range of theatre procedures and provides outpatient and community health care.
It has welcomed 153 newborns in the past three months, including 54 in February alone. Mr Freeman says this, along with the 160 new antenatal bookings in January and February, is signi�cant.
“We see this as an expression of community con�dence in Djerriwarrh.
“But we’re still looking for feedback and, to this extent, we will soon be inviting nominations from community members to help us continue to build for the future and optimise change at the service.”
Djerriwarrh Health Services,29-35 Grant Street, Bacchus Marsh.Inquiries: 5367 2000
(Sup
plie
d)
(03) 5367 2000 | www.djhs.org.au
+ Agent’s Choice, p16
Sophisticated style
Page
17
Source: “Three out of four” Millward Brown study, May 2014. Emma™ conducted by Ipsos MediaCT, 12 months ending June 2015, Nielsen Online Ratings June 2015, people 14+.
Selling your property? Add Star Weekly print to your domain.com.au marketing campaign and reach an extra 159,000 potential property seekers. It’s a proven winning formula to create greater impact and help you sell your property for more.
There has never been a better time to advertise with print. NEWS
3 out of 4 people use newspapers when looking for property
DM14687
Contact your real estate agent today
domain.com.au
16 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
domain.com.au
With a wide street frontage on a block of about 3000 square metres, this quality house has room to spread out inside, and a great pool to gather around outside. Features include dado panelling and Tasmanian oak �oors, and there are spacious living areas. The house has a sunken rumpus room-cum-theatre, and there’s a wood �replace in the lounge room. The dining zone has an open-plan layout while the kitchen has great storage, a dishwasher, electric cooktop and an underbench oven. From the family room, there’s access to an outdoor dining area, which looks over the inground salt water pool. There are three bedrooms here, all with built-in wardrobes, and the main has an en suite. Outside, there’s a large powered workshop with a mezzanine and a separate garden, plus wood sheds. The house has gas central heating, ceiling fans and a split-system, with a remote-controlled double garage alongside. It’s close to schools, the town centre and the Calder.
Brad Teal: 5428 2800 Price: $775,000 Private sale
GISBORNE 11 Fowler Court, 3437
3 2 4
This townhouse set in a quiet complex would be ideal for an investor or a �rst-home buyer. There are two bedrooms – one with a walk-in wardrobe and an en suite, the other with a built-in wardrobe. The family-meals zone is an open space and the large kitchen has gas cooktop, electric oven, near new dishwasher and large corner pantry. A sliding door leads to an undercover outdoor area �tted with café blinds that looks towards low-maintenance gardens that feature pebbled garden beds. The house has high-quality carpets, window furnishings with pelmets, gas ducted heating, split-system, quality security doors and �yscreens throughout, Colorbond fencing and a single garage with built-in storage and automatic tilt door.
Chess Property Consultants: 5429 5544 Price: $349,500 Private sale
ROMSEY 6/3 Regan Drive, 3434
2 2 1
With views of the Macedon Ranges, access to town water, and set on about four hectares, this property is on an iconic corner block in Riddells Creek. The house has three bedrooms, two with built-in wardrobes, the main with walk-in wardrobe and a newly installed en suite. A new kitchen has lots of cupboard space, a 900-millimetre cooker and Blanco dishwasher. The separate lounge room overlooks the established garden which features rock walls, colourful bottle-brush shrubs and a date palm tree. There’s lush pasture and well-drained level paddocks, a double carport, double garage with workshop and an open bay shed.
Gisborne Real Estate - Macedon Ranges Real Estate: 5428 8895Price: Contact agent Private sale
RIDDELLS CREEK 21 Hudsons Lane, 3431
3 2 4
Built by ‘Jeske’, a well-known local builder, and set on about 3.25 acres, Myoori is about 40 squares of double clinker brick set in gorgeous gardens on the quiet side of Mount Macedon. There are �ve bedrooms – two with walk-in wardrobes share an en suite, two have built-in wardrobes and one has built-in shelves. Of the numerous living spaces here, there’s a lounge room with a �replace as well as a separate retreat space. There are timber-lined ceilings and exposed beams in the dining zone. The country-style kitchen includes a walk-in pantry, dishwasher, gas cooktop and a wall oven. There are two courtyards in the grounds, also an outdoor pizza oven and camp �re, as well as a small orchard, vegie garden, a lake with its own boat shed, a chook run and a paddock. The house has electric �oor heating as well as wood and gas heating, �oor to ceiling windows, and an insulated, remote-controlled double garage.
RT Edgar: 5427 1222 Price: $1million+ Private sale
MOUNT MACEDON 20 Syndicate Road, 3441
5 3 2
17 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
domain.com.au
Within an amble of the village centre, this large, sophisticated house has a contemporary edge moderated with an inherant elegance – a winning combination when stylishness matters.
Pearl-grey wall paint and polished �oor tiles juxtapose with classy taupe roman blinds and cedar-framed bifold doors. All look smashing and well put-together in expansive, light-�lled rooms.
Living zones are plentiful and eminently usable – an open, carpeted lounge room; a big family-meals area; a carpeted rumpus/
theatre room with a door to a gabled pergola; and a fantastic indoor/outdoor room (glossily tiled) with a gas log �re, and bifolds each side to both the pergola and an extended wooden deck under a grapevine.
The sleek kitchen has a stone-topped island bench, large walk-in pantry, lots of drawers and Omega dishwasher and 900mm cooker.
The main bedroom, through double doors near front entry, has �tted walk-through wardrobes and a smart en suite with twin basins, big shower and enclosed toilet.
Three more bedrooms are down a second hallway, one with walk-in wardrobe and access to the two-way main bathroom – which further links with a powder room. The laundry has a stack of storage.
There’s also a good-sized study, with a wall of �tted storage, and multi-paned french doors to the east-facing side verandah – making it a great of�ce.
Gas ducted heating and evaporative cooling tames Woodend’s climate, and there’s a walk-in closet in the entry hall, which stretches back beautifully to give
Keatings: 5427 2999 Price: $795,000 Private sale
WOODEND 2 Gwendoline Avenue, 3442
4 2 2
a glimpse of the outdoor room beyond. Surrounding gardens on the block of about 995 square metres are an attractive mix of sculptural trees – many tall varieties affording privacy – roses, border ornamentals and lawn. And the front, north-facing verandah is one of several spots to take it all in.
An integrated, remote-controlled double garage with internal access is a �nal keynote.
Carole Levy
18 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Kennedy & Hunt Real Estate www.kennedyandhunt.com.au
Gisborne32 Frith Road
Private Sale Details:$645,000
Viewing Times:By appointment.
Property Info: A 3 B 2 C 2
Attractive home with views & atreasure of a garden! Land Approx.937m2.Oers 3 bedrms, library/sary/sary tudy,tudy,tudy ensuite, bathrm,formal lounge/dining,lounge/dining,lounge/ kitchen/meals/familyoverlooking the leafy garden & entertainingarea. Character features, high ceilings, baywindows & balcony all add to the charm of thisproperty. Dbl garage & storeroom are a bonus.Walking distance to town – you’ll love it!
Gisborne66 The Boulevard
Private Sale Details:E.S.R. $510,000 - $540,000
Viewing Times:By appointment.
Property Info: A 4 B 2 C 2
A great family home with views andeasy distance to town. Land approx.758m2.Attractive family home within easy distance totown. 3 bedrms upstairs with family bathrm &ensuite. Downstairs o ers study or 4th bedrm,sitting rm & large kitchen/meals/living area& laundry. Loads of storage & fully integratedgarage (with rear roller door). An a ordablehome within a popular neighbourhood.
Macedon64 Victoria Street Private Sale
Private Sale Details:O ers around $650,000 considered
Viewing Times:By appointment.
Property Info: A 3 B 2 C 2
Cottage Charm – Village Position.Land Approx. 1500m2.Attractive street presence, established garden,easy walking distance to all amenities & greataccommodation. 3 bedrms, kitchen/meals/living rm, lounge, ensuite & family bathrm.Decking/entDecking/entDecking/ ertaining space; garage/woage/woage/ rkshop.Make this property your own & revel in theconvenience & charm of country life.
Gisborne19 Pleasant View Court
Private Sale Details:$485,000 - $505,000
Viewing Times:By appointment.
Property Info: A 3 B 2 C 2
Location, a�ordability & tranquility.Land approx. 670m2This contemporary family home includes 3bedrms, master with WIR & ensuite, bathroom& WC, study (or 4th bedrm) with built incupboards, 2 living areas & laundry. The galleykitchen, overlooks the dining & lounge witha lovely garden outlook. Features integratedgarage with storage, shed & water tank. Movein & enjoy the convenience!
Happy Easter from our family to yours.Easter and the extra long weekend is often a time that
people finally have a moment to sit down, and startthinking about the future.
If you are considering moving, upsizing,downsizing or changing your lifestyle, let us help.
We’d love to remove any doubt about the currentmarket value of your property.
Just set aside a spare 30 minutes and we can provideyou with an estimate of value for your property.
We are seeing strong interest from buyers, who areprepared to pay record prices to move to our region.
Easter and the extra long weekend is often a time that people fi nally have a moment to sit down, and start
If you are considering moving, upsizing, downsizing or changing your lifestyle, let us help.
We’d love to remove any doubt about the current
Just set aside a spare 30 minutes and we can provide you with an estimate of value for your property.
We are seeing strong interest from buyers, who are prepared to pay record prices to move to our region.
Make the most of the Easter internet traffi c!
19 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
11 - 15 Stephens Street, WOODENDExciting new 6 lot subdivision. In a serene neighbourhood of Woodend, with an appealing rural character,
this small boutique subdivision offers a rare opportunity to bring dreams to fruition. The area has a mix of farmland andsmall acreage properties, as well as newer housing of high quality.
There are only 5 lots on offer, with sizes ranging from 636m² - 761m².The town centre is only 2 ½ kilometres away, and both Bendigo and Melbourne are within an easy commute by car or train.
Bus routes to the local schools are close by.
Mains sewer, water, power and natural gas are available.
PRICE $240,000 Each
Viewing
3 - 3.30pm
Saturd
ay 26th M
arch
57 Andrew Avenue, WOODENDModern masterpiece. On four private acres, in a no through road, this amazing home combines the best of great design and exemplary style.
At the heart of the house is a huge open-plan area that incorporates the living and dining rooms and kitchen with stone benches, white cabinets andlarge butler’s pantry. The master bedroom has a fabulous valet closet and a stylish, spacious ensuite. An offi ce or fourth bedroom has external access.
This property has a six star energy rating, thanks to double glazing, LED lighting, insulation and other effi ciency measures. There is a huge 22.5m x 8m shed with concrete fl oor, three phase power, and an integrated double garage.
Only a short distance from the town centre, and conveniently close to the Calder Freeway,this stunning home represents the best of modern design in a private country setting.
RESERVE $1,200,000 AUCTION Saturday 9th April at 11am
Suite 3, 39 Anslow St Woodend VIC 3442Phone 5427 4307 or 0427 272 872
www.joangladman.com.au
N
STEP
HEN
S S
TREE
T
ELLISON STREET
GRA
Y S
TREE
T
Lot 4713m² Lot 3
695m² Lot 2636m²
Lot 1664m²
Lot 5761m² Lot 6
703m²SOLD
20 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
THINK BIG!Privately set amongst tranquil surroundingshere is a grand scale home set in a quiet courtlocation.Accommodation oersoerso 5 bedrooms withmain including doubleWIR’s and ensuite pluscentral bathroom.The home oersoerso formal lounge and dining,central family room with adjoining rumpus/pool room plus an undercover outdoorentertaining area.Additional features include double lockupgarage, evaporative cooling, ducted heating,and much more!
Price: $470,000 to $520,000Inspection: BY APPOINTMENTPhoto ID requiredContact: Adam Sacco 0409 033 [email protected]
Unit 7/49 Brook Street, Sunbury3A 1B 1C
DOWNSIZEWITHOUT THESQUEEZE!Brilliantly positioned just minutes from theheart of Sunbury’sy’sy’ main town centre.A spacious light �lled kitchen overlooking theliving areas o�erso�erso� an abundance of storagespace and a large corner pantry which willplease and also �tted with quality applianceswith plenty of space to work.Accommodation includes three generoussized bedrooms with an oversized main withwall to wall BIR’s which share a well-appointedcentral bathroom.
Price: $325,000 to $355,000Inspection: BY APPOINTMENTPhoto ID requiredContact: Adam Sacco 0409 033 [email protected]
60 The Avenue, Sunbury 5A 2B 2C
THE AVENUE...Position speaks for itself in one of the most premium locations of
Sunbury with this splendid �ve bedroom double storey home situated
on a prestigious tree lined street in Jacksons Hill estate.
On entering you are greeted with a large formal entrance, two
bedrooms downstairs with the main bedroom with a largeWIR and
ensuite. This home has three separate living zones spaced throughout
a light �lled open plan kitchen, meals and family room looking out to
the gardens and sized paved undercover area.
Upstairs o�erso�erso� three other bedrooms all with BIR’s and a great storage
room, central bathroom and rumpus room which captures beautiful
SEIZE THE MOMENT!With building commencing within the next 2months, act now and save on stamp duty!All living, kitchen and bathroom areas andbedrooms will create warm, functionalspaces of comformformf t, quality and distinctionand all the homes will be �tted with selectedquality appliances providing owners with thereliability and comformformf t including dishwashers,reverse cycle split system to living areas andremote car garaging.
Price: $345,000+Inspection: {doc.OpenHomeDate}Photo ID requiredContact: Adam Sacco 0409 033 [email protected]
6 Munch Place, Sunbury4A 2B 2C
MAKE YOUR MEMORIES HERE...Ideally situated in a quiet court location withinthe gorgeous pocket of Sunbury at HeadlandPark, this 4 bedroom plus study home presentsa lifestlifestlif yle of contemporary style and in�nitespace.O�erO�erO� ing central lounge and formal dining area�owing through to a vast open-plan living andmeals area and kitchen complete with qualitystainless steel appliances.Other features include evaporative cooling,ducted heating, decorative cornices and higharchitraving, new carpets and timber laminate�ooring.
Price: $465,000 to $505,000Inspection: BY APPOINTMENTPhoto ID requiredContact: Adam Sacco 0409 033 [email protected]
TIME FOR AN UPGRADE?This has been beautifully appointedthroughout, delivering a lifefef style of qualityand convenience.O�e�e� ring large fofof rmal lounge, rumpus room,and gallery style kitchen overlooking themeals area leading out the decked alfresco.Accommodation includes fofof ur bedroomsincluding master with ensuite andWIR plusa further 3 bedrooms with BIR’s’s’ and centralbathroom.Additional fefef atures include ducted heating,evaporative cooling, 16 solar panels, watertanks and so much more!
Price: $445,000 to $480,000Inspection: BY APPOINTMENTPhoto ID requiredContact: Adam Sacco 0409 033 [email protected]
Unit 4/45 Harker Street, Sunbury2A 1B 1C
LOCATATA ION IS KEY!Tucked away in a peaceful complex justminute’s’s’ walk from everything that Sunburythis two bedroom unit o�e�e� rs, open planliving and meals area with a modern spaciouskitchen centralised to overlook an outdoorentertaining area and courtyard framed byestablished plants.Stand out fefef atures include ducted centralheating, split system cooling, single lockupgarage and more not mentioned!
Price: $330,000 to $350,000Inspection: BY APPOINTMENTPhoto ID requiredContact: Adam Sacco 0409 033 [email protected]
DRUM ROLL PLEASE .DDDDRRRDRDDRD UUURURRUR MMMUMUUMUUMU RROOORORROR LLLOLOOLO LLL PPLLLPLPPLPPLP EEEAAAEAEEAEEAE SSSASAASAASA EEEESESSES ..E.EE.E ......RRRiicchhhaarrddd HHHeennrryyis the newest
addition to theLeading RealEstate Team!
22 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
rtedgar.com.au
70 Three Chain Road 24 Fersfield Road
179 McGregor Road 1 Scotia Place
23 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
LUXURY, LIFESTYLE, LOCATION - 1 Acre approx.� Main bedroom with delightful bay-window, WIR & ensuite� Bedrooms 2, 3 & 4 will accommodate Queen sized bed & BIRs� Charming formal lounge room featuring a bay-window� Wide entry leads to a magnificent, open plan kitchen/living area� Newly renovated kitchen with ample bench & storage space� Family/meals area is spacious & filled with light� For the children there is a separate rumpus / games room
ROMSEY $669,000NEW
LISTING
4
2
2
“Country Dreaming”� 4 double bedrooms all with built-in-robes� Kitchen with large pantry, excellent bench space� Open plan dining/lounge with French doors to Verandah� Bathroom with bath, separate shower,er,er vanity & separate toilet� Large laundry/mud room/2nd toilet� Abundance of tank water,ter,ter 5 dams & potential for a bore� Abundance of Tank water,ter,ter 5 dams & potential for a bore
LANCEFIELD $937,000
4
2
2
“A Home to Enjoy for a Lifetime!”1700m2 appx.� Large main bedroom with full ensuite & walk-in-robe� Two more double bedrooms with built-in-robes� Large formal lounge room with Bay Window� Large, open plan family meals area with solid fuel heating� Solid timber kitchen (all electric) with walk-in-pantry� Home office/study with direct access from the double garage� Beautifully established gardens
ROMSEY $420,000
3
2
2
“A Special Touch of Magic” - 20 acres� 5 paddocks for grazing or crops + 2 dams� 3 bedrooms- main bedroom with ensuite BIR� Open plan living/dining/kitchen area� Stylish family bathroom� Library / 2nd living room� Massive shed to hold tractors/trailers with concrete & power� 3.2kw solar system with generous rebate
NULLA VALE/LANCEFIELD $599,000
3
2
2
“Outstanding Lifestyle and Location” – 3433m2� Main bedroom with full ensuite and WIR� Bedrooms 2, 3, 4 and 5 have BIR's� TV room, library, sitting room or play room� Splendid, brand new large kitchen offering all new appliances� Undercover in-ground pool and spa� Very large family bathroom� Open fire place, electric wall heaters in bedrooms & solid fuel heater
ROMSEY $645,000
5
2
2
“Simply Stunning”� Large main bedroom with ensuite & WIR� Queen size second bedroom with BIR� Very spacious, light and bright main bathroom� Beautiful open plan lounge/dining� Large kitchen with a large corner pantry� Undercover alfresco area, perfect entertaining in all weather� Extra long under roof single car garage with built-in-storage
ROMSEY $349,500
2
2
1
“A Vision Splendid” - 22 acres� Master bedroom with ensuite and built-in-robes� Bedrooms 2, 3 & 4 all have built-in-robes� Formal Lounge� Dining room and large family room with cathedral ceilings� Spacious study� Fabulous country kitchen with an impressive walk-in-pantry� Family bathroom and large laundry
LANCEFIELD $696,000
4
2
3
“Such an Elegant Home!”� Spacious main bedroom/parents retreat with ensuite & WIR� Three double bedrooms with BIR� Elegant lounge with gas log fire & adjoining formal dining� Superb kitchen/family/meals – wonderfully light & open area� Large rumpus room/theatre room� Attractive family bathroom� Outdoor entertainment area with wood-fire pizza oven
ROMSEY $515,000
4
2
2
Picture Perfect-1600m2� Main bedroom with bay window, walk-in-robe & ensuite� Bedrooms 2 & 3 have built-in-robes & can accommodate a queen bed� 4th bedroom / Study� Attractive formal lounge� Timber kitchen with adjoining dining/family room overlooking garden� Outdoor entertaining area with covered Gazebo� Family Bathroom
ROMSEY $457,500
3
2
2
Walk Right in and Relax!� Large main bedroom with modern ensuite & WIR� Bedrooms 2 & 3 suits queen size beds with large BIRs� Fourth bedroom/study or rumpus room is an excellent size� Fabulous open plan kitchen/meals/living� Modern family bathroom� Excellent Laundry� Double garage under roof
LANCEFIELD $419,750
4
2
3
24 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Feel at home.
Sunbury 6 Ramsay Court
6 2 2
Opportunity Abounds In This Unique ResidenceWhat a stellar opportunity for the astute investor or large/extended family, with this six bedroom residence, comprising two
distinct dwellings. Nestled in a quiet court minutes to premium amenities, the main residence comprises multiple living areas
including kitchen with gas cooking and dishwasher, three bedrooms, all with BIR's and master with WIR and ensuite. Distinctly
separate, the first floor residence features internal and external access and includes open plan kitchenette/living area, two
bedrooms with BIR's, full bathroom and European laundry.
Auction Saturday 9th April at 11.30am
Open Thu 5.00-5.30pm
Contact Lance Long 0473 026 491
John Dunlop 0419 001 991
Office Sunbury 9744 2555
Gisborne 3/80A Howey Street
3 2 2
Brilliant In All AspectsExceed your expectations in every way with this truly outstanding new three-bedroom
residence, boasting a luxuriously generous floor plan, excellent finishes, gourmet kitchen and
highly attractive locale. Vast bright living/dining/family/Smeg kitchen and plenty of space
outdoors. Tasteful main bathroom, ensuite, central heating, inverter heating/cooling, solar hot
water and remote garage.
Office Gisborne 5428 2800
Rodney Callahan 0418 131 123
Contact Jo Peel 0419 354 294
Open Thu 4.45-5.15pm
Private Sale
Sunbury 7 Oldbury Avenue
4 2 2
Distinguished Family-Friendly Home On Two AcresFour bedroom plus study/fifth bedroom residence, in the prestigious Rolling Meadows Estate
boasts both formal and informal living/dining, meals/kitchen, rumpus, and alfresco
entertaining. Four bedrooms (BIR's) include master (WIR) with ensuite plus additional central
bathroom. Powered workshop, 27,000-litre tank, solar panels, gas boost, integrated double
remote garage, heating/cooling.
Office Sunbury 9744 2555
Contact Lance Long 0473 026 491
Price $950,000
Open Wed 4.30-5.00pm
Private Sale
25 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Contact Janis Paul 0417 560 897SUNSETSTO DREAMOF......SIX BEDROOMBI-LEVEL OFFERSMAXIMUM FLEXIBILITYSituated on approximately 28 acres, with spectacular surround views of Melbourne skyline and elsewhere, this residence is enormous! Comprised ofsix bedrooms, study,study,study gym, four bathrooms and no less than four living rooms. Virtually a mini mansion with a wide balcony to enjoy the spellbindingsunsets. Plenty of good shedding, decked in pool, water tanks galore. Good grazing land – great for horses and bikes too! Rear access to the forestsabounding with wildlife.wildlife.wildlif Enjoy your visitors – beautiful deer and bird parades. Easy commuting - be in Melbourne in well under the hour!Wonderfullifestlifestlif yle opportunity for large or extended family.
GREATSHED
HUGE LANDREAR ACCESS
GISBORNE 6 OLIVIA COURT
E.S.R $780,000-$820,000
Approx 48 squares (450Sqm) residence has rooms for everyone and everything! Comp: Five hugebedrooms, 4 bathrooms, �ne-dining and formal lounge, downstairs study plus upstairs study (with ocestorage and gym) kitchen, family room, plus separate rumpus. Ideal for grand entertaining and familyliving, or work from home. Massive quality shed plus DLUG on huge block of 2669SQM (approx) withaccess fromMill Street. Walk to town, cafescafescaf and park. Enormous and lovely!
JUSTLISTED
GISBORNE 13/75 HAMILTON STREET
$549,000
With an idyllic axis for relaxation and township convenience, this fresh and better than new,new,new residencehas a design emphasis that’st’st’ crisp and contemporary. Walk to all the wonderful facilities of Gisborne andenjoy a new easy living lifestlifestlif yle. Classy and well laid out, with neutral décor toning, the residence hasthree bedrooms, two bathrooms and two living rooms. There’se’se’ a total of three decked areas, a remotecontrolled double garage and two car park, plus room for a vegie garden, and pets area. Absolutelyspotless, fresh and lovely,ly,ly this home is an ideal purchase for a multitude of buyer category!
26 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
82 Main Street, RomseyJulie Ellis 0409 433 699
Property Manager
Ph (03) 5429 6842James Shalders 0412 136 578
Licensed Sales Agent
Fax (03) 5429 6846Jane Lansell-Smith 0412 457 881
Licensed Sales AgentEvery precaution has been taken to establish accuracy of the above information but does not constitute any misrepresenation by the vendor or agent.
30 minutes from Melbourne airport and 50 minutes from CBD
Wishingall a happy,
safe andsuccessful
Easter.Hop into Connallys for
all your Real Estateneeds.
CLARKEFIELD 477 SUTHERLANDS ROAD A 3 B 1
Multiple options for anyone wanting a Country property with easyaccess to Melbourne
Proximity to Melbourne with Panoramic Views and Oodles of Water
• Approx. 43 acres of land, in 4 paddocks• An abundant bore capable of producing
large amounts of water per hour.• Dam as well as Jacksons Creek as a boundary,
plus 20,000 litre tank• 4 paddocks all with water via troughs or creek• Hayshed, machinery shed and shearing shed
all with power,r,r plus assorted other shedding• House has 3 double bedrooms with BIRs• 1 bathroom with separate WC.• 2 living areas, high ceilings, slow combustion
�re• 10 squares of wrap-around verandah• Kitchen with electric appliances, range-hood,
27 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Price $459,000
View Sat 2 April 12-12.30pm or by appointmentSandi Barry-Mueller 0408 392 347
Woodend 3 Sullivans RoadApple Tree CottageCaptivating double fronted Victorian featuring three bedrooms set before a delightfully private north-facing back yard and professionaly landscaped garden. An abundance of heart-warming character and complimented by a lovely inner town location.
Woodend 2 Gwendoline AvenueWhen Only the Best Will DoBeautifully presented high quality residence comprising 4 light �lled living spaces, 4 bedrooms, study/library, and 2 bathrooms. Sensational outdoor living spaces accessed from a wonderful indoor/outdoor room with bi-fold doors both sides, perfect for all seasons. All of this on a large block of 995m2 in the heart of town.
Price $795,000
View Sat 2 April 11-11.30am or by appointmentSandi Barry-Mueller 0408 392 347
Price $675,000
View Sat 2 April 11-11.30am Sat 9 April 12.30-1pm Sandi Barry-Mueller 0408 392 347 John Keating 0419 880 444
Woodend 3 Lilley CourtFamily living on 1994m2 (approx. ½ acre)Superb four bedroom plus study, three bathroom residence comprising kitchen/meals area featuring Smeg and Miele appliances, dining room, sunken lounge/living rooms, study, and automated double garage. Enjoy established living in a sought after address.
ONLY TWO BLOCKS LEFT IN ONE OF WOODENDS MOST BEAUTIFUL AND SOUGHT AFTER BOUTIQUE DEVELOPMENTS.
Dont miss this opportunity to purchase a sensational 1360m2 site which has some lovely established garden and trees and the huge bonus of a bore, or 1071m2 with a northern street frontage of 35m.Maple tree lined quiet court location, picturesque and undulating setting, all town services available and only 1km to the V-Line fast train and 1.3km to the Woodend Town Centre.
Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!Safety testing, tagging and much much more!
www.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.auwww.calcoelectrical.com.au“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”“Servicing the local community for over 37 years”
Established 1999Skilled, courteous, trustworthy tradesmen
One call, all trades 13 11 98 1139
776-
PB26
-14
PREPARING HOMES FOR SALE
CALL DOM 0409 899 959
1221
098-
LB12
-16
V Home Maintenance
REGHON MOWING
PH BRIAN 0419 543 348 1133
417-
LN19
-14
Grow your business with Trades and
Services
Call 1300 666 808
From plumbers to pest control, carpet cleaning to building services, dry cleaning to computer repairs, lawn mowing and more, Network Classifieds has been connecting local businesses with the local community with our Trades and Services each week.
Speak to our classified team and find out how easy it is to advertise. Start building your brand today and be seen every week in the Network Classifieds Trades and Services.
1197
413-
DJ3
6-15
“Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The “Advertising in The
Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly Ranges Star Weekly
is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of is an efficient way of
generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We generating business. We
are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We are getting results. We
are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the are very happy with the
service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too service and there is too
much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we much to mention that we
AARON’S TILINGOver 30 Years Experience Specialising In: • Floor & Wall Tiles • Old & New Homes • Kitchen & Bathroom Renovation Free Measure & Quote.
0432 774 645 G6723428AA-dc29Apr
Placing your classified advert is so easy...
Phone: 1300 666 808 (Open 8.30-5pm Mon-Fri)
Fax: 03 5945 0667Email: [email protected](include your name, address and phone number)
Mail: Network Classifieds, PO Box 9, Pakenham VIC 3810We accept payment by: VISA/MASTERCARD/EFTPOS(1.5% credit card processing fee applies. Cheques and money orders can be posted in or hand delivered to our local office)
Ask about our discounted ongoing advertising rates and how choosing more newspapers gives your advertising more impact and saves you money...
DEADLINESAll Classifieds: 10am Monday
1140
405-
HM
25-1
4
Established 1999Skilled, courteous, trustworthy tradesmen
For a Free Quote Call
13 11 98
1139
777-
PB25
-14
V Garden ServicesV Deadline V Trades Business Profile
Trades & Services
29 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
General Classifi edssection of Network Classifi eds.
Real EstateBuy, Rent & Sell in the
section of Network Classifi eds.section of Network Classifi eds.section of Network Classifi
Real EstateBuy, Rent & Sell in the
section of Network Classifi eds.section of Network Classifi eds.section of Network Classifi
Find your Local Specialist in our
Professional Servicessection of Network Classifi eds.
www.aplo.com.au
1189
429-
HM
26-1
511
8942
9-H
M26
-15
Suppliers & installers of:
68 Barry Road, New Gisborne
Phone - 1300 Escort1300 372 678.
24hrs/7 days. swa4281be.
V Windows
GISBORNE MINI SKIPS/DINGO HIRE3, 4, 6, 8 & 10 CUBIC METRE SKIP BINS
The original provider servicingMacedon Ranges and surrounding areas
Phone: (03) 5428 1871Mobile: 0439 375 140
G6326766AA
-dc24Sep
��DELIGHTFUL��Full Body Relaxation10.00am-8.00pm Mon-Sat
Room 14, building 2Techno Park Dve Williamstown
9397 0347 swa4576xbe.
ALL FETISH! Anything goes!from 99c/min 1300 700 904
1902 226 323 Chat now!$5.45/min pay/mob extra
Full Body RubsRelax by appt. 10am-10pm.
swa3961xe. 0469 772 431
V Adult PhoneTalk
5428 1798 or 0428 518 1595428 1798 or 0428 518 1595428 1798 or 0428 518 1595428 1798 or 0428 518 1595428 1798 or 0428 518 159
WATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGWATER BORINGDK & EM MurrayDK & EM Murray
Over 60 years experience in Macedon Ranges
1160
137-
LB43
-14
-14
Far Eastern RelaxationDay special $105 1/2 hour.
77 Racecouse Road, Nth Melb.9326 8388. swa6144b.
V Water Solutions
1300 EscortCasual Drivers required for afterhours and weekend work. Noexperience needed. Must bereliable and have own car.Phone 9935 7798.
V Adult Services
1209
632-
CG49
-15
1209
632-
CG49
-15
1209
632-
CG49
-15
MACEDON RANGES MINI SKIPSGISBORNE BASED
SERVICING THE MACEDON RANGES &SURROUNDING AREAS
2, 3, 4, 6, 8, 10 (Cubic Meters)Walk In Bins AvailableWalk In Bins AvailableWalk In Bins Available
If paying rent and raising a family is making it difficult to save the deposit for
that dream home.... don’t worry.
DON’T MISS OUT, CALL NOWYou will be delighted with our offer.
Don’t wait until its too late.
*Conditions Apply*
V House & Land
1136373-RC22-14
ALL ADVERTISEMENTS bookedunder this classification arestrictly for ancillary roles only.To comply with the law it is stillan offence under the Sex WorkAct 1994 to publish anystatements intended or likely toinduce a person to seek work asa sex worker.
RING-A-BIN
2M, 3M, 4M, 6M & 9MWalk in bins available
Macedon Ranges / Sunbury based/ Gisborne7 days a week
Support your local business
1300 746 422 0418 392 622
1142
426-
LN27
-14
Real EstateV Rubbish Removal V Adult Phone
TalkV Adult
Employment
P.M. TREE LOPPINGT
T TDAVID McINTOSH (Manager)QUALIFIED ARBORISTPhone: 5428 6359 or 0418 526 769
� Full Insurance� All work Council approved� 15 years guarantee� All Council permits supplied� 100% computer levelling� Concrete pump used� 15 years experience� For a free quote and advice
Contact Simon:9309 0700 - 0411 174 000
�����5
STAR
G6638324AA
-dc18Feb
RomseyFirewood
Excellent QualityRedgum
3m split......... $140 pcm6m split..........$130 pcm12m split........$125 pcmFree Delivery All areas
Phone Peter0418 384 796
CLASSIFIEDSEARLY DEADLINES
EASTERClassified deadlines for Tuesday 29th Marchissue of the Sunbury / Macedon Ranges Star
Weekly are as follows:THURSDAY 24TH MARCH
Classifieds - 9:30AM1206
174-
KK
46-1
5
Australian Restumpers Group®
0437 841 947 9333 0038 1219
743-
DJ10
-16
• Travel Tower • Fully Insured ($20m) • Stump Grinder • Electrically Certifi ed • Stump Grinder • Electrically Certifi ed • Stump Grinder • Electrically Certifi• Mulcher • Trained Staff• Mulch For Sale • Qualifi ed Arborist• Mulch For Sale • Qualifi ed Arborist• Mulch For Sale • Qualifi
9744 3033 ~ 0488 393 799
TREE LOPPING & REMOVAL
1171
129-
KC
5-15
• Computer Levelling • Council permits supplied • Stumps for new extension • Engineers plans and soil test supplied Free Quote and advicePh: 0416 033 003 or 9338 3668 (AH)Ph: 0416 033 003 or 9338 3668 (AH)
New rules apply to the advertising of dogs and cats
for sale.It is now an offence to advertise the sale of a dog or cat unless
the microchip identifi cation number of the animal is included in the advertisement or notice. A registered domestic animal business may use its Council
business registration number as an alternative.
For further information,call 136 186 or visit
www.dpi.vic.gov.au/pets 1021
249-
PJ16
-12
V Reblocking/UnderpinningV Tiling
V Pets & Services
1221146-LB12-16
Packaged LiquorLicence ApplicationWe Asia Finest Pty Ltd applied to the Victorian Commission for Gambling and Liquor Regulation on 21st January 2016 for the application of a packaged liquor licence at Shop 4-5, 106-126 Gap Road, Sunbury VIC 3429.
Any person may object to the grant of thisapplication on the grounds that:
situated, and/or
or abuse of alcohol.
An objection must state the reasons for the objection.
V FirewoodAll BICKLES RUBBISH REMOVAL� Cheap Rates � Pensioner Discount
� We Load For You � Free QuotesJEFF 9744 1401 - 0418 998 823
G6690082G6690082
G6656363AA
-dc25Feb
THE GAS CHIEFCall Rowdie McIntosh
Ph: 5367 7756 or 0438 536 150
for all your Natural and LP Gas appliance repairs
for all your Natural and LP Gas appliance repairs
for all your Natural and LP
� Central Heaters � Cookers� Space Heaters � Hot Plates� Hot Water Units
Space Heaters Hot Water Units Space Heaters
� Wall OvensIf it’s got gas we’ll fix it!
Licensed Natural Gas Conversion SpecialistLic. No. 24391
The ForumGentleman’s Club
Open Midday till late 7 days a week.Air conditioned self contained rooms.
Private introductions available. New ladies on roster.
Guess who is back?!?Easter Trading:
Closed Good Friday & Easter Sunday.Easter Saturday open midday till late.
Normal Business hours return from Easter Monday.Melton’s only licenced brothel.
20 Norton Drive, Melton Phone 03 9746 8922 SWA9
076b
e
1220
398-
PB
12-1
6
SKIP IT BIN HIREFriendly Prompt service
2m, 3m, 4m, 6m & Walk ins available
Phone Geoff 1300 275 474Or 0417 740 310
www.skipitbinhire.com.au
Bin prices from $120*
1213
415-
RC04
-15
*Conditions Apply
1210
438-
CG
50-1
5
Community Engagement Reference Group Expressions of InterestWestern Water is seeking members for its new face-to-face Community Engagement Reference Group.The group’s role is to provide a direct link between the Board and customers, local businesses and organisations to help Western Water e�ectively engage with our community about matters of strategic and operational importance to the business.A copy of the group’s Terms of Reference which include further details of the group’s role and the selection criteria for membership can be obtained at WesternWater.com.auWritten expressions of interest in joining the group close on 27 April 2016. Please send your expression of interest to [email protected] or to Western Water, PO Box 2371, Sunbury DC VIC 3429.
1221483-LB12-16
V Adult ServicesV Rubbish RemovalV Plumbing V Public Notices and Event
Trades & Services General Notices General Classifi eds
30 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
$27$27$ .0027.0027
$27.00$29.00$31.00$33.00
2 Papers $5.50 EXTRA 3 Papers $11 EXTRA 4 Papers $16.50 EXTRA 5 Papers $22 EXTRA 6 Papers $27.50 EXTRA
*Offer only available for items normally advertised in the “For Sale” or “Motoring” section. All advertisements must be pre-paid. For $27.00 you get a 15 word ONE ITEM ONLY advertisement, restricted to “For Sale” or “Motoring” items only for private advertisers, run initially for 3 months or untl sold. After your advertisement has run for 3 months you must call us to renew it for a further 2 week period AND reduce the price of your item by a minimum 5% for items in the “For Sale” section or 3% for items in the “Motoring” section. After 2 weeks you must then call us again to renew for another 2 weeks and again reduce the price ofyour item by a further 5% or 3%. This procedure may continue until you have sold your item. If we do not hear from you we will assume you have sold your item and your advertisement will not appear. The sale price must be included in the advertisement and the only alterations you may make are to the PRICE of your item. Business advertisements, rental hire and real estate are not included in the offer for the purpose of ongoing profi t. The publisher reserves the right to decline any booking for the purpose of ongoing gain.
Call or visit us online!networkclassifi eds.com.au
Employment
Motoringsection of Network Classi Motoringsection of Network Classi Motoring
eds.Motoring
eds.Motoringsection of Network Classi eds.section of Network Classi Motoringsection of Network Classi Motoring
eds.Motoringsection of Network Classi Motoring
Buy & Sell in our
Office Manager Wanted
Full time Office Manager for a residential care
facility in theLoddon Mallee Region.Relevant qualification or working experience
SALES ASSISTANTRequired for a busy retail store,a reliable and motivated person,Mon - Fri, 9am to 5pm. Junioraward applies. Woodend. Emailresume to: [email protected]
V Positions VacantV Positions Vacant
Courses start MARCHYou may be eligible for a Vic & Commonwealth Govt. subsidy.
$84 to $507 for Hairdressing
Ring Cheryle on 9329 9544Academy of Hair & Beauty
Toid 3572
www.thehairacademy.com.au
Hair and BeautyCourses start MARCH
Hair and BeautyCourses start MARCH
1218
789-
RC
09-1
6
V Training And Development
1300 666 808or email us sales@networkclassi eds.com.auor email us sales@networkclassi eds.com.auor email us sales@networkclassi
Place your advertisement by calling
Not just a new name… but also a new look with new sections. However, you will still get the same easy to read, easy to use information packed section you have grown to love each week.
BRINGING TOGETHER A HUGE NETWORK OF QUALITY COMMUNITY NEWSPAPERS THAT CAN WORK EVEN HARDER FOR YOU.
Call Bernadette:0408 807 466 7 days per weekExperienced HR Manager able to assist with FREE Résumé FREE Résumé FREEAssessment, Career Advice,Cover Letter, Key Selection Criteria, Document Writing,Interview Coaching, Coursesand LinkedIn Profile Writing.
JAYCO Heritage caravan, 2005,25 foot, 30th anniversary model,full shower & washing machine,2 way fridge, microwave, fullstove/oven/griller, 3 gas burn-ers, electric hotplate, flatscreenTV, DVD & video, reverse cycleheating/cooling, inner springmattress, outside awning, dou-ble axle, 4 new tyres, jerrycontainer brackets on the rearwith spare wheel, overall lengthwith draw bar & spare, 24 foot,10 inch. $32,000 negotiable.Phone: 0419 009 148.
DISCRIMINATION INADVERTISING IS UNLAWFULThe Victorian Equal Opportunity Act 1995 makes itunlawful for an advertiser to show any intention to
discriminate on the basis of sex, pregnancy, race, age,marital status, political or religious belief or physical
features, disability, lawful sexual activity/sexualorientation, HIV/AIDS status or on the basis of being
associated with a person with one of the abovecharacteristics, unless covered by an exception under
the Act. As Network Classifieds could be legally liable ifan unlawful advertisement is printed, Network
Classifieds will not accept advertisements that appearto break the law. For more information about
discrimination in advertising, contact your legal advisersor the Equal Opportunity Commission.
1193
284-
LB31
-15
Specialising inBlack Forest
03 5427 2693Mention this ad for a 10% discount
Tyre and Auto
1221
432-
ACM
12-1
6
FORD, Fairmont AU wagon,2000 model, duel fuel, LPG gas,VGC, 205,000kms, automatic,front and rear power windows,CC, AC, always garaged, MP3player, with roadworthy.QGH-291. $4,950. 0412 217 087.
V Positions Vacant V Professional V Auto Services/ Repair V Motor VehiclesV Caravans &Trailers
Employment Motoring
31 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
SPORT
Having claimed the Riddell District Netball League premiership last season, Riddell will increase its focus on bringing local talent into the club this season.
As the most dominant team of the past two years, the Bombers are again in the mix with what looks like a strong line-up ahead of the season’s April 16 opening.
New A-grade coach Jarrad Walker says he’s happy with where his side is sitting and thrilled with the numbers at try-outs and training.
Walker also coaches Victorian Netball League side Wilson Storage Southern Saints in division 1.
“�ere’s been a lot of interest in the B, C, and under-19 grades and big numbers have shown up,” he said.
“Instead of getting people from outside, we wanted to look at what was around our area and try to get them to the club. It gives me a lot of heart to give opportunities to other girls to step up into A-grade.”
�e A-grade side will be di�erent from last year’s premiership line-up. Jess Kennedy, Danni Davidson and Mikeala Vaughan are among those not returning.
“Jess is in the AFL women’s academy … she wanted to focus on her football this year,” Walker said. “It’s exciting for her, but I’m disappointed. She will hopefully help out with a few games when football allows it.
“Danni and Mikeala decided, with their other netball commitments, not to play.”
Christine Harris and Lauren Close will again be the leaders on court.
“Ellen Close is stepping up from B-grade, while Meikah Johns, an under-19 player, will also play A-grade,” Walker added.
Joining them will be sharp shooter Bec Colwell, who’s crossing from Macedon, and defender Danielle Wilson.
“A lot of the junior players are excited to have Bec at the club,” Walker said. “For them to see a player of her ability playing for us … she’s someone they can look up to.
“Danielle has played plenty of country netball but never in the RDNL. She has played VNL.”
Walker, who was helping out last season, said there had been a lot of phone calls between him and outgoing coach Lauren Close, who will coach the C-grade side with Harris this time round.
Tanya Cro�, Yasmin McGregor and Michelle Rix will coach the other sides.
Tara Murray
Bombers opt for new blood
By Tara Murray
A strong defensive e�ort from Sunbury Jets set the scene for their win in the opening round of Big V women’s division 1.
Facing last year’s grand �nalists, the Jets broke the Geelong Supercats’ game open in the third quarter to run away with a 63-48 win.
For the �rst quarter and a half, it looked a tight contest with both teams testing each other.
Candice Rogers dominated for the Cats and scored most of her 26 points during this period.
�e Jets then stepped up defensively, with captain Chelsea Burns leading the way to have her team in front by a point at half-time.
Defensively, the Jets stepped up in the third quarter, restricting the Supercats to just seven points, including only two �eld goals.
�e Supercats couldn’t close the gap until the last few minutes of the game when it was already well and truly over.
Sharon Plichta adds experience to the Sunbury line-up. (Shawn Smits)
Jets blast off in Big V Jets coach Kennedy Kereama said it was
pleasing to get a �rst-up win.“We were really cautious of the opposition
and knew it would be tough.“�e scoreline didn’t really re�ect the game
and I felt we had to battle really hard for each point. �at’s a testament to Geelong. We made some tough shots.”
Kereama said the side made some changes to the defensive end to try to restrict the in�uence of Rogers … and it paid o�.
He paid credit to Burns, who �nished the night with seven steals and nine defensive rebounds.
“She showed some great leadership in the game and was obviously voted as captain by the girls for a reason,” he said.
“She probably sparked our defensive e�ort and the other girls obviously followed and everyone chipped in.
“We made some adjustments defensively. Obviously, Candice hurt us badly in the �rst
half. Not only was she dominant and smart with her play, she had two of our players on three fouls in the �rst quarter.
“To hold them, or any team, to seven points in a quarter is a really good e�ort. We had to make some adjustments and play a bit of zone … teams probably don’t practise a lot against zone early in the season.”
As Kereama expected, there was no stand-out scorer, with three players, Burns, Emma Mahady and Monique Stevens, in double �gures.
“�at’s probably going to be our strength, having everyone make contributions,” the coach said. “Having that depth, we know we’ll have players who can score.”
�e Jets also unveiled another signing: veteran Sharon Plichta, a championship winner with Altona and Werribee. “For me, she brings experience and leadership to the group,” Kereama said. “And she knows how to put the ball in the hoop.”
Mission accomplished, Rupo coach moves onRupertswood reigns in the Gisborne and District Cricket Association B-grade competition a�er a comprehensive grand �nal win over St Anthonys.
Rupertswood was well and truly in control of the match at its home ground a�er the previous weekend and didn’t take long to wrap it up on Saturday.
St Anthonys resumed at 5-80, chasing 212, and was quickly in even deeper trouble when Rupertswood grabbed an early wicket.
From there it was plain sailing for Rupo with St Anthonys skittled for 109.
Only Lucas Alaimo o�ered any resistance with 57.
For Rupertswood captain-coach John Lane, the win completed a journey back to the top grade which started a�er the team was relegated from the McIntyre Cup in 2012-13.
“It’s exciting to be premiers and back in McIntyre,” Lane said.
“Aaron [Forward] bowled a treat with his eight overs and put us in the box seat so we could win comfortably.”
Despite being in apparent control, Lane said there was a small change of game plan during the week.
“We decided to bowl straighter to their guys who liked to free their arms a little bit,” he said.
“Aaron and Brandon Webber bowled from one end and I bowled nine overs from the other and they couldn’t get us away.”
Kyahl Anderson was named man of the match for his 76 made on day one a�er coming into the senior team in only the �nal round of the season.
“He batted at four and had only played one game for us during the year,” Lane said.
“He’d played �rst XI for us before and made three hundreds in the thirds, but his restricted availability meant he couldn’t play a lot of �rst XI cricket.
“Once we knew he was quali�ed for �nals, we started feeding him balls in the �rst XI net to
get him ready to play in the top team and hoped he would get runs.”
�e premiership ends Lane’s time as captain-coach. A�er being in charge when Rupo dropped from McIntyre Cup, he returned this season because of “un�nished business”.
“I’ve ful�lled my commitment to get them back into McIntyre Cup,” he said.
“�e club is in a good position and someone else will have the opportunity to lead them in McIntyre. I’ll still play some cricket next year, but I won ’t have the same commitments as this season.”
Tara Murray
SPORT STARWEEKLY.COM.AU
32 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
SCOREBOARD CRICKET
VICTORIAN PREMIER FIRSTSSemi-�nals, Sat 19 & Sun 20 MarchMelbourne v Ringwoodat Camberwell Sports GroundMELBOURNE 1st InningsM BROWN b Holland . . . . . . . . . . . . . . . . . 3A KENT lbw b Holland . . . . . . . . . . . . . . . . 1M HILL c Loorham b Holland . . . . . . . . . . 30S GOTCH b Holland . . . . . . . . . . . . . . . . . 31S HARPER lbw b King . . . . . . . . . . . . . . . . 0L EDWARDS lbw b ToppARDS lbw b ToppARDS lbw b T . . . . . . . . . . . . . . 36B McDONALD c Loorham b Holland . . . . . 10J KOOP lbw b King . . . . . . . . . . . . . . . . . . 3W RYAN lbw b KingYAN lbw b KingY . . . . . . . . . . . . . . . . . . 0J COLEMAN not out. . . . . . . . . . . . . . . . . . 2P SMITH c Loorham b King . . . . . . . . . . . . 0Extras (2lb 1nb). . . . . . . . . . . . . . . . . . . . . 3Total . . . . . . . . . . . . . . . . . . . . . . . . . . . 119Fall: 3, 16, 43, 44, 94, 114, 117, 117, 117, 119Bowling: M Topp Topp T 14-3-29-1, I Holland 18-9-20-5, D King 11.1-5-12-4, J Freeman 2-1-5-0, M Fotia 3-0-14-0, B Walsh 8-0-37-0 Overs: 56.1RINGWOOD 1st InningsJ FREEMAN not out. . . . . . . . . . . . . . . . . 56D KING not out . . . . . . . . . . . . . . . . . . . . 66Extras (3lb 1nb). . . . . . . . . . . . . . . . . . . . . 4No wicket for . . . . . . . . . . . . . . . . . . . . . 126Bowling: J Coleman 10-5-11-0, P Smith 5-1-19-0, J Koop 6-1-20-0, B McDonald 7-2-26-0, L Edwards 3-2-3-0, M Hill 4-1-19-0, W Ryan 2-0-17-0, M Brown 2-0-8-0 Overs: 39.Result: Ringwood wonUmpires: S Craig & P Gillespie
Fitzroy Doncaster v Prahranat Schramms Reserve, DoncasterFITZROY DONCASTER 1st InningsM BREMNER c Hartley b Seymour . . . . . . 26J BLYTH c Hancock b WJ BLYTH c Hancock b WJ BL ilcox . . . . . . . . . . 20T SHEEHAN b Grimwade . . . . . . . . . . . . . 18P DICKSON c Bull b Grimwade . . . . . . . . . 77N VARDI c Hartley b Seymour . . . . . . . . . . 47M FRITH c & b Wilcox . . . . . . . . . . . . . . . 58T LAWFORD c Dhull b Grimwade. . . . . . . . 46L BANTHORPE lbw b Wilcox. . . . . . . . . . . . 2E ALAVI b WE ALAVI b WE ALA ilcox . . . . . . . . . . . . . . . . . . . . 1S DUCKWORTH c Hartley b Grimwade. . . . . 6A PERRIN not out 4Extras (2w 4nb) . . . . . . 6Total . . . . . . . . . . . . . . . . . . . . . . . . . . . 310Fall: 47, 54, 89, 164, 219, 290, 292, 300, 300, 310Bowling: M Wilcox 23-3-77-4, A Hutton 8-1-42-0, S Seymour 17-1-68-2, S Grimwade 30.1-6-78-4, S Miller 10-0-30-0, A Dhull 5-1-14-0Overs: 93.1PRAHRAN 1st InningsA BULL c Banthorpe b Frith . . . . . . . . . . . 37J HANCOCK b Perrin . . . . . . . . . . . . . . . . . 9R BRICKER c Sheehan b Perrin . . . . . . . . 31S MILLER lbw b Lawford . . . . . . . . . . . . . 67R HARTLEY c Blyth b Perrin . . . . . . . . . . . 73A DHULL b Perrin . . . . . . . . . . . . . . . . . . . 9S SEYMOUR not out . . . . . . . . . . . . . . . . 34S COATES c Banthorpe b Perrin S COATES c Banthorpe b Perrin S COA . . . . . . . . . 2M WILCOX b Perrin . . . . . . . . . . . . . . . . . . 1A HUTTON c Sheehan b Perrin . . . . . . . . . . 1S GRIMWADE run out . . . . . . . . . . . . . . . . 3Extras (10lb 8nb) . . . . . . . . . . . . . . . . . . 18Total . . . . . . . . . . . . . . . . . . . . . . . . . . . 285
Fall: 24, 68, 87, 210, 238, 251, 253, 257, 271, 285Bowling: A Perrin 18-3-71-7, T Lawford 22.3-2-85-1, M Frith 10-1-28-1, S Duckworth 13-3-50-0, E Alavi 9-0-41-0Overs: 72.1.Result: Fitzroy Doncaster won.Umpires: A Barrow & M Hanton.
WOMEN’S PREMIER SECONDSFinalCOBURG v MELTONCOBURG v MELTONCOBURG v MELat Shepley Oval, DandenongCOBURG InningsE WHITFIELD run out . . . . . . . . . . . . . . . . 7N TUILAGI run out. . . . . . . . . . . . . . . . . . . 3R MELTON lbw b RobinsonR MELTON lbw b RobinsonR MEL . . . . . . . . . . . . . 2A HOLLAND b Polkinghorne . . . . . . . . . . . . 0C MORROW run out . . . . . . . . . . . . . . . . . . 5K ENNOR not out . . . . . . . . . . . . . . . . . . 25C COGHILL b Surace . . . . . . . . . . . . . . . . 17G PEEL b Garwood. . . . . . . . . . . . . . . . . . . 0J PEARSON b Polkinghorne . . . . . . . . . . . . 0D LOUGHNAN c & b Martin . . . . . . . . . . . . 7M KORNET b Garwood . . . . . . . . . . . . . . . . 0E QUINN not out 0Extras (2b 4lb 19w 2nb) 27Total . . . . . . . . . . . . . . . . . . . . . . . . . . . . 94Fall: 4, 6, 15, 18, 23, 53, 56, 61, 87, 94Bowling: B Polkinghorne 9-2-13-2, A Robinson 6-1-19-1, S Di Mauro 5-2-16-0, J Surace 9-3-15-1, K Garwood 8.1-2-18-2, N Martin 4-2-6-1Overs: 41.1MELTON InningsMELTON InningsMELS DI MAURO not out . . . . . . . . . . . . . . . . 34L SHAW b Loughnan . . . . . . . . . . . . . . . . . 3S THEODORE lbw b Morrow . . . . . . . . . . . 18B POLKINGHORNE b Quinn . . . . . . . . . . . . 4J SURACE not out . . . . . . . . . . . . . . . . . . 24Extras (1b 8w 3nb) . . . . . . . . . . . . . . . . . 12Three wickets for . . . . . . . . . . . . . . . . . . . 95Fall: 4, 25, 41Bowling: D Loughnan 7-3-18-1, C Coghill 9-3-13-0, C Morrow 9-2-18-1, J Pearson 4.1-1-15-0, E Quinn 9-2-18-1, M Kornet 2-0-13-0Overs: 40.1.Melton wonUmpires: C Hall R Harrison
PREMIER LOWER GRADESSemi-�nalsSeconds: Melb Uni 2-64 v Fitz Donc, St Kilda 1-15 v Ess 9-167.Thirds: Melb Uni 1-33 v Geelong 163 (Reid 72no Condy 36 Van Cuylenburg 4-21 Grant 3-56), Carl v Monash Tigers 9-246 (Cross 42 Krelle 42 Humphries 39 McKenna 35no O’Sullivan 4-57).Fourths: Monash Tigers 150 (O’Brien 5-37 Mills 3-21) v Carl 2-0. Melb Uni 9-257 (Hyde-Smith 121 McIntosh 45 Drukeshkumar 3-27 Wilkinson 3-57) v Dand.Women: Firsts: Box Hill 5-204 (Brock 57no A Lanning 53 Grif�ths 49) d Melb 199 (Jensen 47 Yates 42 Crowley 35).
VSDCAGrand-�nalsNorth East 1st XI: Bayswater 124 v Mt Waverley. 2nd XI: No Play. South west 1st XI: Oakleigh 8-221 (Mcguinness 62 Allen 54) v Caul�eld. 2nd XI: Malvern 196 (Gill 50) v Williamstown. North West 3rd XI: Brunswick 42 (Rycroft 6-9) v Yarraville 4-134 (Doyle 57 No Leach 52). 4th XI: No Play. South East 3rd XI: No Play. 4th XI: Bayswater 102 v Oakleigh 4-23.
METROPOLITANMETROPOLITANMETROPOLITFerntree GullyGrand-f: Norm Reeves Shield: Knox�eld 208 d The Basin 174. Stephen Lee Medalist: T Boxell. DeCoite Shield: Upper Ferntree Gully 8-212 v Lyster�Lyster�L eld.
RingwoodGrand-f: Trollope Shield: Wantirna South 2-96 d North Ringwood 95. Wilkins Cup: Lilydale 6-178 d Montrose 177. Newey Plate: North Ringwood 43 & 6-(dec) 158 d Wantirna South 53 & 76. Pascoe Shield: Montrose 8-141 d Ainslie Park 140. A: Heathmont Baptist 104 d Warranwood 100. B: South Croydon 8-142 d Ainslie Park 138. C: Wonga Park 142 d St Andrews 90. D:Warrandyte 8-120 d East�eld 8-117. E: Wonga Park 4-96 d Kilsyth 59. F: Wonga Park 108 d South Croydon 103.
Western Suburbs Churches & CommunityGrand-f: A.E. Lowe Shield: Williams Landing 9-252 (R Taneja Taneja T 87 S Sharma 56) d Eynesbury Eagles 109 (M Bhaskar 6-47). Bill Honey Shield: Semi-f: Western All Stars 5-148 (G Shanks 56 J Davies 42) d Rockbank 98 (E Hemmingson 4-15), County West 258 (J Singh 144 C Arachchilage 4-45) d Western Lions 108. Tasman Tasman T Smith Shield: Grand-f: St Johns 9-215 (S Taafe 79D Nagpal 4-53) d WTaafe 79D Nagpal 4-53) d WT est Melbourne 122 aafe 79D Nagpal 4-53) d West Melbourne 122 aafe 79D Nagpal 4-53) d W(A singh 52S Morgan 49).
BOWLSBOWLS VICTORIA - SATURDASATURDASA Y METROPOLITTURDAY METROPOLITTURDA AN PENNANTY METROPOLITAN PENNANTY METROPOLITFinalsDiv 1: Croy (1) 85 MCC (1) 80. Div 2: Diam Ck (1) 96 Pak (1) 76. Div 3: Mulg CC (3) 82 Ess (3) 69. Div 4: Mord (2) 58 Bays (2) 72. Div 5:Whitt (3) 77 N Bal (2) 69. Div 6: Epp RSL (2) 81 Black (4) 72. Div 7: Semi-�nals: Dand Clb (3) 62 Bruns (3) 67, Palm Lake (1) 93 Bent (4) 65. Div 8: Cran RSL (4) 34 Dand RSL (1) 5
BV MIDWEEK METROPOLITAN PENNANTBV MIDWEEK METROPOLITAN PENNANTBV MIDWEEK METROPOLITDivisional Finals Women’s Round Robin Rd 2: Wav Glf (1) 53 Sunb (1) 62. Semi-f div 1: Bund RSL (2) 79 Donv (1) 54, Mid Pk (1) 51 Croy (1) 59. Div 2: Bays (1) 55 Deer Pk (1) 59, Mord (1) 48 Ber (2) 66. Div 3: Fitz Vic (1) 67 Keil (1) 62, Mid Pk (2) 58 Cran RSL (1) 61. Qtr-f div 4: Donc (4) 76 Pak (3) 49, MCC Kew Spts (3) 59 Hamp (3) 58, Ess (3) 48 Mulg CC (7) 62, Keil (3) 64 Palm Lake (2) 52. Div 5: Round Robin Rd 2: Pres/Res (3) 55 Y Val CC (2) 2
BV U-18 SINGLES CHAMPIONSHIPRound 1Boys: Sec 1: C Hanley (Melb). Sec 2: M Trewren (E Shep). Sec 9: B Andrews (Moon V). Sec 10: EHiggins (Sunb). Sec 11: J Davies (Fitz). Sec 12: JYates (Glenr). Girls: Sec 1: T Trewren (E Shepp). Sec 5: M Long (Glenr).Sec 8: L Trewarne (Glenr).
GOLFGV METROPOLIAN PENNANTRound 1Men: DIV 1: METROPOLITAN METROPOLITAN METROPOLIT 6 bt SANCTUARY LAKES 1 (D Micheluzzi bt J Cooper 5-3 L Michel bt J Cooper 2 up B Collyer bt B O’Donoghue 6-5 A Didone bt T Sharpe 5-3 M Roberson bt M Gill 4-3 N Brown bt C Grigson 3-2 T Hardham lost to J Ward 2-1), THE NATIONAL NATIONAL NA 5 bt THE HERITAGE HERITAGE HERIT 2 (S Kent lost to J Stirling 2-1 R Emond lost to M Jager 3-1 D Dorning bt S
Maizels 5-3 P O’Dwyer bt R Malvaso 5-4 T Bayliss bt B Toogood Toogood T 7-6 C Nicholls bt A Dinardo 4-3 R Armour bt D Seymour 1 up), ROYAL ROYAL ROYMELBOURNE 4 bt VICTORIA 3 (D Brereton bt K Ciupek 1 up M Sanchez bt M Brooks 3-2 W Heffernan lost to J Nashar 2-1 J McMillan lost to A Majstorovic 1 down J Hetherington bt L Mills 4-3 P Little bt J Sandic 1 up H Gilbert lost to L Murnane 2-1), SOUTHERN 3 bt COMMONWEALTH COMMONWEALTH COMMONWEAL 2 (R Hammond bt T Couling 5-3 K Streat bt C John 3-2 T Coffey lost to F Droope 1 down B Greaves bt M Venables 2-1 J Laf� nLaf� nLaf� lost to C Hasthorpe 2-1 J Besley bt G Sluce 3-2 B Croker bt K Lyle 2-1).Sluce 3-2 B Croker bt K Lyle 2-1).Sluce 3-2 B Croker bt K L
DIV 2: Rosanna 5 bt Peninsula Kingswood2, Latrobe 5 bt Woodlands 2, Gisborne 5 btCheltenham 2, Kingston Heath 5 bt Yarra Yarra Y Yarra Yarra Y 2.DIV 3: Rossdale 5 bt Kew 2, Kooringal 4 bt Northern 3, Spring Valley 5 bt Waverley 2, Keysborough 4 bt Goonawarra 3.
DIV 4: Huntingdale 6 bt Eynesbury 1, Heidelberg4 bt Chirnside Park 3, Patterson River 4 bt GreenAcres 3, Cranbourne 5 bt Yering Meadows 2.Acres 3, Cranbourne 5 bt Yering Meadows 2.Acres 3, Cranbourne 5 bt Y
DIV 5: Box Hill 4 bt Eastern 3, Sandhurst 4 bt Settlers Run 3, Riversdale 6 bt Sunshine 1.
DIV 6: Amstel 6 bt Yarrambat 1, Melton Valley 4 bt Whittlesea 3, Bacchus Marsh 5 bt Berwick Montuna 2, Melbourne Airport 4 bt Churchill Park 3.
Women: DIV 1: YARRA YARRA Y YARRA YARRA Y 7 bt METROPOLITAN METROPOLITAN METROPOLIT 0 (C Tan Tan T bt J Charlton at 19th S Fernando bt S Andereson 3-2 C Bryant bt G Ednie 8-6 C Kuchenmeister bt S Clark 5-4 M Cuddihy bt D Baulch 6-5 B Baker bt K Hastie 3-2 R Germino bt K Kemp 1 up), PENINSULA KINGSWOOD 5 bt HUNTINGDALE 2 (S Vogel bt L Teo Teo T 2-1 SB Park bt H Gubbels 2 up G Hallinan bt E Smith 4-2 G Macklan lost to B Ling 3-2 A McCaig bt H Geallatly 2 up L Johnston lost to K Henningsen at 19th J Wyllie bt J Do 1 up), VICTORIA 4 bt KINGSTON HEATH HEATH HEA 3 (G Ruffels bt D Marshall 2-1 L Callow lost to L Brown 3-1 B Chignell bt L Arundell 2-1 A Gavardinas lost to A Zhou 2 down E Clark lost to U De Neefe 3-2 M Rose bt B Osborne 2 up J Clark bt R Hanson 6-5), COMMONWEALTH 5 bt KEW 2 (A Hilliard 6-5), COMMONWEALTH 5 bt KEW 2 (A Hilliard 6-5), COMMONWEALlost to L Ooi 2-1 S Johnson bt J Donelly 5-4 L Sanft lost to L Day 2-1 M Peters bt J Baker 3-1 K Kennedy bt A Manuell 5-3 L Grif� nGrif� nGrif� bt H Hodgetts 7-6 L Briers bt C Wang 4-3).
DIV 2: Woodlands 4 bt The National 3, Southern 6 bt Royal Melbourne 1, Riversdale 5 bt Sunshine 2, Heidelberg 6 bt Spring Valley 1.
DIV 3: Green Acres 4 bt Latrobe 3, Rosanna 6 bt Keysborough 1, Sandhurst 5 bt Patterson River 2, Box Hill 5 bt Medway 2.
PGA LEGENDS PRO-AM at Gardiners Run: (par 72): Final scores: 64: CWilliams. 67: S Taylor Taylor T . 68: L Stephen J Kirchner. 69: S Ford A Gilligan D Merriman T Mezera. 70: B Wall D Harrington S O’Brien T Elliott G Joyner G Wall. 71: M McFadden D Hando J Onions. 72: D Armstrong M Harwood P Hayes R Davis R Cooney J Martin D Purchase. 73: DGood P Powell R Backwell G Carroll T Price M Zilko. 74 S Aisbett G McCully S Herbert H Dolan B Wearne P Woodward. 75: L Allen F Conallin T Hollingsworth C Le Chevallier M Paterson P Dalgleish I BakerFinch. 76: C Fox S Hutchison W Greene L Tinkler. 77: C Trist L Hunter G Bruyeres. 78: A Dakers. 79: W Rogers D Brown. 80: M Humphries E Booth. 81: G Ferguson. 83:K Oung. 84: D Galloway.
PGA LEGENDS PRO-AMat Heathcote: (Par 71): 64: C Williams. 68: TElliott. 69: J Onions. 71: M Zilko D Hando. 72:J Martin G McCully S Ford D Good P PowellP Dalgleish G Dowling. 73: M Harwood G Joyner M Paterson. 74: T Hollingsworth. 75:S O’Brien P Woodward L Tinkler. 76: P Hayes.77: D Harrington B Wearne. 78: D Brown. 79:G Ferguson M Humphries A Dakers W Rogers.81: L Allen. 82: F Conallin G Roberts. 84: GRix. 85: G Begg. 87: S Slater.
FLINDERS PRO-AM(par 69): 63: A Martin. 64: J Ingram. 65: RHaywood J Marchesani. 67: A Brown. 68: MBoth T Elliott J Onions. 69: A Cox L HickmanL Burns R Lal. 70: E Elliott B Ford W LowrieDK Im B Wharton A Pitty. 71: N Condon L FarryK Harris D Higgins. 72: M Curtain A Dudley-Bateman B McGill D Stein C Smedley. 73:H Williams M Isherwood A Kelly C McLeanM Voglis D Smith S Johnson. 74: S GardinerD Hando J Kraan J Shaw E Walters M ChoiG Cusick. 75: R Granger C Le ChevallierS McDermott L Bleumink. 76: N Dastey B Parrish M Hakkinen A Schultz. 77: A JacobsenL Bates S Lambert. 78: T Alsford M OhlmusM Faraone J Jeong. 79: M Judd I Merrett Z Morwood. 80: B Eyton-Jones. 81: B WestwickW Greene. 84: C Sartori.
RUGBY UNIONVRUDewar Shield: Harlequin 47 d End Hills 26, Moorabbin 53 d Souths 29, Melbourne 45 d Power House 5, Footscray 47 d Melbourne Uni 15, Melbourne 30 d Power House 7.
P2: Harlequin 71 d End Hills 5, Moorabbin 54 d Souths 5, Melbourne Uni 42 d Footscray 5.
P3: Harlequin 25 d End Hills 12, Moorabbin 28 d Souths 0, Melbourne Uni 22 drew Footscray 22.
SOFTBALLNORTHERN at Mill ParkRd 18: U-19: Cheetahs 5 d Monarchs 3.U-13: Cheetahs Green 12 d Monarchs 8.Grand Finals: U-16: Monarchs Red 7 d Cheetahs 3.Women: Cheetahs White 7 d Rebels 6.
SOCCERNATIONAL PREMIER LEAGUE WOMENNATIONAL PREMIER LEAGUE WOMENNARound 2: Bulleen Lions 0 Senior NTC 0. \Round 3: Calder United 4 Geelong Galaxy United 1, Box Hill United 0 Heidelberg United 3.
TEN PINWESTERN SUBURBS LEAGUERound 16 at WatergardensHSM: P Williams 755 O Hedi 749 C Allen 731. HSF: K Coward 688 C Giordmaina 568 M Lee 550.HGM: P Williams 279 O Hedi 279 J Chiodo 267.HGF: K Coward 265 C Giordmaina 206 S Rogerson 203.
By Tara Murray
A�er a long pre-season, Calder Cannons are ready to hit the �eld on �ursday night to kick o� the TAC Cup season.
�e Cannons and Eastern Ranges will start the season under lights at RAMS Arena and Cannons coach Andrew Johnston said his team could not wait.
“It’s been a really good pre-season,” he said.“We started with 90-plus kids back in
November and put them through their paces. We’ve now got a list of 54 who are quality kids.
“We had a camp at Queenscli� last weekend and it was about putting it all together. Now we’re ready for the season.”
Johnston, in his second year as head coach, said there was one big di�erence between this group and the one from last season.
“I can’t compare to a couple of years ago as I wasn’t coach but they had a really good side and got 11 players dra�ed,” he said.
“�is year the group is a lot closer than last year and the top-age guys have made a real point of including the 17-year-olds.
“It’s a really good start that they’ve come together as a group.”
Johnston said 22 players from last year’s group were still with the Cannons.
Many of them played several games last year despite being bottom age.
“We have a really good mix of players,” he said. “We were up and down last year and it meant we got to play a lot of the 17-year-olds. It was a big focus for us late in the season to again give them one, two or even half a dozen games.
Ryan Baker was impressive for Calder Cannons in the off-season. (Damian Visentini)
Cannons primedfor big season
It holds them in good stead for this year.”Johnston said several players had shown
promise so far in the o�-season.“James Peters is coming back from a serious
injury,” he said.“Tom Burnside has shown real athletic ability
and will be really important this year. “Jackson McDonald and Harri Rocke have
shown leadership, and Ryan Baker and Lachlan Bramble are up-and-coming leaders.
“Ben Ronke tested well last week and he played senior football last year. He was part of St Bernards premiership side.
“He is a big-bodied boy who may play a few games in the VFL.”
Like in previous years, the Cannons won’t appoint a captain and instead will rotate the position.
“We have 12 players in the leadership group and we’re working closely with them,” Johnston said.
“We’ll have a di�erent captain each week and announce a captain at the end of the regular season if we’re lucky enough to play �nals.”
Johnston said the club had about half a dozen players in the Vic Metro under-18 squad, including Burnside, Mitch Lewis and Jack Reaper.
STARWEEKLY.COM.AU SPORT
33 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Diggers Rest Bulla players can hold their heads high despite not getting the result they were a�er in the Gisborne and District Cricket Association McIntyre Cup grand �nal.
Needing a win against Gisborne to claim the club’s �rst McIntyre Cup premiership, the Burras were le� shattered when the teams �nished tied at 215.
Because the Dragons �nished second on the ladder to the Burras’ fourth, the premiership went to Gisborne.
Burras coach Kevin Barker said the side was gutted.
“At the end of the day, we didn’t actually lose the grand �nal, it’s as simple as that,” he said. “We pushed a really good side to the end.
“If a couple of things had gone our way it could have been a di�erent result, not taking anything away from Gisborne.
“It’s a numb feeling knowing we didn’t lose the game.”
Starting the third day of the match at Gardiner Reserve needing to take �ve wickets for victory, the Burras looked in control when they dismissed Simon Harman, Clinton Young and Tahir Afridi in quick succession.
At that stage the Dragons needed 47 runs with two wickets in hand.
“Our bowlers had done the job all year and we expected them to do it again this time,” Barker said.
“We created a chance in the second last over, but didn’t take it.
“To their credit they fought hard and put on more than 40 for the last two wickets.
“We knew they’d �ght hard as they are a strong side and a successful club. Credit to them, they fought.”
Darren Quarrell who was on a hat-trick a�er taking the wickets of Harman and Young, �nished with �ve, while Rhys Berry and Lindon Dowsett took two wickets each.
It capped o� a good year with the ball for both Berry and Quarrell,who were named in the GDCA team of the year last week.
Barker was named player of the grand �nal a�er making 118 on day one, which set up the Burras’ total.
He said the club still had a lot to be proud of, in their �rst season back in the top grade.
“It’s important for everyone to hold their heads high,” he said.
“No one gave us a shot at the start of the year and to get as far as we did it is an amazing e�ort. At the end of the day, they didn’t actually lose.”
Tara Murray
Flag ‘lost’ in tied decision
By Tara Murray
Two best mates were unlikely heroes with the bat for Gisborne in the Gisborne and District Cricket Association McIntyre Cup grand �nal.
At 8-169, the Dragons’ premiership hopes looked all but gone a�er Diggers Rest Bulla had taken three quick wickets.
At the crease for the Dragons were the Nolan brothers, Darcy and Geordy.
Both had highest scores of 16 for the season. �ey managed to put on 22 runs before Geordy was out for six.
�at brought a clearly injured Jay King to the crease. Despite not being able to run, King stayed with Darcy Nolan and they kept the scoreboard ticking over.
A Nolan boundary levelled the scores at 215 – enough to secure the Dragons a premiership as they had �nished higher on the regular- season ladder.
�e game was over the next ball, with Nolan dismissed for 34.
Despite having a highest score ever of just 31, Nolan said he was quietly con�dent that he could get the job done. He made 12 not out batting at No.11 in the Dragons’ B-grade grand �nal win over the Burras in 2013-14.
Mates get the job doneDarcy Nolan, with Jay King on the left, celebrates hitting the runs that delivered his side the McIntyre Cup; inset, Gisborne with the cup. (Luke Hemer)
“Five wickets and 80 runs you think … you can get them,” he said.
“�e fact it took us nine down didn’t matter in the end. When the ball was on my pads, I had to go for it and it paid o�.
“It’s unreal – to get out there and get the job done.”
Nolan said batting with his brother and then with one of his best mates was a contrast.
“Batting with Geordy was awesome,” he said. “His chat was good early … he batted really hard and put his head over the pill and did the right thing.
“Jay is one of my best mates. “It’s pretty ballsy to come out last week and
take four wickets and this week bat through with stress fractures in his shin and be there when we got the runs.”
Doctors told King, who moved across from Rupertswood in the o�-season, he shouldn’t be playing in the grand �nal a�er scans before the �rst weekend of the match revealed the stress fractures.
“It’s pretty messed up,” King said. “I thought I was done for.
“�e doctor said, ‘No you can’t play’, but the physio strapped me up heavily and got me to the point where I could attempt to play.”
�e �nal decision to play was le� to King. “�ey didn’t pick me until about 11 on the Saturday morning,” he said.
“I had to have a bowl and see if I could run at the last minute … they put it in my hands as to whether I could contribute. I said yes and they backed me in … [I’m] very thankful.”
King, who took four wickets on the �rst two days, was the most nervous person at the ground when the two Nolans were batting.
“I couldn’t speak to anyone,” he said. “I was sitting here being quiet and didn’t move. I didn’t want to talk to anyone. I was packing myself.”
King, who could barely walk, let alone run, �nished four not out.
“I was in a bit of strife,” he said. “I kept telling ‘Darc’ to keep �ghting. ‘Darc’
didn’t want to know me [when he hit the runs to tie the score] – he was too busy trying to talk to everyone in the crowd.
“It was a little bit of an anti-climax that he went out straight a�erwards.
“As well as the result, I got to play with ‘Darc’, and he’s my best mate. It’s been a brilliant year.”
Even break enough to get Gisborne over the �nals lineA tie was as good as a win for Gisborne in the McIntyre Cup grand �nal on Saturday.
In an on-the-edge-of-your-seat �nish, the Dragons fought their way to 215, to equal Diggers Rest Bulla and win the Gisborne and District Cricket Association’s premiership.
Con�dent at 5-129 a�er the �rst two days of the match, the Dragons were on edge when they slumped to 8-169.
Dragons’ playing coach Simon Harman had said last week it would be the �rst two partnerships on day three that would decide the game, but then had to sit and watch the bottom three batsmen get the job done.
“�e �rst partnership wasn’t too bad, but then to lose two wickets straight away was really disappointing and made the job a lot harder,” Harman said.
“�e nerves were sky high and it wasn’t looking good. As I said last week, we had faith in the other three guys and they were able to pull us over the line.”
Harman paid tribute to Geordy and Darcy Nolan, along with Jay King, who ensured the Dragons levelled the scores with the Burras at 215 a piece.
“All the more credit to Geordy, Darcy and for Jay King at the end for sticking it out.
“Darcy is fantastic and he is a big game player, who brings the big stu� on the big stage.
“It was a fantastic e�ort from Jay. He is badly injured and managed to play through it. We were anticipating him not playing. We’re glad we picked him.”
A�er tying the scores, Darcy Nolan was out the next ball, but it didn’t matter with a tie enough to give the Dragons the premiership a�er they �nished higher on the ladder.
“Whether its a win or tie, it’s irrelevant to us. If you get a home �nal, you’ve been the better team throughout the year.
“It feels like a complete win to us.”Ironically, the Dragons only �nished higher
than the Burras on the ladder a�er a �nal round win between the two sides.
“It shows you need to play all the games out to 6pm – we’re really happy that we did that,” Harman said.
“I think we took an important wicket with about 15 minutes to play.”
�e win capped o� a brilliant day for the Dragons with their second side taking out the C-grade premiership.
Tara Murray
34 SUNBURY & MACEDON RANGES STAR WEEKLY \ MARCH 22, 2016
Free Genuine Floor Mats 3 YEAR Mechanical Protection PlanFull Tank Of Fuel T.S.A Capped Price Servicing*
2015 PLATE - HOT PRICE SALE!!!!
Melton Toyota143-147 High Street, Melton T 03 8746 0300 LMCT 1976
meltontoyota.com.au
^All vehicles in stock at time of preperation. All vehilces to be delivered no later than 31/03/2016. *Conditions Apply,