Species complex What is a species? Morphology, phylogenetic distinctiveness, ecology Reproductive continuity (rem: definitions of populations) We discuss.

Species complex

•What is a species?

•Morphology, phylogenetic distinctiveness, ecology

•Reproductive continuity (rem: definitions of populations)

•We discuss multiple species (evolutionary units) even if not "biological species"

•A very typical problem evolutionary biologists face

Chapter 13

Implies chromosomal similarity

•Remember: humans and chimps very similar at sequence level, but 1000s of genes have been gained/lost between the two through duplication

•Hybridization referring to our close ancestors could have been possible, assuming reconstruction of Neanderthal genome correct

isolation-migration models

• IMAGINE: two species that you are studying with genetic markers, and you find out that they share some alleles

• how is that possible???

• 1. clearly they hybridized, OMG, gross

• 2. or, diversity from the ancestral population has not yet been fixed for alternate alleles in the 2 populations

• coalescent theory lets us calculate these probabilities, and allow for isolation NOT being immediate

And of course often

outbreeding has fitness

consequences

Coalescent simulations

• Recover possible historical scenario by simulation

• Ancestral diversity, current diversity, migration easy to simulate: does SIMULATED DNA carry same pattern as empirical data? If not, reject...if yes, consider as one possibility

• Easier to reject unlikely hypotheses than separate all likely hypotheses, increasing data helps

• may include effects of migration, change in population size, bottlenecks, and so on

Population expansion IN GENERAL:

Series of bottlenecks, reduced diversity

300,000 markersCluster analysis

recapitulates migration distances

Mutation, drift, and migration reach equilibria

that allow inference of past migration and interbreeding

Ah to be alive      on a mid-September morn      fording a stream      barefoot, pants rolled up,      holding boots, pack on,      sunshine, ice in the shallows,      northern rockies.

Rustle and shimmer of icy creek watersstones turn underfoot, small and hard as toes      cold nose dripping      singing inside      creek music, heart music,      smell of sun on gravel.

      I pledge allegiance

I pledge allegiance to the soil      of Turtle Island,and to the beings who thereon dwell      one ecosystem      in diversity      under the sunWith joyful interpenetration for all.

Gary Snyder

More than Feet...

•We are brains, language, art, emotion

•“There are many competing hypotheses for why we are the last hominins left on Earth...”Zimmer and Emlen

•We are monotypic - nothing else quite like us.

Dolphin brains

•we aren’t the only species with large brains

•...what is it about our brain that (we think) makes us so different?

• The discovery of spindle cells (neurons without extensive branching, known also as "von Economo neurons", or VENs) in the brains of the humpback whale, fin whale, sperm whale, killer whale,[15][16] bottlenose dolphins, Risso's dolphins, and beluga whales[17] is another unique discovery. Humans, the great apes, and elephants, species all well known for their high intelligence, are the only others known to have spindle cells[18](p242). Spindle neurons appear to play a central role in the development of intelligent behavior. Such a discovery may suggest a convergent evolution of these species.[19]

art

•figurative art begins to appear in the fossil record around 40,000 years ago

•we are a visual species: reducedreliance on olfactory sense

•apes have a duplicated opsin genelacking in other primates, has evolvedinto color vision

•may be key event in identifying ripe/safe food: overall reliance on vision

trichromatic vision is a complex adaptation

•as so often happens, it is a gene duplication that allowed it

language

• when traits are shared, that is evidence of recent common ancestry

• traits that vary between groups are evidence of ancient common ancestry

• culture evolves under similar rules as mutations in a gene

• linguistic similarities and differences evolve temporally

• processes of mutation and drift, non-random people with whom we share culture: assumptions about evolutionary models can apply to culture

300,000 markersCluster analysis

recapitulates migration distances

Mutation, drift, and migration reach equilibria

that allow inference of past migration and interbreeding

how has selection continued to change us?

•as populations continue to find new habitats to live in, there are signs of adaptation

•rare alleles at EPAS1 locus found primarily in Tibetans: allow better survival at high altitude

•lactase persistence: allow additional calorie source to pastoral communities

•modern world may be relaxing selection in other ways

traits being selected

•often involve life history traits: age atfirst reproduction,body mass index,physiology, and trade-offs of these

•remember: selection context-specific,may be different indifferent locations,cultures...

emotion

• text: emotion causes motivation; motivation helps mammals reach goals such as food or mates

• traits of emotion coincide with development of particular neuronal structures, particular hormonal pathways (expressed proteins)

• Sanger-Schachter theory of emotion: emotion is a function both of cognition (thought) and physiological state

• these lead to the bonds we form: we know that oxytocin (involved in maternal bonding/imprinting with offspring) and vasopressin are two key players

on the topic of love...some mutations

change the length of a particular fragment, and can have major phenotypic results

ctttcgatctctctctctctcgatac......ctttcgatctctctctctctctctctcgatac

•simple sequence repeats (SSR) loci have motifs (“words”) that can easily mutate during replication

•strand slippage, increase or decrease number motifs

•not often within genes, but in non-coding regions that influence expression (e.g. between promoter region and gene)

•proximity of promoter region influences rate of transcription (and thus amount of product)

•in voles (and other mammals, it seems) can affect number of vasopressin receptors in brain

genectttcgatctctctctctctcgatac

genectttcgatctctctctctctctctctctcgatac

promoter

promoter

•more vasopressin receptors in prairie volemore monogamy and social care by males

•fewer receptors in meadow vole - more promiscuity, and behavior can be changed by providing additional receptors

expression is behavior

•vasopressin receptor has variable expression across species

•higher levels of expression associated with strong pair-bonding (approaching monogamy)

•experimentally increasing expression of vasopressin receptor induces pair-bonding behavior

yes

•the homologous - orthologous - system works the same way in humans. homozygotes for particular allele classes have less persistent relationships

•as with MHC diversity influencing mate choice, our genes and simple physiological and genomic upregulation - out of our control - control much of what we do!

mhc

• MHC molecules “show” processed proteins on cell surface

• immune system responds (usually to your benefit)

• extreme diversity at this locus: why?

molecule with benefits

• diversity allows presentation/recognition of diverse pathogen/foreign material (helps immune system clear body of disease)

• greater diversity, better presumed immune response

• (heterosis, overdominance: two forms of increased fitness with heterozygosity)

• so life (vertebrates) might act to increase diversity somehow?

old shirts andmate choice

• Wedekind study: MHC dissimilar mates preferred?

• T-shirts worn by guys, presented to women - all genotyped at MHC loci

• greatest mismatch at genotype (different alleles) = greatest “attraction”

being unusual and mating

Incongruity of primate species tree and DQA1 promoter region gene tree.

Loisel D A et al. PNAS 2006;103:16331-16336

©2006 by National Academy of Sciences

MHC- related gene