Top Banner
1 | www.apexbt.com Sorafenib Cat. No.: A3009 CAS No.: 284461-73-0 Formula: C21H16ClF3N4O3 M.Wt: 464.82 Synonyms: BAY-43-9006,Sorafenib,Nexavar,sorafenibum Target: Tyrosine Kinase Pathway: PDGFR Storage: Store at -20°C In Vitro ı23.25mg/mL in DMSO Preparing Stock Solutions Mass 1mg 5mg 10mg Solvent Concentration 1 mM 2.1514 mL 10.7569 mL 21.5137 mL 5 mM 0.4303 mL 2.1514 mL 4.3027 mL 10 mM 0.2151 mL 1.0757 mL 2.1514 mL Please refer to the solubility information to select the appropriate solvent. Shortsummary Raf kinases and tyrosine kinases inhibitor IC₅₀ & Target , 22 nM (B-Raf), 90 nM (VEGFR2), 57 nM (PDGFRβ) In Vitro Cell Viability Assay Cell Line: PLC/PRF/5 and HepG2 cells Preparation method˖ The solubility of this compound in DMSO is >10 mM. General tips for obtaining a higher concentration: Please warm the tube at 37 °C for 10 minutes and/or shake it in the ultrasonic bath for a while.Stock solution can be stored below -20°C for several months. Reacting conditions: IC50: 6.3 μM for PLC/PRF/5 cells 4.5 μM for HepG2 cells 72 hours Applications: The effect of sorafenib on cell proliferation was measured by CellTiter -Glo Product Name: Sorafenib Revision Date: //2020 Product Data Sheet Solvent & Solubility Biological Activity 1 | www.apexbt.com Sorafenib Cat. No.: A300 0 0 0 0 0 0 0 0 0 9 9 9 9 9 9 9 9 9 9 9 CAS No.: 28 28 8 8 28 8 8 8 28 28 28 28 28 2 28 28 8 28 2 2 2844 44 44 44 44 44 44 44 44 4461 61 61 61 61 61 61 61 61 1 61 1 - - - - 73 7 7 7 7 7 7 7 7 7 7 7 - 0 Formula: C C2 C2 C2 C2 C2 C2 C2 C2 C C2 C2 C C C 1H16ClF3N4O3 M.Wt: 464.82 Synonyms: BAY - Y Y 43 - 9006,Sorafenib,Nexa var,sorafenibum T arget: Tyrosine Kinase Pathway: PDGFR Storage: Store at - 20°C In Vitro ı ı ı ı ı ı ı ı ı ı ı ı ı 23.25mg/mL in DMSO Preparing Stock Solutions Mass 1mg 5mg 10mg Solvent Concentration 1 mM 2.1514 mL 10.7569 mL 21.5137 mL 5 mM 0.4303 mL 2.1514 mL 4.3027 mL 1 0 mM 0.2151 mL 1.07 7 7 7 7 7 7 7 757 57 57 57 57 57 57 57 5 57 57 m m m m m m m m m m mL L L L L L L L L L L 2.1514 mL Plea a a a a a a a a ase se se se s se s se se se e e e e e e r r r r r r r r r r ref ef ef ef ef ef ef ef f e e e e e ef e e e e e er er er er er er r er er er er t t t t t t t t t t t to o o o o o o o o o o t t th t t e solubility information to select the appropriate solvent nt nt t nt t t t t t. Shortsummary Raf kinases and tyrosine kinases inhibitor IC ₅₀ & Target , 22 nM (B - Raf), 90 nM (VEGFR2), 57 nM (PDGFRβ) In Vitro Cell Viability Assay Cell Line: e: e: e: e: e: e e e PLC/PRF/5 and HepG2 cells Pr Pr Pr Pr Pr r Pr Pr Pr P ep ep ep ep ep ep ep ep ep ep ep e ar ar a ar ar ar ar ar ar ar rat at a at at t t at at t t t t a at at t t ati i i i io io io i i io io io io o io io o io ion n n n n n n n n n n n n method ˖ The solubility of this compound in D D D D D D D D D D D DMS MS MS MS MS MS MS MS MS MS MS M MS MS M MS M O O O O O O O O O O O O O O O O O O is is is is s is is is is is s > > > > > > > > > > > >10 10 10 10 1 10 10 10 1 1 1 1 1 mM. General tips for obtaining a higher concentration: Please war ar ar ar r ar ar ar r r ar rm m m m m m m m m m m m m m th th th th th th th th th th th h h he tube at 37 °C for 10 minutes and/or shake it in the ultrasonic bath for a while.Stock solution can be stored below - 20°C for several months. Reacting conditions: IC50: 6.3 μM for PLC/PRF/5 cells 4.5 μM for HepG2 cells 72 hours Applications: The effect of sorafenib on cell proliferation was measured by CellTiter - Glo Product Name: Sorafenib Revision Date: / /2 020 0 et Product Data Shee Solvent & Solu u u u u ub b b b bi i i i i il l l l l l l l li i i it t t t t t t ty y y y y y y y y Biologica a a al l l l l A A A A A Activity
3

Sorafenib - PerfectionSorafenib Cat. No.: A3009 CAS No.: 284461-73-0 Formula: C21H16ClF3N4O3 M.Wt: 464.82 Synonyms: BAY-43-9006,Sorafenib,Nexavar,sorafenibum Target: Tyrosine Kinase

Sep 24, 2020

Download

Documents

dariahiddleston
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Sorafenib - PerfectionSorafenib Cat. No.: A3009 CAS No.: 284461-73-0 Formula: C21H16ClF3N4O3 M.Wt: 464.82 Synonyms: BAY-43-9006,Sorafenib,Nexavar,sorafenibum Target: Tyrosine Kinase

1 | www.apexbt.com

SorafenibCat. No.: A3009

CAS No.: 284461-73-0

Formula: C21H16ClF3N4O3

M.Wt: 464.82

Synonyms: BAY-43-9006,Sorafenib,Nexavar,sorafenibum

Target: Tyrosine Kinase

Pathway: PDGFR

Storage: Store at -20°C

In Vitro

23.25mg/mL in DMSO

Preparing

Stock Solutions

Mass

1mg 5mg 10mgSolvent

Concentration

1 mM 2.1514 mL 10.7569 mL 21.5137 mL

5 mM 0.4303 mL 2.1514 mL 4.3027 mL

10 mM 0.2151 mL 1.0757 mL 2.1514 mL

Please refer to the solubility information to select the appropriate solvent.

Shortsummary Raf kinases and tyrosine kinases inhibitor

IC₅₀ & Target , 22 nM (B-Raf), 90 nM (VEGFR2), 57 nM (PDGFRβ)

In Vitro

Cell Viability Assay

Cell Line: PLC/PRF/5 and HepG2 cells

Preparation method The solubility of this compound in DMSO is >10 mM. General tips for obtaining

a higher concentration: Please warm the tube at 37 °C for 10 minutes and/or

shake it in the ultrasonic bath for a while.Stock solution can be stored below

-20°C for several months.

Reacting conditions: IC50: 6.3 μM for PLC/PRF/5 cells 4.5 μM for HepG2 cells 72 hours

Applications: The effect of sorafenib on cell proliferation was measured by CellTiter-Glo

Product Name: SorafenibRevision Date: / /2020

Product Data Sheet

Solvent & Solubility

Biological Activity

1 | www.apexbt.com

SorafenibCat. No.: A300000000000099999999999

CAS No.: 282888288882828282828228288282228444444444444444444446161616161616161611611----7377777777777 -0

Formula: CC2C2C2C2C2C2C2C2CC2C2CCC 1H16ClF3N4O3

M.Wt: 464.82

Synonyms: BAY-YY 43-9006,Sorafenib,Nexavar,sorafenibum

Target: Tyrosine Kinase

Pathway: PDGFR

Storage: Store at -20°C

In Vitro

23.25mg/mL in DMSO

Preparing

Stock Solutions

Mass

1mg 5mg 10mgSolvent

Concentration

1 mM 2.1514 mL 10.7569 mL 21.5137 mL

5 mM 0.4303 mL 2.1514 mL 4.3027 mL

10 mM 0.2151 mL 1.0777777777575757575757575755757 mmmmmmmmmmmLLLLLLLLLLL 2.1514 mL

Pleaaaaaaaaaasesesesessesseseseeeeeeese rrrrrrrrrrrefefefefefefefeffeeeeeefeeeee ererererererrerererer tttttttttttto oooooooooo ttthtt e solubility information to select the appropriate solventntnttntttttt.

Shortsummary Raf kinases and tyrosine kinases inhibitor

IC₅₀ & Target , 22 nM (B-Raf), 90 nM (VEGFR2), 57 nM (PDGFRβ)

In Vitro

Cell Viability Assay

Cell Line:e:e:e:e:e:eee PLC/PRF/5 and HepG2 cells

PrPrPrPrPrrPrPrPrP epepepepepepepepepepepe araraarararararararratataatatttatatttttaatatttatiiiiioioioiiioioioiooioiooioionn n nnnn nnnnnn method The solubility of this compound in DDDDDDDDDDDDMSMSMSMSMSMSMSMSMSMSMSMMSMSMMSM O OO OO O OOOOOOOOOOOOO isisisissisisisisiss >>>>>>>>>>>>10101010110101011111 mM. General tips for obtaining

a higher concentration: Please wararararrarararrrarrmmmmmmmmmmmmmm thththththththththththhhhe tube at 37 °C for 10 minutes and/or

shake it in the ultrasonic bath for a while.Stock solution can be stored below

-20°C for several months.

Reacting conditions: IC50: 6.3 μM for PLC/PRF/5 cells 4.5 μM for HepG2 cells 72 hours

Applications: The effect of sorafenib on cell proliferation was measured by CellTiter-Glo

Product Name: SorafenibRevision Date: / /20200

etProduct Data Shee

Solvent & Soluuuuuubbbbbiiiiiillllllllliiiittttttttyyyyyyyyy

Biologicaaaalllll AAAAAActivity

Page 2: Sorafenib - PerfectionSorafenib Cat. No.: A3009 CAS No.: 284461-73-0 Formula: C21H16ClF3N4O3 M.Wt: 464.82 Synonyms: BAY-43-9006,Sorafenib,Nexavar,sorafenibum Target: Tyrosine Kinase

2 | www.apexbt.com

assay. Sorafenib inhibited cell proliferation dose-dependently with an IC50 of

6.3 μmol/L in PLC/PRF/5 and 4.5 μmol/L in HepG2 cells.

In Vivo

Animal experiment

Animal models: Female CB17 SCID mice injected with PLC/PRF/5 cells

Dosage form: Oral administration; 10, 30, and 100 mg/kg body weight; once daily for 16 or 21

days

Applications: Sorafenib tosylate produced dose-dependent growth inhibition of s.c.

implanted PLC/PRF/5 tumor xenografts in SCID mice. Dose levels of 10 and 30

mg/kg produced significant and dose-dependent TGIs of 49% and 78%,

respectively. Sorafenib tosylate produced durable partial tumor regressions in

50% of the mice at the 100 mg/kg dose level.

Other notes: Please test the solubility of all compounds indoor, and the actual solubility may

slightly differ with the theoretical value. This is caused by an experimental

system error and it is normal.

1. Cheriyan VT, Alsaab H, et al. "A CARP-1 functional mimetic compound is synergistic with BRAF-targeting in non-small cell lung

cancers." Oncotarget. 2018 Jul 3;9(51):29680-29697.PMID:30038713

2. Sieber J, Wieder N, et al. "GDC-0879, a BRAF(V600E) Inhibitor, Protects Kidney Podocytes fromDeath." Cell Chem Biol. 2017 Dec

6.PMID:29249695

See more customer validations on www.apexbt.com.

[1] Liu L, Cao Y, Chen C, et al. Sorafenib blocks the RAF/MEK/ERK pathway, inhibits tumor angiogenesis, and induces tumor cell

apoptosis in hepatocellular carcinoma model PLC/PRF/5. Cancer research, 2006, 66(24): 11851-11858.

FOR RESEARCH PURPOSES ONLY.NOT FOR HUMAN, VETERINARY DIAGNOSTIC OR THERAPEUTIC USE.Specific storage and handling information for each product is indicated on the product datasheet. Most APExBIO products are stable

under the recommended conditions. Products are sometimes shipped at a temperature that differs from the recommended storage

temperature. Shortterm storage of many products are stable in the short-term at temperatures that differ from that required for

long-term storage. We ensure that the product is shipped under conditions that will maintain the quality of the reagents. Upon receipt

of the product, follow the storage recommendations on the product data sheet.

Product Citations

References

Caution

2 | www.apeexbt.commmmmmmmmmmmmm

assay. Sorafenib inhibited cell proliferation dose-dependently with an IC50 of

6.3 μmol/L in PLC/PRF/5 and 4.5 μmol/L in HepG2 cells.

In Vivo

Animal experiment

Animal models: Female CB17 SCID mice injected with PLC/PRF/5 cells

Dosage form: Oral administration; 10, 30, and 100 mg/kg body weighththththththththt;;;;;;;; onoooooooooo ce daily for 16 or 21

days

ApApApppppppppplplplplplplplpppliciciciciciciciciciccatatatatatatatataatatioioioioioioioioioonsnsnsnsnsnsnsnsnssns::::::::: Sorafenib tosylate produced dose-deeeeeeeepepepepepepepepeppepeendndndndndndndndndddenenenenenenenenennent ttttt tttt t tt t tt t t grgg owth inhibition of s.c.

implanted PLC/PRF/5 tumor xenogrgrgrgrgrgrgrgrgrrgrrrrrafafafafafafafafafafafafafafaftststststststststststststss iiiiiiiiiinnnnnnnnnn SCSCSCSCSCSCSCSCSCSCSCSCCID mice. Dose levels of 10 and 30

mg/kg produced significant and dddddddddososososososososososooooo eeeeeeeee-dependent TGIs of 49% and 78%,

respectively. Sorafenib tosylate produced durable partial tumor regressions in

50% of the mice at the 100 mg/kg dose level.

Other notes: Please test the solubility of all compounds indoor, and the actual solubility may

slightly differ with the theoretical value. This is caused by an experimental

system error and it is normal.

1. Cheriyan VT, AlAlAlAlAlAAAlAlAlAAlAlAAA sasasasasasasasasasasasasasas abaababababababbbbabbbabbaababab HHHHHH, et al. "A CARP-1 functional mimetic compound is synergistic wwwwwwwwwwwitititititititittitititittthhhhhhhhhhhhhh BRBRBRBRBRBRBRBRBRBRRRBRRBRBRRBRBRBRRAFAAAAAAAAAAA -targeting in non-small cell lung

cancers." Oncotarget. 2018 Jul 3;9(51):29680-29697.PMID:30038713

2. Sieber J, Wieder N, et al. "GDC-0879, a BRAF(V600E) Inhibitor, Protects Kidney Podocytes fromDeath." Cell Chem Biol. 2017 Dec

6.PMID:29249695

See more customer validations on www.apexbt.com.

[1] Liu L, Cao Y, Chen C, et al. SSSSSSSSSSororororororororororrafafafafafafafafafaffenenenenenenenenenenene iiiibi blocks the RAF/MEK/ERK pathway, inhibits tumor annnnnnnnngigigigigigigigigiggiogogogogogogogogogogggeneeneneneneneneneenenenennneneeeeseseseseseseseeseseeeessesesisisisisississisisisiis, and induces tumor cell

apoptosis in hepatocelluuuuuuuuulalalalalaalalalaaar rrrrrrrr cacacacacacacacaccaacarcrcrcrcrcrcccccrcrcrccccccccrccrcinininininnininininninomooooooooo a model PLC/PRF/5. Cancer research, 2006, 66(24): 1111111111118585858585858585855855111111111-------1111111111111111111111118585858585858585858558585588 8.8

FOR RESEARCH PURPOSES ONLY.NOT FOR HUMAN, VETERINARY DIAGNOSTIC OR THERAPEUTTIC USE.Specific storage and handling information for each product is indicatted on the product datasheet. Most APEPEPEPEEPEPEEPEEExBxBxBxBxBxBxBxBBxBBEEEEEEEEEEEEEEEEE IOIOIOIOIOIOIOIOO ble products are stab

under the recommended conditionsss... PrPrPrPrPPrPrPPrPrPProdooooooooo ucts are sometimes shipped at a temperature that differs mmended storageed at a temperature that differs fffffffffrorororrorrrroror m mmmmmmmmmmmmmmmmm ththththththththtthheeeeeeeeeeee rerererererererereerereccccocccccccc mmended storag

temperature. Shortterm storageeeeeeeegee oooooooooooff f ff f f f ff mammamamamamamamamamamam nynynynynynynynyynyynynyny products are stable in the sshort-term at temperatures tttttttthahahahahahahahahahahahahat t t t t tt t tt didididididididiid ffffffffffffffffffffffffffff ereeeeeererererererereererererr fffffffffffffffrom that required for

long-term storage. We eeeeeeeeeensnsnsnsnsnsnsnsnsnsssurururururuururuu e eeeeeeeeee ththhhhthhthhthththththththththhththhatatatatatatatataatatatttataaa tttttttthehh product is shipped under conditions that will maintaiaiaiaiaiaiaaiiaiaiaiaaaiaaa n n n n n nn nnnnnnnnnnn thhhhhhhhhhthththththttthhthhtthe e e e eee eee quququququququququuquqququuaaalalalalaalalaaaa itiii y of the reagents. Upon receipt e

of the product, folllllllllllowowowowwowowwwowowwwwwo ttttttttthehehehehehehehehehehe ssssssssssstototototototototootootootorarararrrrarararrar ge recommendations on the product ddata sheet.

Product Citaaaaatttttiiiiiooooonnnnnnssssssssss

References

Caution

Page 3: Sorafenib - PerfectionSorafenib Cat. No.: A3009 CAS No.: 284461-73-0 Formula: C21H16ClF3N4O3 M.Wt: 464.82 Synonyms: BAY-43-9006,Sorafenib,Nexavar,sorafenibum Target: Tyrosine Kinase

3 | www.apexbt.com

APExBIO Technologywww.apexbt.com

7505 Fannin street, Suite 410, Houston, TX 77054. Tel: +1-832-696-8203 | Fax: +1-832-641-3177 | Email: [email protected]

3 | www.apexbt.com

APExBIO Technologywww.apexbt.com

7505 Fannin street, Suite 410, Houston, TX 77054.Tel: +1-8333333333222222222222--6966666666666 6-8203 | Fax: +1-832-641-3177 | Email: [email protected]