This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
1
Somatic tissue engineering in mouse models reveals an actionable role for WNT pathway 1
alterations in prostate cancer metastasis 2
Josef Leibold1*, Marcus Ruscetti1*, Zhen Cao2,3*, Yu-Jui Ho1, Timour Baslan1, Min Zou4, Wassim 3
Abida5, Judith Feucht6, Teng Han3,7, Francisco M. Barriga1, Kaloyan M. Tsanov1, Leah Zamechek1, 4
Amanda Kulick8, Corina Amor1, Sha Tian1, Katarzyna Rybczyk1, Nelson R. Salgado1, Francisco J. 5
Sánchez-Rivera1, Philip A. Watson2, Elisa de Stanchina8, John E. Wilkinson9, Lukas E. Dow7, Cory 6
Abate-Shen4, Charles L. Sawyers2,10#, and Scott W. Lowe1,10# 7
8
1Department of Cancer Biology and Genetics, Memorial Sloan Kettering Cancer Center, New York, 9
NY, USA. 10
2Human Oncology and Pathogenesis Program, Memorial Sloan Kettering Cancer Center, New York, 11
NY, USA. 12
3Weill Cornell Graduate School of Medical Sciences, Weill Cornell Medicine, New York, NY, USA. 13
4Departments of Pharmacology, Urology, Medicine, Pathology and Cell Biology, and Systems Biology, 14
Herbert Irving Comprehensive Cancer Center, Columbia University Medical Center, New York, NY, 15
USA. 16
5Department of Medicine, Memorial Sloan Kettering Cancer Center, New York, NY, USA. 17
6Center for Cell Engineering and Immunology Program, Memorial Sloan Kettering Cancer Center, New 18
York, NY, USA. 19
7Sandra and Edward Meyer Cancer Center, Department of Medicine, Weill Cornell Medicine, New 20
York, NY, USA. 21
8Department of Molecular Pharmacology, Sloan Kettering Institute, Memorial Sloan Kettering Cancer 22
Center, New York, NY, USA. 23
9Department of Pathology, University of Michigan, Ann Arbor, MI, USA. 24
10Howard Hughes Medical Institute, Chevy Chase, MD, USA. 25
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Cell culture and compounds 458 LNCaP and Myc-CAP cells were provided by P.A. Watson. Primary murine fibroblasts from C57BL/6 459 mice were purchased from Cell Biologics, Inc and grown in complete fibroblast media (M2267). MPt, 460 MP, and MPApc murine prostate cancer cell lines were derived from EPO-GEMM prostate tumors with 461 these genotypes. To generate these cell lines, prostate tumors were minced, digested in DMEM media 462 containing 3 mg/ml Dispase II (Gibco) and 1 mg/ml Collagenase IV (C5138;Sigma) for 1 hour at 37oC, 463 and plated on 10 cm culture dishes coated with 100 µg/ml collagen (PureCol) (5005; Advanced 464 Biomatrix). Primary cultures were passaged at least 3 times to remove fibroblast contamination. All 465 prostate cancer cell lines were maintained in a humidified incubator at 37oC with 5% CO2, and grown in 466 RPMI 1640 or DMEM supplemented with 10% FBS and 100 IU ml-1 penicillin/streptomycin. All cell 467 lines used were negative for mycoplasma. 468 469 Enzalutamide (S1250) and G007-LK (S7239) were all purchased from Selleck chemicals for in vitro 470 studies. Drugs for in vitro studies were dissolved in DMSO (vehicle) to yield 10 mM stock solutions and 471 stored at -80°C. For in vitro studies, growth media with or without drugs was changed every 3 days. For 472 in vivo studies, G007-LK (B5830) was purchased from APExBIO. G007-LK was dissolved in 10% 473 DMSO and then reconstitued in 20% Cremophor EL (Sigma-Aldrich) in saline. 474 475 In vitro genome editing 476 For visualizing WNT pathway activity in vivo, MP and MPApc cell lines were engineered to express a 477 7TCF-Luciferase construct (a gift from Roel Nusse (Addgene plasmid # 24308)). Lentivuruses were 478 packaged by co-transfection of Gag-Pol expressing 293 T cells with expression constructs and envelope 479 vectors (VSV-G) using the calcium phosphate method. Following transduction, cells were selected with 480 4μg/ml puromycin for 1 week. 481 482 MiRE-based shRNAs targeting Apc, Ctnnb1, and Renilla were cloned into MSCV-based vectors as 483 previously described (53,54). Retroviruses were packaged by co-transfection of Gag-Pol expressing 293 484 T cells with expression constructs and envelope vectors (VSV-G) using polyethylenimine (PEI; Sigma-485 Aldrich). Following transduction with shRNA retroviral constructs, cell selection was performed with 486 4μg/ml puromycin for 1 week. Perturbation of WNT pathway activity following Apc or Ctnnb1 487 knockdown was confirmed by qRT-PCR or readout of TCF activity through TOPFLASH assays. 488 489 Plasmids containing a mutant form of -catenin (catS45P) were provided by L. Dow. To engineer 490 MPApc cell lines to express catS45P, retroviruses were packaged by co-transfection of Gag-Pol 491 expressing 293 T cells with expression constructs and envelope vectors (VSV-G) using PEI. Following 492 transduction, cells were selected with 4μg/ml puromycin for 1 week. 493 494 Establishment of organoid lines 495 Mouse prostate organoids were established and cultured as described previously (55). Pten
-/- organoids 496 were established from Pb-Cre; Pten
flox/flox mice. WT or Pten-/- organoids were transduced with lentiCas9-497 Blast and the bulk population was selected in blasticidin for 3 days. WT organoids were then transduced 498 with LentiCRISPRv2-sgp53 and bulk selected in puromycin for 3 days to generate p53-/- organoids. Apc 499 mutant organoid lines were generated using Retro-sgApc-tdTomato constructs targeting codons 884 and 500 1405 (provided by T. Han and L. Dow) and were bulk sorted to enrich for transduced cells as previously 501 described (56). Ctnnb1 knockdown was achieved using MiRE-based shRNAs targeting Ctnnb1 as 502 described above. 503 504
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
In vitro organoid growth analysis 505 Organoid growth analysis was carried out as previously described (57). 1,000 cells per 50 μl matrigel 506 dome were seeded in EGF withdrawal medium, and each time point consisted of 3 domes in a 24-well 507 plate. Cell viability was assessed using the CellTiter-Glo Viability Assay (Promega) according to the 508 manufacturer’s protocol. All values for each time point were normalized to day 1 readings. 509 510 Animal studies 511 All mouse experiments were approved by the Memorial Sloan-Kettering Cancer Center (MSKCC) 512 Internal Animal Care and Use Committee. Mice were maintained under specific pathogen-free 513 conditions, and food and water were provided ad libitum. Mice were purchased from Jackson laboratory. 514 Pb-Cre4 (58) male mice were crossed with LSL-Cas9 female mice to produce Pb-Cre4;LSL-Cas9 male 515 mice for generation of EPO-GEMMs. 516 517 Electroporation-induced genetically engineered mouse models (EPO-GEMMs). 518 8-12 week old WT C57BL/6, or transgenic Pb-Cre;LSL-Cas9 and Rosa26-CAGs-LSL-RIK (59) male 519 mice were anesthetized with isofluorane and the surgical site (pelvic region) scrubbed with a povidone-520 iodine scrub (Betadine) and rinsed with 70% alcohol. After opening the peritoneal cavity, the left 521 seminal vesicle was used as a landmark and the left anterior lobe of the prostate was pulled out. 50 μl of 522 a plasmid mix (see specifications below) was injected into the left anterior lobe of the prostate using a 523 27.5 gauge syringe and tweezer electrodes were tightly placed around the injection bubble. Two pulses 524 of electrical current (60V) given for 35 ms lengths at 500 ms intervals were then applied using an in vivo 525 electroporator (NEPAGENE NEPA21 Type II electroporator). After electroporation, the peritoneal 526 cavity was rinsed with 0.5ml of pre-warmed saline. After the procedure the peritoneal cavity was 527 sutured and the skin closed with skin staples. The mice were kept at 37˚C until they awoke and post-528 surgery pain management was done with injections of buprenorphine and/or meloxicam for the three 529 following days. Tumor formation was assessed by ultrasound imaging, and mice were sacrificed 530 following early tumor development or at endpoint. Genome editing in EPO-GEMM tumors was 531 confirmed by Sanger sequencing. 532 533 To generate EPO-GEMM tumors in C57BL/6 WT mice, the following vectors and concentrations were 534 used: a pT3-MYC transposon vector (5µg), a Sleeping Beauty transposase (SB13) (1µg), and/or a 535 pX330 CRISPR/Cas9 vector (20µg) (addgene #42230) targeting the respective tumor suppressor genes. 536 For generation of tumors in Pb-Cre;LSL-Cas9 mice, a pT3-MYC transposon vector (10µg) (addgene 537 #92046), pT3-sgp53 transposon vector (20µg), and SB13 (6µg) were used. For assessment of tissue 538 recombination in Rosa26-CAGs-LSL-RIK mice, a PGK-Cre vector (10µg) was used. The Sleeping 539 Beauty transposase (SB13) and the pT3 transposon vector were a generous gift of Dr. Xin Chen, UCSF 540 San Francisco. The pX330 vector was a gift from Feng Zhang (addgene plasmid # 42230). 541 542 The following sgRNAs were used to target the respective tumor suppressor gene locus: 543 544 Pten: GTTTGTGGTCTGCCAGCTAA 545 p53: ACCCTGTCACCGAGACCCC 546 Apc
892: CAGGAACCTCATCAAAACG 547 Apc
1529: CAGTTCAGGAAAACGACAA 548 Apc
1405: GTTCAGAGTGAGCCATGTAG 549 550 To generate the pX330 vector containing two sgRNAs, the vector was opened using the XbaI cloning 551 site and the sgRNA-casette containing the second guide was PCR cloned into the vector using the 552 following primers: XbaI U6 fwd. ATGCTTCTAGAGAGGGCCTATTTCCCATGATT and NheI gRNA 553 scaffold rev. ATGTCGCTAAGCTCTAGCTCTAAAACAAAAAAGC. 554
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
555 Ultrasound imaging 556 High-contrast ultrasound imaging was performed on a Vevo 2100 System with a MS250 13- to 24-MHz 557 scanhead (VisualSonics) to stage and quantify prostate tumor burden. Tumor volume was analyzed 558 using Vevo LAB software. 559 560 Bioluminescence imaging 561 Bioluminescence imaging (BLI) was used to track luciferase expression in orthotopically transplanted 562 MPApc or MP WNThi prostate cell line tumors expressing a 7TCF-Luciferase (Luc) reporter, as well as 563 orthotopically and intravenously transplanted organoids expressing a Luc reporter. Mice were injected 564 i.p. with luciferin (5 mg/mouse; Gold Technologies) and then imaged on a Xenogen IVIS Spectrum 565 imager (PerkinElmer) 10-15 minutes later for 60 seconds. Quantification of luciferase signaling was 566 analyzed using Living Image software (Caliper Life Sciences). 567 568 Orthotopic transplantation of cell lines 569 50,000 MPApc or MP WNThi prostate tumor cells expressing a 7TCF-Luc reporter were resuspended in 570 25 μl of a 50% matrigel (BD Biosciences)/ 50% PBS solution and injected into the right anterior prostate 571 lobe of 8-10 week old male C57BL/6 mice using a Hamilton Syringe as previously described (52). BLI 572 imaging was used to assess tumor formation, and mice were subsequently randomized and enrolled into 573 treatment groups. The impact on metastatic burden was assessed after four weeks of treatment. 574 In vivo metastasis assay using cell lines 575 500,000 MP or MPApc prostate tumor cells were resuspended in 400 μl of PBS and tail vein injected 576 into 8-10 week old Nu/Nu (Nude) male mice. 577 578 Orthotopic transplantation of organoids 579 A LentiLuciferase-Neo construct was transduced into all organoid lines and bulk selected for 3 days in 580 neomycin. 3 x 106 cells per mouse were used for orthotopic injection. Organoids were dissociated into 581 single cells and resuspended in 50% matrigel and 50% medium before injection into NOD-scid IL2Rγnull 582 (NSG) male mice. In vivo luciferase signals were measured once a week on an IVIS Spectrum imager. 583 Mouse prostate tissues were collected after 13 weeks for histological analysis. 584 585 In vivo metastasis assay using organoids 586 25,000 dissociated LentiLuciferase-Neo transduced orgnaoid cells were resuspended in 400 μl of PBS 587 and tail vein injected into NSG mice. In vivo luciferase signals were measured once a week on an IVIS 588 Spectrum imager. Mouse lung tissues were collected 40 days post-injection. 589 590 Surgical castration 591 Castration was performed as previously described (60). EPO-GEMM mice were monitored for prostate 592 tumor development by ultrasound, and enrolled and randomized into treatment groups once tumors 593 reached 500 mm3. Ultrasound imaging was repeated every week following castration to assess changes in 594 prostate tumor burden. Upon sacrifice prostate tumor tissue was allocated for 10% formalin fixation and 595 OCT frozen blocks. 596 597 Pre-clinical treatment studies 598 EPO-GEMM mice were monitored for prostate tumor development by ultrasound, and enrolled and 599 randomized into treatment groups once tumors reached 500 mm3. C57BL/6 mice orthotopically 600 transplanted with MP and MPApc prostate tumors cells expressing a 7TCF-Luc reporter were evaluated 601 by BLI to verify tumor development before being randomized into various study cohorts. Nude mice tail 602 vein injected with MPApc prostate tumor cells were randomized and treated either with G007-LK or 603 vehicle control the day before injection to assess metastasis prevention. 604
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
605 Mice were treated with vehicle or G007-LK (30 mg/kg body weight) by intraperitoneal (ip) injection 606 for 5 consecutive days followed by 2 days off treatment. Ultrasound and/or BLI were repeated every 607 week during treatment to assess changes in prostate tumor burden. No obvious toxicities were observed 608 in vehicle- or drug-treated animals as assessed by changes in body weight. Upon sacrifice prostate tumor 609 tissue was allocated for 10% formalin fixation and snap frozen tissue for DNA/RNA analysis. 610 611 Analysis of metastasis burden 612 The presence of peritoneal, lymph node, thorax, lung, and liver metastases was determined at survival or 613 experimental endpoint by gross examination under a dissecting scope. Metastasis burden and the total 614 number of individual metastases was further quantified from H&E stained sections. The presence of 615 disseminated tumors cells (DTCs) in the bone marrow of EPO-GEMM mice was assessed following 616 PCR genotyping for the presence of the human MYC allele in the bone marrow flushes from the 617 hindlimbs of these mice. PCR genotyping of MP EPO-GEMM prostate tumors and normal WT prostate 618 tissue were used as positive and negative controls, respectively. 619 620 Immunohistochemistry and immunofluorescence 621 Tissues were fixed overnight in 10% formalin, embedded in paraffin, and cut into 5 μm sections. 622 Haematoxylin and eosin (H&E) and immunohistochemical/immunoflourescence staining was performed 623 using standard protocols. The following primary antibodies were used: Androgen Receptor (AR; Sc-624 816), p63 (Sc-8431), and CK8 (Sc-8020) (Santa Cruz); Porcupine (PORCN; AB105543), MYC 625 (AB32072), Ki67 (AB16667), and LRP6 (AB24386) (Abcam); Cytokeratin 5 (CK5; 905501) and 626 Cytokeratin 8 (CK8; 904801) (Biolegend); -catenin (BD610153), E-cadherin (BD610181), and ASCL1 627 (MASH1;BD556604) (BD Biosciences); Synaptophysin (SYP; 1485-1) (Epitomics); mKate2 (AB233) 628 (Evrogen); p63 (4A4, Ventana); Vimentin (5741), and TCF1/TCF7 (2203) (Cell Signaling). 629 Histopathological features in EPO-GEMM primary prostate tumors and metastases were assessed by a 630 trained veterinary pathologist (J. Wilkinson). 631 632 High throughput RNA-sequencing (RNA-seq) 633 For RNA-seq analysis of the transcriptional profiles of MPt and MP EPO-GEMM prostate tumors, as 634 well as normal anterior lobe tissue from prostates of wild type (WT) C57BL/6, total RNA was extracted 635 from bulk tissue using the RNeasy Mini Kit (Qiagen). Purified polyA mRNA was subsequently 636 fragmented, and first and second strand cDNA synthesis performed using standard Illumina mRNA 637 TruSeq library preparation protocols. Double stranded cDNA was subsequently processed for TruSeq 638 dual-index Illumina library generation. For sequencing, pooled multiplexed libraries were run on a 639 HiSeq 2500 machine on RAPID mode. Approximately 10 million 76bp single-end reads were retrieved 640 per replicate condition. Resulting RNA-Seq data was analyzed by removing adaptor sequences using 641 Trimmomatic (61), aligning sequencing data to GRCm38.91(mm10) with STAR (62), and genome wide 642 transcript counting using featureCounts (63) to generate a TPM matrix of transcript counts. Genes were 643 identified as differentially expressed using R package DESeq2 with a cutoff of absolute log2FoldChange 644 ≥ 1 and adjusted p-value < 0.05 between experimental conditions (64). Functional enrichments of these 645 differentially expressed genes were performed with enrichment analysis tool Enrichr (65) and the 646 retrieved combined score (log(p-value) * z-score) was displayed. 647 648 Clustering and Gene Set Enrichment Analysis (GSEA) 649 Principal component analysis was performed using the DESeq2 package in R. Gene expressions of 650 RNA-Seq data were clustered using hierarchical clustering based on one minus pearson correlation test. 651 For pathway enrichment analysis, the weighted GSEA Preranked mode was used on a set of curated 652 signatures in the molecular signatures database (MSigDB v7.0) 653 (http://www.broadinstitute.org/gsea/msigdb/index.jsp). From 22,596 signatures, signatures with 15-500 654
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
genes were only considered for further analyses. From the results, enriched signatures with an adjusted p 655 value less than 0.05 were considered as statistically significant. 656 657 Copy Number Variations (CNVs) 658 CNVs were infered from sparse whole genome sequencing data as described previously (66,67). In 659 brief, 1 μg of bulk genomic DNA (gDNA) was extracted from prostate tumors and tissue using the 660 DNeasy Blood & Tissue Kit (Qiagen) and sonicated using the Covaris instrument. Sonicated DNA was 661 subsequently end-repaired/A-tailed, followed by ligation of TruSeq dual indexed adaptors. Indexed 662 libraries were enriched via PCR and sequenced in multiplex fashion using the Illumina HiSeq2500 663 instrument to achieve roughly 1 million uniquely mappable reads per sample – a read count sufficient to 664 allow copy number inference to a resolution of approximately 400kb. For data analysis, uniquely 665 mapped reads where counted in genomic bins corrected for mappability. Read counts were subsequently 666 corrected for GC content, normalized, and segmented using Circular Binary Segmentation (CBS). 667 Segmented copy number calls are illustrated as relative gains and losses to the median copy number of 668 the entire genome. Broad events (chromsome wide and several megabase sized events) are discernible in 669 a genome-wide manner as illustrated in Figure 2F. Focal events, namely chromsomal amplifications, are 670 discernible in zoom-in-views of chromosomes as depicted in Figures 3F, S4D, and S4E. 671 672 Mouse MSK-IMPACT 673 Tumors were profiled for genomic alterations in M-IMPACT_v1key cancer-associated genes using our 674 custom, deep sequencing MSK-IMPACT assay that surveys 468 known cancer driver genes. Custom 675 DNA probes were designed for targeted sequencing of all exons and selected introns of oncogenes, 676 tumor suppressor genes, and members of pathways deemed actionable by targeted therapies. Genomic 677 DNA from tumor and matched normal WT prostate anterior tissue samples were subjected to sequence 678 library preparation and exon capture (NimbleGen). Up to 30 barcoded sequence libraries were pooled at 679 equimolar concentrations and input into a single exon capture reaction, as previously described (68). 680 Pooled libraries containing captured DNA fragments were subsequently sequenced on the Illumina 681 HiSeq system. 682 683 Sequence data were demultiplexed using BCL2FASTQv1.8.3 (Illumina), and vesitigial adapter 684 sequences were removed from the 3’ end of sequence reads. Reads were aligned in paired-end mode to 685 the hg19 b37 version of the genome using BWA-MEM (Burrows-Wheeler Alignment tool). Local 686 realignment and quality score recalibration were performed using Genome Analysis Toolkit (GATK) 687 according to GATK best practices (69). Paired-sample variant calling was performed on tumor samples 688 and their respective matched normals to identify point mutations/single nucleotide variants (SNVs) and 689 small insertions/deletion (indels). MuTect (version 1.1.4) (70) was used for SNV calling and 690 SomaticIndelDetector, a tool in GATKv.2.3.9, was used for detecting indel events. Variants were 691 subsequently annotated using Annovar, and annotations relative to the canonical transcript for each gene 692 (derived from a list of known canonical transcripts obtained from the UCSC genome browser) were 693 reported. 694 695 Tissue microarray (TMA) 696 Tissue microarrays (purchased from US Biolab) containing a total of 126 prostate tumor specimens from 697 66 patients with localized and metastastic disease were stained for -catenin expression by 698 immunofluorescence through the Molecular Cytology Core Facility at MSKCC using a Discovery XT 699 processor (Ventana Medical Systems). Briefly, tissue sections were deparaffinized with EZPrep buffer 700 (Ventana Medical Systems) and antigen retrieval was performed with CC1 buffer (Ventana Medical 701 Systems). Sections were blocked for 30 minutes with Background Buster solution (Innovex), followed 702 by avidin-biotin blocking for 8 minutes (Ventana Medical Systems). Sections were incubated with a -703
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
catenin antibody (8814; Cell Signaling) for 5 hours, followed by a 60-minute incubation with 704 biotinylated goat anti-rabbit IgG (PK6101; Vector labs) at a 1:200 dilution. Detection was performed 705 with Streptavidin-HRP D (part of DABMap kit, Ventana Medical Systems), followed by incubation with 706 Tyramide Alexa 488 (B40953; Invitrogen) prepared according to the manufacturer’s instructions. After 707 staining, slides were counterstained with DAPI (D9542; Sigma Aldrich) for 10 min and coverslipped 708 with Mowiol. Tissues were then scored on a 0-3 scale for -catenin expression, with scores of 0 and 1 as 709 “negative” and 2 and 3 as “positive” for -catenin. 710 711 Human clinical data analysis 712 CBioPortal.org was used to plot the frequency of mutations, amplifications, and/or deletions in genes of 713 interest in prostate cancer patients from various datasets. TP53 alterations included deep deletions 714 (homozygous loss) as well as missense, inframe, and truncating mutations. A Kaplan-Meier survival 715 curve of prostate cancer patients with or without WNT pathway alterations was generated using part of 716 the SU2C dataset (3), which included 47 patients in the WNT activated group and 81 patients in the non-717 WNT activated group. Patients were randomized into the two groups based on WNT pathway activating 718 alterations in the following genes: CTNNB1, APC, AXIN2, WIF1, SFRP1, DKK1, RNF43, ZNRF3, 719 GSK3B, TCF7, TLE1, LRP5, LRP6, and WNT2b (71). The percentage of WNT pathway altered prostate 720 tumor specimens from patients with locoregional vs. metastatic disease was determined from an MSK-721 IMPACT dataset (5), which included 194 locoregional, 135 mPC, and 147 mCRPC patients. 722 Locoregional disease in this setting indicated disease without distant clinical or pathologic spread, 723 including lymph node involvement in the pelvis only. LRP5 and LRP6 amplification frequency was 724 determined from a dataset containing samples obtained from primary tumors where CNV analysis was 725 performed by Affymetrix SNP 6.0 (31), or two datasets containing samples obtained from metastatic 726 sites where CNV analysis performed by whole exome sequencing (3,4). LRP5 and LRP6 expression 727 levels in amplified (AMP or GAIN) or non-amplified tumors were determined in mCRPC patients 728 samples from the SU2C dataset (3) using normalized fpkm values and CNV calls. 729 730 Patients and Samples 731 Histopathological analysis was performed on a primary prostate tumor tissue biopsy from a mCRPC 732 patient treated at MSKCC harboring a MYC amplification and p53 alteration (L114Ffs*33) as part of the 733 MSK-IMPACT cohort (5,72). Clinical sequencing analysis (MSK-IMPACT) was completed on this and 734 other samples and collected using a web-based electronic data capture. Immunohistochemical and 735 sequencing analysis on human tissue samples were performed under MSKCC Institutional Review 736 Board approval. All samples and clinical data were deidentified. 737 738 AR+, NE+, and DN PC classification 739 We adhered to the AR+/NE+/DN prostate cancer subtype classification as proposed in (18). Briefly, AR 740 and NE scores were calculated according to the expression of the mRNA z-scores of 10 AR activity 741 genes (KLK3, KLK2, TMPRSS2, FKBP5, NKX3-1, PLPP1, PMEPA1, PART1, ALDH1A3, STEAP4) 742 and 10 NE signature genes (SYP, CHGA, CHGB, ENO2, CHRNB2, SCG3, SCN3A, PCSK1, ELAVL4, 743 NKX2-1) for mouse and human prostate samples (19). Subsequently, samples for each dataset were 744 normalized from 1 (highest expression of either NE or AR score, respectively) to 0 (lowest expression of 745 either NE or AR score, respectively) as displayed in the scattered plot. Immunohistochemical staining 746 and quantification of AR and SYP/ASCL1 (NE) marker expression was also used for subtype 747 classification in some mouse and human tumors. DN prostate cancers were defined as those that lacked 748 expression of both AR+ and NE+ markers. 749 750 TOPFLASH Assay 751
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
10,000 cells were plated in 100 μl of media containing 10% FBS per well of a black-walled 96-well 752 plate (Perkin Elmer). After 24 hours, cells were transfected using PEI with 170 ng of TOPFLASH 753 Firefly reporter and 30 ng of pRL-SV40P Renilla constructs provided by T. Tamella. In initial 754 experiments, the WNT-insensitive FOPFLASH Firefly reporter (also provided by T. Tamella) was used 755 to rule out signal background (not shown). 36 hours after transfection, Firefly and Renilla signals were 756 detected using Dual-Glo luciferase detection reagents (Promega) according to manufacturer’s 757 instructions. A Varioskan Flash plate reader (Thermo Fischer Scientific) was used to detect 758 luminescence. To control for transfection efficiency, Firefly luciferase levels were normalized to Renilla 759 luciferase levels to generate the measure of relative 7TCF activity. 760 761 Immunoblotting 762 Cell lysis was performed using RIPA buffer (Cell signaling) supplemented with phosphatase inhibitors 763 (5mM sodium fluoride, 1 mM sodium orthovanadate, 1 mM sodium pyrophosphate, 1 mM β-764 glycerophosphate) and protease inhibitors (Protease Inhibitor Cocktail Tablets, Roche). Protein 765 concentration was determined using a Bradford Protein Assay kit (Biorad). Proteins were separated by 766 SDS-PAGE and transferred to polyvinyl difluoride (PVDF) membranes (Millipore) according to 767 standard protocols. Membranes were immunoblotted with antibodies against Axin1 (2087), phospo--768 catenin S33/S37/T41 (9561), PTEN (9188), P53 (2524), and FKBP5 (12210) from Cell Signaling, AR 769 (ab108341), cyclophilin B (ab16045), and NKX3.1 (ab196020) from Abcam, APC (OP44) from 770 Millipore, and P21 (sc-6246) from Santa Cruz in 5% BSA in TBS blocking buffer. After primary 771 antibody incubation, membranes were probed with an ECL anti-rabbit IgG or anti-mouse IgG secondary 772 antibody (1:10,000) from GE Healthcare Life Science and imaged using a FluorChem M system 773 (Protein Simple). Protein loading was measured using a monoclonal β-actin antibody directly conjugated 774 to horseradish peroxidase (1:20,000) from Sigma-Aldrich and imaged as above. 775 776 qRT-PCR 777 Total RNA was isolated using the RNeasy Mini Kit (Qiagen), and complementary DNA (cDNA) was 778 obtained using the TaqMan reverse transcription reagents (Applied Biosystems). Real-time PCR was 779 performed in triplicate using SYBR Green PCR Master Mix (Applied Biosystems) on the ViiA 7 Real-780 Time PCR System (Invitrogen). GAPDH and mRn18s served as endogenous normalization controls. 781 782 Cell viability assay 783 5,000 cells were plated in 100 μl of media containing 10% FBS per well of a black-walled 96-well plate 784 (Perkin Elmer). The next day the media was changed, and cells were treated with G007-LK or 785 enzalutamide for 72 hours. Following treatment, cell viability was assessed using the CellTiter-Glo 786 Viability Assay (Promega) according to the manufacturer’s protocol. IC50 calculations were made using 787 Prism 6 software (GraphPad Software). 788 789 Statistical analysis 790 Statistical analyses were performed as described in the figure legend for each experiment. Group size 791 was determined on the basis of the results of preliminary experiments and no statistical method was used to 792 predetermine sample size. The indicated sample size (n) represents biological replicates. Group allocation 793 and outcome assessment were not performed in a blinded manner. All samples that met proper 794 experimental conditions were included in the analysis. Survival was measured using the Kaplan–Meier 795 method. Statistical significance was determined by one- and two-way ANOVA, Fisher’s exact test, 796 Student’s t test, log-rank test, Mann-Whitney test, and Pearson’s correlation using Prism 6 software 797 (GraphPad Software) as indicated. Significance was set at P < 0.05. 798 799 Data Availability 800
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
RNA-seq data generated in this study are deposited in the Gene Expression Omnibus database under 801 accession number GSE139340. Mouse IMPACT sequencing data presented in this study are deposited in 802 the NCBI BioProject database under accession number PRJNA610252. 803 804 Figure Preparation 805 Figures were prepared using BioRender.com for scientific illustrations and Illustrator CC 2020 (Adobe). 806 807 808
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA Cancer J Clin 2018;68(1):7-30 doi 845 10.3322/caac.21442. 846
2. Huggins C. Control of cancers of man by endocrinologic methods. Cancer Res 1957;17(5):467-847 72. 848
3. Abida W, Cyrta J, Heller G, Prandi D, Armenia J, Coleman I, et al. Genomic correlates of 849 clinical outcome in advanced prostate cancer. Proc Natl Acad Sci U S A 2019;116(23):11428-36 850 doi 10.1073/pnas.1902651116. 851
4. Robinson D, Van Allen EM, Wu YM, Schultz N, Lonigro RJ, Mosquera JM, et al. Integrative 852 Clinical Genomics of Advanced Prostate Cancer. Cell 2015;162(2):454 doi 853 10.1016/j.cell.2015.06.053. 854
5. Abida W, Armenia J, Gopalan A, Brennan R, Walsh M, Barron D, et al. Prospective Genomic 855 Profiling of Prostate Cancer Across Disease States Reveals Germline and Somatic Alterations 856 That May Affect Clinical Decision Making. JCO Precis Oncol 2017;2017 doi 857 10.1200/PO.17.00029. 858
6. Armenia J, Wankowicz SAM, Liu D, Gao J, Kundra R, Reznik E, et al. The long tail of 859 oncogenic drivers in prostate cancer. Nat Genet 2018;50(5):645-51 doi 10.1038/s41588-018-860 0078-z. 861
7. Sun Y, Campisi J, Higano C, Beer TM, Porter P, Coleman I, et al. Treatment-induced damage to 862 the tumor microenvironment promotes prostate cancer therapy resistance through WNT16B. Nat 863 Med 2012;18(9):1359-68 doi 10.1038/nm.2890. 864
8. Gurel B, Iwata T, Koh CM, Jenkins RB, Lan F, Van Dang C, et al. Nuclear MYC protein 865 overexpression is an early alteration in human prostate carcinogenesis. Mod Pathol 866 2008;21(9):1156-67 doi 10.1038/modpathol.2008.111. 867
9. Arriaga JM, Abate-Shen C. Genetically Engineered Mouse Models of Prostate Cancer in the 868 Postgenomic Era. Cold Spring Harb Perspect Med 2019;9(2) doi 10.1101/cshperspect.a030528. 869
10. Choi HJ, Lee HB, Jung S, Park HK, Jo W, Cho SM, et al. Development of a Mouse Model of 870 Prostate Cancer Using the Sleeping Beauty Transposon and Electroporation. Molecules 871 2018;23(6) doi 10.3390/molecules23061360. 872
11. Maresch R, Mueller S, Veltkamp C, Ollinger R, Friedrich M, Heid I, et al. Multiplexed 873 pancreatic genome engineering and cancer induction by transfection-based CRISPR/Cas9 874 delivery in mice. Nat Commun 2016;7:10770 doi 10.1038/ncomms10770. 875
12. Park JS, Lim KM, Park SG, Jung SY, Choi HJ, Lee DH, et al. Pancreatic cancer induced by in 876 vivo electroporation-enhanced sleeping beauty transposon gene delivery system in mouse. 877 Pancreas 2014;43(4):614-8 doi 10.1097/MPA.0000000000000102. 878
13. Seehawer M, Heinzmann F, D'Artista L, Harbig J, Roux PF, Hoenicke L, et al. Necroptosis 879 microenvironment directs lineage commitment in liver cancer. Nature 2018;562(7725):69-75 doi 880 10.1038/s41586-018-0519-y. 881
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
14. Hubbard GK, Mutton LN, Khalili M, McMullin RP, Hicks JL, Bianchi-Frias D, et al. Combined 882 MYC Activation and Pten Loss Are Sufficient to Create Genomic Instability and Lethal 883 Metastatic Prostate Cancer. Cancer Res 2016;76(2):283-92 doi 10.1158/0008-5472.CAN-14-884 3280. 885
15. Kim J, Eltoum IE, Roh M, Wang J, Abdulkadir SA. Interactions between cells with distinct 886 mutations in c-MYC and Pten in prostate cancer. PLoS Genet 2009;5(7):e1000542 doi 887 10.1371/journal.pgen.1000542. 888
16. Grasso CS, Wu YM, Robinson DR, Cao X, Dhanasekaran SM, Khan AP, et al. The mutational 889 landscape of lethal castration-resistant prostate cancer. Nature 2012;487(7406):239-43 doi 890 10.1038/nature11125. 891
17. De Laere B, Oeyen S, Mayrhofer M, Whitington T, van Dam PJ, Van Oyen P, et al. TP53 892 Outperforms Other Androgen Receptor Biomarkers to Predict Abiraterone or Enzalutamide 893 Outcome in Metastatic Castration-Resistant Prostate Cancer. Clin Cancer Res 2019;25(6):1766-894 73 doi 10.1158/1078-0432.CCR-18-1943. 895
18. Bluemn EG, Coleman IM, Lucas JM, Coleman RT, Hernandez-Lopez S, Tharakan R, et al. 896 Androgen Receptor Pathway-Independent Prostate Cancer Is Sustained through FGF Signaling. 897 Cancer Cell 2017;32(4):474-89 e6 doi 10.1016/j.ccell.2017.09.003. 898
19. Kumar A, Coleman I, Morrissey C, Zhang X, True LD, Gulati R, et al. Substantial 899 interindividual and limited intraindividual genomic diversity among tumors from men with 900 metastatic prostate cancer. Nat Med 2016;22(4):369-78 doi 10.1038/nm.4053. 901
20. Chen WS, Aggarwal R, Zhang L, Zhao SG, Thomas GV, Beer TM, et al. Genomic Drivers of 902 Poor Prognosis and Enzalutamide Resistance in Metastatic Castration-resistant Prostate Cancer. 903 Eur Urol 2019;76(5):562-71 doi 10.1016/j.eururo.2019.03.020. 904
21. Watson PA, Ellwood-Yen K, King JC, Wongvipat J, Lebeau MM, Sawyers CL. Context-905 dependent hormone-refractory progression revealed through characterization of a novel murine 906 prostate cancer cell line. Cancer Res 2005;65(24):11565-71 doi 10.1158/0008-5472.CAN-05-907 3441. 908
22. Ellwood-Yen K, Graeber TG, Wongvipat J, Iruela-Arispe ML, Zhang J, Matusik R, et al. Myc-909 driven murine prostate cancer shares molecular features with human prostate tumors. Cancer 910 Cell 2003;4(3):223-38. 911
23. Shlien A, Tabori U, Marshall CR, Pienkowska M, Feuk L, Novokmet A, et al. Excessive 912 genomic DNA copy number variation in the Li-Fraumeni cancer predisposition syndrome. Proc 913 Natl Acad Sci U S A 2008;105(32):11264-9 doi 10.1073/pnas.0802970105. 914
24. Ciriello G, Miller ML, Aksoy BA, Senbabaoglu Y, Schultz N, Sander C. Emerging landscape of 915 oncogenic signatures across human cancers. Nat Genet 2013;45(10):1127-33 doi 916 10.1038/ng.2762. 917
25. Quigley DA, Dang HX, Zhao SG, Lloyd P, Aggarwal R, Alumkal JJ, et al. Genomic Hallmarks 918 and Structural Variation in Metastatic Prostate Cancer. Cell 2018;174(3):758-69 e9 doi 919 10.1016/j.cell.2018.06.039. 920
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
26. Hieronymus H, Schultz N, Gopalan A, Carver BS, Chang MT, Xiao Y, et al. Copy number 921 alteration burden predicts prostate cancer relapse. Proc Natl Acad Sci U S A 922 2014;111(30):11139-44 doi 10.1073/pnas.1411446111. 923
27. Ouyang X, Jessen WJ, Al-Ahmadie H, Serio AM, Lin Y, Shih WJ, et al. Activator protein-1 924 transcription factors are associated with progression and recurrence of prostate cancer. Cancer 925 Res 2008;68(7):2132-44 doi 10.1158/0008-5472.CAN-07-6055. 926
28. Visakorpi T, Hyytinen E, Koivisto P, Tanner M, Keinanen R, Palmberg C, et al. In vivo 927 amplification of the androgen receptor gene and progression of human prostate cancer. Nat 928 Genet 1995;9(4):401-6 doi 10.1038/ng0495-401. 929
29. Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Annu Rev Cell 930 Dev Biol 2004;20:781-810 doi 10.1146/annurev.cellbio.20.010403.113126. 931
30. Hausmann G, Banziger C, Basler K. Helping Wingless take flight: how WNT proteins are 932 secreted. Nat Rev Mol Cell Biol 2007;8(4):331-6 doi 10.1038/nrm2141. 933
31. Cancer Genome Atlas Research N. The Molecular Taxonomy of Primary Prostate Cancer. Cell 934 2015;163(4):1011-25 doi 10.1016/j.cell.2015.10.025. 935
32. Montanari M, Rossetti S, Cavaliere C, D'Aniello C, Malzone MG, Vanacore D, et al. Epithelial-936 mesenchymal transition in prostate cancer: an overview. Oncotarget 2017;8(21):35376-89 doi 937 10.18632/oncotarget.15686. 938
33. Stylianou N, Lehman ML, Wang C, Fard AT, Rockstroh A, Fazli L, et al. A molecular portrait of 939 epithelial-mesenchymal plasticity in prostate cancer associated with clinical outcome. Oncogene 940 2019;38(7):913-34 doi 10.1038/s41388-018-0488-5. 941
34. Reya T, Clevers H. Wnt signalling in stem cells and cancer. Nature 2005;434(7035):843-50 doi 942 10.1038/nature03319. 943
35. Barker N, Clevers H. Mining the Wnt pathway for cancer therapeutics. Nat Rev Drug Discov 944 2006;5(12):997-1014 doi 10.1038/nrd2154. 945
36. Huang SM, Mishina YM, Liu S, Cheung A, Stegmeier F, Michaud GA, et al. Tankyrase 946 inhibition stabilizes axin and antagonizes Wnt signalling. Nature 2009;461(7264):614-20 doi 947 10.1038/nature08356. 948
37. Ferri M, Liscio P, Carotti A, Asciutti S, Sardella R, Macchiarulo A, et al. Targeting Wnt-driven 949 cancers: Discovery of novel tankyrase inhibitors. Eur J Med Chem 2017;142:506-22 doi 950 10.1016/j.ejmech.2017.09.030. 951
38. Waaler J, Machon O, Tumova L, Dinh H, Korinek V, Wilson SR, et al. A novel tankyrase 952 inhibitor decreases canonical Wnt signaling in colon carcinoma cells and reduces tumor growth 953 in conditional APC mutant mice. Cancer Res 2012;72(11):2822-32 doi 10.1158/0008-954 5472.CAN-11-3336. 955
39. Schatoff EM, Goswami S, Zafra MP, Foronda M, Shusterman M, Leach BI, et al. Distinct 956 Colorectal Cancer-Associated APC Mutations Dictate Response to Tankyrase Inhibition. Cancer 957 Discov 2019;9(10):1358-71 doi 10.1158/2159-8290.CD-19-0289. 958
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
40. Roper J, Tammela T, Cetinbas NM, Akkad A, Roghanian A, Rickelt S, et al. In vivo genome 959 editing and organoid transplantation models of colorectal cancer and metastasis. Nat Biotechnol 960 2017;35(6):569-76 doi 10.1038/nbt.3836. 961
41. Sanchez-Rivera FJ, Papagiannakopoulos T, Romero R, Tammela T, Bauer MR, Bhutkar A, et al. 962 Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Nature 963 2014;516(7531):428-31 doi 10.1038/nature13906. 964
42. Cho H, Herzka T, Zheng W, Qi J, Wilkinson JE, Bradner JE, et al. RapidCaP, a novel GEM 965 model for metastatic prostate cancer analysis and therapy, reveals myc as a driver of Pten-mutant 966 metastasis. Cancer Discov 2014;4(3):318-33 doi 10.1158/2159-8290.CD-13-0346. 967
43. O'Rourke KP, Loizou E, Livshits G, Schatoff EM, Baslan T, Manchado E, et al. Transplantation 968 of engineered organoids enables rapid generation of metastatic mouse models of colorectal 969 cancer. Nat Biotechnol 2017;35(6):577-82 doi 10.1038/nbt.3837. 970
44. Boj SF, Hwang CI, Baker LA, Chio, II, Engle DD, Corbo V, et al. Organoid models of human 971 and mouse ductal pancreatic cancer. Cell 2015;160(1-2):324-38 doi 10.1016/j.cell.2014.12.021. 972
45. Saborowski M, Saborowski A, Morris JPt, Bosbach B, Dow LE, Pelletier J, et al. A modular and 973 flexible ESC-based mouse model of pancreatic cancer. Genes Dev 2014;28(1):85-97 doi 974 10.1101/gad.232082.113. 975
46. Zuber J, Radtke I, Pardee TS, Zhao Z, Rappaport AR, Luo W, et al. Mouse models of human 976 AML accurately predict chemotherapy response. Genes Dev 2009;23(7):877-89 doi 977 10.1101/gad.1771409. 978
47. Kang TW, Yevsa T, Woller N, Hoenicke L, Wuestefeld T, Dauch D, et al. Senescence 979 surveillance of pre-malignant hepatocytes limits liver cancer development. Nature 980 2011;479(7374):547-51 doi 10.1038/nature10599. 981
48. Hickman MA, Malone RW, Lehmann-Bruinsma K, Sih TR, Knoell D, Szoka FC, et al. Gene 982 expression following direct injection of DNA into liver. Hum Gene Ther 1994;5(12):1477-83 doi 983 10.1089/hum.1994.5.12-1477. 984
49. Jefferies MT, Cox AC, Shorning BY, Meniel V, Griffiths D, Kynaston HG, et al. PTEN loss and 985 activation of K-RAS and beta-catenin cooperate to accelerate prostate tumourigenesis. J Pathol 986 2017;243(4):442-56 doi 10.1002/path.4977. 987
50. Lee SH, Luong R, Johnson DT, Cunha GR, Rivina L, Gonzalgo ML, et al. Androgen signaling is 988 a confounding factor for beta-catenin-mediated prostate tumorigenesis. Oncogene 989 2016;35(6):702-14 doi 10.1038/onc.2015.117. 990
51. Wellenstein MD, Coffelt SB, Duits DEM, van Miltenburg MH, Slagter M, de Rink I, et al. Loss 991 of p53 triggers WNT-dependent systemic inflammation to drive breast cancer metastasis. Nature 992 2019;572(7770):538-42 doi 10.1038/s41586-019-1450-6. 993
52. Ruscetti M, Quach B, Dadashian EL, Mulholland DJ, Wu H. Tracking and Functional 994 Characterization of Epithelial-Mesenchymal Transition and Mesenchymal Tumor Cells during 995 Prostate Cancer Metastasis. Cancer Res 2015;75(13):2749-59 doi 10.1158/0008-5472.CAN-14-996 3476. 997
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
53. Chicas A, Wang X, Zhang C, McCurrach M, Zhao Z, Mert O, et al. Dissecting the unique role of 998 the retinoblastoma tumor suppressor during cellular senescence. Cancer Cell 2010;17(4):376-87 999 doi 10.1016/j.ccr.2010.01.023. 1000
54. Chien Y, Scuoppo C, Wang X, Fang X, Balgley B, Bolden JE, et al. Control of the senescence-1001 associated secretory phenotype by NF-kappaB promotes senescence and enhances 1002 chemosensitivity. Genes Dev 2011;25(20):2125-36 doi 10.1101/gad.17276711. 1003
55. Drost J, Karthaus WR, Gao D, Driehuis E, Sawyers CL, Chen Y, et al. Organoid culture systems 1004 for prostate epithelial and cancer tissue. Nat Protoc 2016;11(2):347-58 doi 1005 10.1038/nprot.2016.006. 1006
56. Schatoff EM, Zafra MP, Dow LE. Base editing the mammalian genome. Methods 2019;164-1007 165:100-8 doi 10.1016/j.ymeth.2019.02.022. 1008
57. Adams EJ, Karthaus WR, Hoover E, Liu D, Gruet A, Zhang Z, et al. FOXA1 mutations alter 1009 pioneering activity, differentiation and prostate cancer phenotypes. Nature 2019;571(7765):408-1010 12 doi 10.1038/s41586-019-1318-9. 1011
58. Wu X, Wu J, Huang J, Powell WC, Zhang J, Matusik RJ, et al. Generation of a prostate 1012 epithelial cell-specific Cre transgenic mouse model for tissue-specific gene ablation. Mech Dev 1013 2001;101(1-2):61-9. 1014
59. Dow LE, Nasr Z, Saborowski M, Ebbesen SH, Manchado E, Tasdemir N, et al. Conditional 1015 reverse tet-transactivator mouse strains for the efficient induction of TRE-regulated transgenes in 1016 mice. PLoS One 2014;9(4):e95236 doi 10.1371/journal.pone.0095236. 1017
60. Ruscetti M, Dadashian EL, Guo W, Quach B, Mulholland DJ, Park JW, et al. HDAC inhibition 1018 impedes epithelial-mesenchymal plasticity and suppresses metastatic, castration-resistant 1019 prostate cancer. Oncogene 2016;35(29):3781-95 doi 10.1038/onc.2015.444. 1020
61. Bolger AM, Lohse M, Usadel B. Trimmomatic: a flexible trimmer for Illumina sequence data. 1021 Bioinformatics 2014;30(15):2114-20 doi 10.1093/bioinformatics/btu170. 1022
62. Dobin A, Davis CA, Schlesinger F, Drenkow J, Zaleski C, Jha S, et al. STAR: ultrafast universal 1023 RNA-seq aligner. Bioinformatics 2013;29(1):15-21 doi 10.1093/bioinformatics/bts635. 1024
63. Anders S, Pyl PT, Huber W. HTSeq--a Python framework to work with high-throughput 1025 sequencing data. Bioinformatics 2015;31(2):166-9 doi 10.1093/bioinformatics/btu638. 1026
64. Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq 1027 data with DESeq2. Genome Biol 2014;15(12):550 doi 10.1186/s13059-014-0550-8. 1028
65. Kuleshov MV, Jones MR, Rouillard AD, Fernandez NF, Duan Q, Wang Z, et al. Enrichr: a 1029 comprehensive gene set enrichment analysis web server 2016 update. Nucleic Acids Res 1030 2016;44(W1):W90-7 doi 10.1093/nar/gkw377. 1031
66. Baslan T, Kendall J, Rodgers L, Cox H, Riggs M, Stepansky A, et al. Genome-wide copy 1032 number analysis of single cells. Nat Protoc 2012;7(6):1024-41 doi 10.1038/nprot.2012.039. 1033
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
67. Baslan T, Kendall J, Ward B, Cox H, Leotta A, Rodgers L, et al. Optimizing sparse sequencing 1034 of single cells for highly multiplex copy number profiling. Genome Res 2015;25(5):714-24 doi 1035 10.1101/gr.188060.114. 1036
68. Won HH, Scott SN, Brannon AR, Shah RH, Berger MF. Detecting somatic genetic alterations in 1037 tumor specimens by exon capture and massively parallel sequencing. J Vis Exp 2013(80):e50710 1038 doi 10.3791/50710. 1039
69. DePristo MA, Banks E, Poplin R, Garimella KV, Maguire JR, Hartl C, et al. A framework for 1040 variation discovery and genotyping using next-generation DNA sequencing data. Nat Genet 1041 2011;43(5):491-8 doi 10.1038/ng.806. 1042
70. Cibulskis K, Lawrence MS, Carter SL, Sivachenko A, Jaffe D, Sougnez C, et al. Sensitive 1043 detection of somatic point mutations in impure and heterogeneous cancer samples. Nat 1044 Biotechnol 2013;31(3):213-9 doi 10.1038/nbt.2514. 1045
71. Sanchez-Vega F, Mina M, Armenia J, Chatila WK, Luna A, La KC, et al. Oncogenic Signaling 1046 Pathways in The Cancer Genome Atlas. Cell 2018;173(2):321-37 e10 doi 1047 10.1016/j.cell.2018.03.035. 1048
72. Zehir A, Benayed R, Shah RH, Syed A, Middha S, Kim HR, et al. Mutational landscape of 1049 metastatic cancer revealed from prospective clinical sequencing of 10,000 patients. Nat Med 1050 2017;23(6):703-13 doi 10.1038/nm.4333. 1051
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242
Published OnlineFirst May 6, 2020.Cancer Discov Josef Leibold, Marcus Ruscetti, Zhen Cao, et al. metastasisactionable role for WNT pathway alterations in prostate cancer Somatic tissue engineering in mouse models reveals an
Updated version
10.1158/2159-8290.CD-19-1242doi:
Access the most recent version of this article at:
To order reprints of this article or to subscribe to the journal, contact the AACR Publications
Permissions
Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)
.http://cancerdiscovery.aacrjournals.org/content/early/2020/05/06/2159-8290.CD-19-1242To request permission to re-use all or part of this article, use this link
Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Author Manuscript Published OnlineFirst on May 6, 2020; DOI: 10.1158/2159-8290.CD-19-1242