Sodium Channel Mutation in acaricide resitant Ticks in India

8/11/2019 Sodium Channel Mutation in acaricide resitant Ticks in India

1/10


2/10

Author's personal copy

Acta Tropica 125 (2013) 237245

Contents lists available at SciVerse ScienceDirect

Acta Tropica

journal homepage: www.elsevier .com/ locate /actatropica

Survey ofpyrethroids resistance in Indian isolates ofRhipicephalus (Boophilus)

microplus: Identification ofC190A mutation in the domain II ofthepara-sodium channel gene

Rinesh Kumar, Gaurav Nagar, Anil Kumar Sharma, Sachin Kumar, D.D. Ray, Pallab Chaudhuri,Srikanta Ghosh

EntomologyLaboratory, Parasitology Division, IndianVeterinary Research Institute, Izatnagar 243122, UttarPradesh, India

a r t i c l e i n f o

Article history:

Received 17 July 2012

Received in revised form 3 October 2012

Accepted 14 October 2012

Available online 22 October 2012

Keywords:

Rhipicephalus (Boophilus) microplus

Deltamethrin resistance

Esterase

Mutation

Para-sodium channel gene

a b s t r a c t

Monitoring acaricide resistance and understanding the underlying mechanisms are critically important

in developing strategies for resistance management and tick control. Eighteen isolates ofRhipicephalus

(Boophilus) microplus collected from four agro-climatic regions ofIndia were characterized and the resis-

tant data were correlated with bioassay results, esterase enzyme activities and with the presence/absence

ofpoint mutation in the para-sodium channel gene. The adult immersion test was standardized to assess

the level ofresistance and resistant factors (RF) in the range of1.295.7 were detected. Out ofeighteen

isolates, three were categorized as susceptible (RF < 1.4), five isolates at level I (RF = 1.5


3/10


238 R.Kumar et al. / Acta Tropica 125 (2013) 237245

primary targets of SPs, which are structural derivatives of the nat-

urally occurring pyrethrins (Narahashi, 1988). Intensive use of SPs

in arthropodcontrol has led to a worldwide emergence of resistant

populations. Many of the resistant arthropods carry specific point

mutations in the sodium channel gene and structural alterations

in the sodium channel protein may diminish the interaction of

SPs with sodium channel, reducing the sensitivity to pyrethroids(Dong, 2007; Soderlund, 2008). Most of the mutations in sodium

channel gene have been reported in domain II S6 transmembrane

segment and domain II S4-5 linker region. A small number of

mutations have also been found outside of domain II usually

in domain I or III. Insensitive target site resistance mechanism,

which is now quite ubiquitous among disease vectors and other

arthropod species is also reported in R. (B.) microplus. A mutation

in the sodium channel gene was found in Corrales and San Felipe

isolates of R. (B.) microplus from Mexico that were extremely

resistant to the acaricide permethrin. This mutation involved a

single substitution of an adenosine (A) for thymidine (T) at the

position 2134 (T2134A) in the sodium channel gene sequence

(GenBank accession no. AF134216), resulting in the replacement

of a phenylalanine by an isoleucine in transmembrane segmentsix of domain III of the sodium channel gene (He et al., 1999).

Studies have shown that this mutation correlates with flumethrin,

deltamethrin and cypermethrin resistance in Mexican tick popula-

tions (Jamroz et al., 2000; Rosario-Cruz et al., 2005). More recently,

another mutation in the domain II S4-5 linker region of the sodium

channel gene has been reported in cattle tick R. (B.) microplus from

Australia (Morgan et al., 2009) and Brazil (Nogueira Domingues

et al., 2012). The cytosine (C) to adenine (A) mutation at position

190 (C190A) in the para-sodium channel gene sequence results in

an amino acidsubstitution fromleucine in the susceptible isolate to

isoleucine in the resistant isolate. The mutation found in Australian

and Brazilian ticks has not been detected in ticks from Mexico

(Chen et al., 2009; Rosario-Cruz et al., 2009). The second and

less understood mechanism involves esterase enzyme mediated

metabolic detoxification. A number of assays have been developed

to detect elevated expression of esterase via gene amplification

(Field et al., 1988) and over-transcription (Fournier et al., 1992).

However, In India there is a paucity of information on the status

and mechanisms of development of acaricide resistance in R. (B.)

microplus, the most economically important tick infesting Indian

livestock. There is a need to closely monitor acaricide resistance

problem in India as there is diversity reported in the mechanism

of resistance to SPs in R. (B.) microplus from different regions of

the world (He et al., 1999; Chen et al., 2009). Hence, the aim of

the present study was to determine the mechanism of resistance

in eighteen field isolates ofR. (B.) microplus collected from highly

tick infested areas of India through correlation of discriminat-

ing dose (DD) bioassay results with esterase activity and the

presence/absence of mutation in the para-sodium channel gene.

2. Materials and methods

2.1. Reference susceptible tick line (IVRI-I)

The colony of acaricides susceptible reference IVRI-I line ofR.

(B.) microplus (NBAII-IVRI-BM-1-1998) was used as the standard to

assess susceptibility/resistance status in tickisolates collectedfrom

the study area. Thecolony is maintained in the Entomology Labora-

tory of IndianVeterinary ResearchInstitute forthe last 15 years and

has not been exposed to any acaricides. The susceptibility status

of the colony was established by periodical testing against sev-

eral organo-phosphates, organo-chlorines, synthetic pyrethroidsand formamidine compounds in independent bioassays. Different

developmental stages of ticks were reared in glass tubes covered

with cotton cloths and kept in BOD incubator maintained at 28C

with 852%RH. A group of1014days old larvaewerereleased on

the ears of disease free cross bred calves using ear bag method and

the bags were checked regularly. After 1618 days, the engorged

females dropped in the ear bags were collected for in vitro bioas-

says. After 23 feeding cycles, calves were set free for a month.

The homogeneity amongst different generations of IVRI-I line hasbeen established by uniform entomological data and by analyzing

the sequences of 16s rRNA gene of the tick species (accession nos.

GU222462, GU323287, and GU323288) (Kumar et al., 2011).

2.2. Reference deltamethrin resistant tick line (IVRI-IV)

The deltamethrin resistant IVRI-IV line ofR. (B.) microplus was

originally collected from cattle shed located at Danapur village of

Patna, Bihar, India. The cattle owners of the village reported low

efficacy of deltamethrin used for the control of ticks. As the col-

lected samples were not sufficient for effective AIT, adults were

reared in the laboratory at 28 C with 852% RH for oviposi-

tion and hatching of larvae. As mentioned above, larvae were

released on separate batch of calves and significant number ofadult females was obtained. To determine the acaricide resistance

status, previously determined discriminating dose (DD) of tech-

nical grade deltamethrin (99.9%) (AccuStandard Inc., USA) was

used in AIT and the resistance factor (RF) was determined (Sharma

et al., 2012). Initially, the ticks were selected from the treatment

of 6X(X= 30ppm) concentration of deltamethrin. The adult female

that survived was allowed to lay eggs and the developed larvae

were released on calves for feeding. After completing the cycle the

engorged females of the next generation were collected and again

treated with higher concentration of deltamethrin to get the LC50values. The experimentwas continued for several generations with

the increasing acaricide pressure. The resistance increase in subse-

quent generations was calculated by the method ofGopalan et al.

(1996) using the following formula:

Resistance fold increased=LC50 values of the resistant ticks

LC50 values of the susceptible ticks.

The RF of reference IVRI-IV line was calculated as 42.5.

2.3. Sampling

Two stage stratified sampling method was adopted to collect

live engorged females ofR. (B.) microplus from animals and from

the cracks and crevices of organized and unorganized farms. The

areas of collection were selected from four agro-climatic regions

of India (Fig. 1) where tick infestation level is normally very high

and SPs and OP insecticides are intensively used for animal hus-

bandry and agricultural activities. The isolates (BEG, DNP, DRB,

and SUL) were collected from middle gangetic region located at242010273115N, 821950881740E with annual tem-

perature and rainfall in the range of 440C and 10001200 mm,

respectively. The isolates (N-24P, S-24P) were collected from areas

located at 22.56N88.36E receiving annual rainfall from 1250

to 2500mm with an average annual temperature in the range

from 15 to 35.5 C. The isolates (PAT, BTH, and LDH) were col-

lected from trans-gangetic plain region located at 29.3032.32N,

73.5576.50E with very cold winter (2 C) and hot summer

(40 C) and receiving 460960 mm annual rainfall. The other iso-

lates (COR, PRT, UDP, BLW, BSW, JPR, BHT, ALW, and SKR) of

western region located at 23.3030.11N, 69.2978.17E having

very low annual rainfall of 200400mm and average temperature

of 848C.

The female ticks were collected in separate vials, covered withcotton cloths to allow air and moisture exchange, and were trans-

portedto the local processing centers. Thesamples collectedfrom a


4/10


R. Kumar et al. / Acta Tropica 125 (2013) 237245 239

Fig. 1. Collection of tick samples from different agro-climatic regions (shaded) of India.Source: Planning Commission of India.

particular area (district) were pooled, designated as an isolate and

washed thoroughly in water, labeled and kept at 28C and 855%

relative humidity. The AIT was conducted at the processing cen-

ters where the engorged ticks were collected in a large numbers.

When collected ticks were fewer in number and insufficient for

conducting AIT theseticks weretransported to the entomology lab-

oratory of Indian Veterinary Research Institute and were kept at

optimum maintenance conditions egg laying at 28 C and 855%

relative humidity. The egg masses of different engorged females

of each isolate were pooled and the pooled larvae were released

on calves for feeding. The resistance status of the isolates againstdeltamethrin was determined by AIT using statistically significant

number of ticks.

2.4. Adult immersion test

The adult immersion test was adopted as per the method of

Drummond et al. (1973) and Benavides et al. (1999) using different

discriminating dose (DD) of deltamethrin to determine the resis-

tance factorand the level of resistance. Discriminating dose (DD) of

deltamethrinwas determined as 2 LC95 (229.6 ppm= 59.2 ppm)

to conduct in vitrobioassaysof differentfield isolates (Sharmaet al.,

2012). Each isolate was exposed to different discriminating doses

viz., 2x, 4x, 6x, 8x, 10x prepared in distilled water from the stock

solution of deltamethrin, where x is the calculated value of LC95.Four to six replications each containing 5 ticks were treated at each

DD for 2min and kept in Petri dishes after drying on tissue paper.


5/10



Table 1

Primers used to amplify the targeted regions of sodium channel gene.

Name Primer sequence 5-3 Region amplified Product size Ref.

D2F

D2R

ACGTTCGTTTCGTCTGCTA

GATTCGCTTGGGACAGATT

Domain II-S6 (kdr) 434 bp Jamroz et al. (2000)

D3F

D3R

CTGGTTACATCATATCTAATTGCCAC

CCAGCCTTCTTCTTTTGTTCATTG

Domain III-S6 193 bp Chenet al. (2009)

L2F

L2R

TACGTGTGTTCAAGCCTA

ACTTTCTTCGTAGTTCTTGC

Domain II S4-5 linker (Superkdr) 167 bp Morgan et al. (2009)

After 24h, the treated ticks were transferred to 10ml tick-rearing

tubes covered with cotton cloths and were placed in incubator

maintained at 28C and 855% relative humidity. The entomo-

logical data was recorded regularly. The LC50 value of different

isolates was determined by applying regression equation analysis

to the probit transformed data of mortality using GraphPad Prism

version 4.0, San Diego, CA, USA. Resistance factors (RFs) for dif-

ferent isolates were worked out by the quiescent between LC50of

field isolates and LC50of reference susceptible IVRI-I line ofR. (B.)

microplus (Castro-Janer et al., 2009). As per the calculated value of

resistance factor (RF), the resistance status in field isolates ofR. (B.)

micropluswas categorized as susceptible (RF1.4), resistance level

I (RF= 1.55.0), levelII (RF= 5.125.0), levelIII (RF= 2640) andlevel

IV (RF41) (Kumar Sachin et al., 2011).

2.5. Esterase assay

Esterase activities withthe substrates-and-naphthylacetatewere determined in the ticks according to the method of

Hemingway (1998) with some modifications. Twenty deep frozen

larvae were homogenized in a precooled glass pestle in 200lof distilled water. The homogenates were spun at 1100g in

a refrigerated centrifuge at 4 C for 15 min and resulting super-

natant was used for assay. Reaction mixtures contained 20l of

the homogenate in quadruplicate adjacent wells (two wells eachfor -and -naphthyl acetate) of microtitre plate and 200l of-and -naphthyl acetate solution (250l of 30 mM stock in 25mlof phosphate buffer 0.02M, pH 7.2.), respectively. The reaction

mixtures were incubated at room temperatures for 30min before

additionof50l offastblue solution(0.023g fast blue salt dissolvedin 2.25ml distilled water and 5.25ml of 5% SDS in 0.1M sodium

phosphate buffer, pH 7.2) to each well. The plates were incubated

for 5min at room temperature and absorbance was measured at

570 nm in a microtitre plate reader (Tecan, Austria) operated by a

personal computer using Magellan 6 software. The resulting opti-

cal densities (ODs) were compared with standard curves of ODs for

known concentrations of the products -and -naphthyl acetate,respectively. The esterase activities were expressed as enzyme

ratio (mean activity of enzyme in resistant isolate/mean activityof enzyme in reference susceptible IVRI-I line).

2.6. Extraction of genomic DNA, RNA, amplification and

sequencing

Ten to fifteen days old, unfed larvae emanating from reference

IVRI-I, IVRI-IV lines and field isolates, whose resistance status was

characterized were used to isolate total RNA and genomic DNA.

The total RNA was extracted from about 100 mg tick larvae using

Trizol reagent (Sigma, USA) following the manufacturers protocol.

The integrity of RNA was checked by gel electrophoresis and con-

centration was determined in Nanodrop 3300C spectrophotometer

(Thermo scientific, USA). The cDNA was synthesized from 3g of

total RNAusingthe RevertAidTM H minus Reverse Transcription Kitusing OligodT primer (Fermentas, Germany). The cDNA was stored

at 20 C until use. The genomic DNA was extracted from 400 mg

tick larvae by phenolchloroform extraction as per the standard

technique (Sambrook et al., 2001). Genomic DNA was preserved in

200l of TE buffer.The PCR primers to amplify the fragments of the sodium chan-

nelgene flanking themutationsites were designed from thepartial

sodium channel R. (B.) microplus gene sequence (Mexican strain,

GenBank accession no. AF134216). Nucleotide sequences of the

primer pairs, the product sizes and the regions amplified are indi-

cated in Table 1. Domain IIS6 was amplified by primer pair D2F and

D2R; domain IIIS6 was amplified by primer pair D3F and D3R and

S4-5 linker region in domain-II was amplified by primer pair L2F

and L2R. The lyophilized primers were resuspended in TE buffer

andthe stock solution was further diluted in nuclease free water to

obtain a working solution of 10pmol/l.First strand cDNA generated from the larvae of IVRI-I, IVRI-IV

lines and from 18 field isolates were used as a template for PCR

amplification of knockdown resistance (kdr) region (domain IIS6)

of the sodium channel gene. PCR reaction was carried out in a 25lreaction volume containing 2.5l of 10 AccuPrime PCR buffer I,5.0l cDNA (1:5 dilution, 100 ng/l); 1.0l of each primer, D2Fand D2R, 0.3l of AccuPrime Taq DNA polymerase (5IU/l) (Invi-trogen, USA). The PCR conditions optimized as one cycle of initial

denaturation at 94 C for 2 m in followed by 35 cycles of 94C for

1min, 50C for 1min, 68 C for 1min and a final extension at 68C

for 10min.Genomic DNA was isolated from larvae of IVRI-I, IVRI-IV lines

and eighteen field isolates and was used as a template for PCR

amplification of domain IIIS6 region (encompassing the T2134A

mutation site) and domain II S4-5 (encompassing the C190A

mutation site) in the voltage-gated sodium channel gene. For

amplification of T2134Amutation site, a 25l PCR reaction was setup using 2.5l of 10 PCR buffer; 5.0l genomic DNA (1:5 dilu-tion, 50ng/l); 0.5l dNTP (10mM), 0.75l of each primer, D3FandD3R,0.3l of DreamTaq DNA polymerase (5IU/l) (Fermentas,Germany). The PCR conditions optimized as an initial denaturation

step at 95 C for 2min, followed by 34 cycles of 95 C for 1 m in,

55 C for 30 s and 72 C for 30s with a final extension step at 72C

for 10min.

The C190A mutation site was amplified by PCR using a set ofprimers, L2F and L2R. A 25l PCR reaction was performed using2.5l of 10 AccuPrime PCR buffer II, 5.0l genomic DNA (1:5dilution, 50ng/l), 1.0l of each primer, 0.3l of AccuPrime TaqDNA polymerase (5IU/l) (Invitrogen, USA). Thermal cycling con-ditions were: initial denaturation of 94C for 2 m in and followed

by 40 cycles each consisting of successive incubations at 94C for

1min, 50 C for 30 s, 68 C for 30s with a final extension step at

68 C for10 min. Allamplifications were carried outin a VeritiTher-

mal Cycler (Applied Biosystems, USA). The positive amplification

of genes was visualized by electrophoresis of the product in ethid-

ium bromide stained 1.5% and 3% metaphor agarose gel. The PCR

products were purified using QIAquick gel extraction kit (Qiagen,

Germany).

The purified PCR product of T2134A mutation site (193bp) andC190A mutation site (167bp) were subjected to double stranded

custom DNA sequencing. The purified PCR product ofkdr region


6/10



Table 2

Showing slope,LC50 values, RF, level of resistance and its relation to presence/absence of mutation in thepara-sodium channel gene.

Tick isolates Slope SE LC50 values (95% CL) RF against deltamethrin Level of resistancea Na+ channel mutation

DNP 2.42 0.24 55.9 (51.760.4) 4.2 I ND

BEG 2.08 1.32 92.0 (83.6101.2) 6.9 II ND

DRB 2.18 1.37 46.1 (42.350.2) 3.4 I ND

SUL 1.30 0.14 467.1 (399.2546.5) 34.9 III D

N-24P 2.96 0.30 26.9 (16.344.4) 2.0 I ND

S-24P 3.55 0.73 158.0 (149.0167.5) 11.8 II D

PAT 1.62 0.93 69.2 (61.278.2) 5.2 II ND

BTH 2.351.48 102.1 (92.8112.3) 6.7 II ND

LDH 2.32 0.37 90.0 (85.794.5) 7.6 II D

COR 3.44 0.87 71.9 (67.876.2) 5.4 II ND

PRT 1.37 0.32 33.5 (28.938.9) 2.5 I ND

UDP 2.96 0.42 153.6 (143.5164.3) 11.5 II D

BLW 5.09 1.03 114.04 (109.6118.6) 8.5 II D

BSW 0.55 0.22 0.27 (0.180.39) 1.2 S ND

JPR 1.08 0.43 6.1 (5.047.37) 1.4 S ND

BHT 3.30 0.76 65.9 (53.760.3) 4.9 I ND

ALW 0.68 0.27 3.33 (2.195.06) 1.25 S ND

SKR 1.27 0.42 1282.5 (1089.41516.9) 95.7 IV D

aS,susceptible= RF< 1.4; level I= 1.5< RF< 5; level II= 5.1< RF< 25; level III= 26< RF< 40; level IV= RF> 41;D, detected; and ND, not detected.

(434bp) was ligated with the T/A cloning vector pTZ57R/T (InsTAClone, MBI,Fermentas Inc., GmbHGermany) andrecombinantplas-

mids were transformed into E. coli DH5 cells. Plasmid DNA waspurified with a plasmid purification kit (Qiagen, Germany). Insert-

positiveclones wereverifiedby restriction enzyme digestionbefore

sequencing. The positive clones and PCR products were outsourced

to DNA sequencing facility at University of Delhi, South Campus

for double stranded sequencing. The forward and reverse sequence

datawere aligned andanalyzedusing Lasergenesoftware(DNAStar

Inc.,Madison, USA) and BTIsoftware (GeneToolLite,USA)andcom-

pared with homologues in GenBank using BLAST (NCBI). Sequence

information of at least five PCR products/clones from each of the

field isolate was analyzed.

3. Results

The data on slope, LC50, RF values and the level of resistance in

the field isolates are shown in Table 2. Five isolates viz., DNP, DRB,

N-24, PRT and BHT were detected as resistant at level I withRF ran-

gingfrom 2.0to 4.9. Resistance level IIwas detectedin eightisolates

with 5.211.8 RF values while two isolates, SUL and SKR collected

from middle gangetic plain region and western dry region, respec-

tively, were detected as highly resistant and categorized under

level III; RF= 34.9 and level IV; RF= 95.7, respectively. The farm-

ers/farm owners reported frequent applications of higher doses

of deltamethrin due to very low efficacy of the most aggressively

marketed product.

The- and-esterase enzyme activity in terms of enzyme ratio

in collected field isolates of R. (B.) microplus is summarized inTable 3. The correlation data of survival% and - and -esteraseenzyme activity is summarized in Table 4. The enzyme ratio and

survival% of tick isolates were observed significantly (p< 0.001)

correlated with correlation coefficient (r) in - and -esteraseactivities. The correlation coefficient (r) indicates the real correla-

tion between both the variables whichtend to increase or decrease

together when r exists between 0 and 1. The correlation of deter-

mination (R2) for - and -esterase activity indicated that 73.3%and 55.3% data points of field isolates were very close to the corre-

lation lines. However, the correlation was more pronounced with

-esterase than-esterase. When a minimum of 50% survival per-centage at DD was compared, a significant correlation between -and -esterase activities with survival percentages was observed

(Fig. 2A and B).The PCR amplification of domain IIS6 showed clear bands

at 434 bp. The kdr mutation was not detected in any of the

Table 3Esteraseactivityin Indian isolatesofR. (B.) microplus collectedfrom differentplaces.

Tick isolates Resistance factor Survival% -Esterase ratio -Esterase ratio

IVRI-I 1.0 0.0 1.0 1.0

IVRI-IV 42.5 100 3.07 1.77

DNP 4.2 48.9 1.88 2.08

BEG 6.9 60 2.31 2.45

DRB 3.4 35 1.72 1.63

SUL 34.9 86.7 4.35 2.92

N-24P 2.0 65 1.75 1.60

S-24P 11.8 85 3.56 2.89

PAT 5.2 50 1.77 1.85

BTH 6.7 65 2.46 2.71

LDH 7.6 75 4.01 2.79

COR 5.4 56.7 1.44 1.13

PRT 2.5 33.3 1.84 1.4

UDP 11.5 90 3.21 2.46BLW 8.5 100 3.47 2.24

BSW 0.02 10 1.2 1.03

JPR 0.45 15 1.08 1.0

BHT 4.9 50 2.33 2.13

ALW 0.25 20 1.12 1.07

SKR 95.7 100 4.06 2.9

deltamethrin resistant isolates as well as in reference deltamethrin

resistant IVRI-IV line ofR. (B.) microplus. The PCR amplification of

the domain IIIS6 transmembrane segment of the sodium channel

gene from the susceptible and resistant isolates showed a clear

band at 193bp. No mutation was detected at position 2134 (T

to A) in domain IIIS6 transmembrane segment of resistant iso-

lates and also in reference IVRI-IV line (Fig. 3) despite of varying

degree of resistance status. The S4-5 linker region showed clear

band of 167 bp. Sequence analysis from susceptible and resistant

field isolates led to the identification of a cytosine (C) to adenine

(A) nucleotide substitution (CTC to ATC) at position 190 in domain

II S4-5 linker region in six isolates (BLW, LDH, S24-P, SKR, SUL,

and UDP) having high RF in the range of 7.695.7 (Fig. 4). In silico

translation of this nucleotide substitution causes an amino acid

change from leucine in the susceptible isolate to isoleucine (L64I)

Table 4

Correlationbetween survival% and enzyme activity in collected Indian isolates ofR.

(B.) microplus.

E nzyme activity P earso n s corr elat io n

coefficient (r) (95%CL)

p value R2

-Esterase 0.856 (0.65820.9436) 0.0001 0.733-Esterase 0.744 (0.43750.8956) 0.0003 0.553


7/10



Fig. 2. (A) Correlationbetween survival% and-esterase activity in differentIndian

isolatesofR. (B.)microplus. (B)Correlationbetweensurvival%and-esteraseactivity

in different Indian isolates ofR. (B.) microplus.

in the resistant isolate within domain II S4-5 linker of the para-

sodium channel gene. Similar mutation was observed in reference

deltamethrin resistant IVRI-IV line ofR. (B.) microplus.

4. Discussion

Selection for insecticide resistance in pest population is a majorconsequence of using pesticides and is the principal threat to the

efficacy of SPs for the control of vectors of human and animal

diseases. Amongst the different vectors, ticks are ranked second to

mosquitoes in terms of numbers of diseases transmitted to human

andanimals. Of the899 tick species reported throughout the world

(Barker and Murrell, 2004), in India R. (B.) microplus is considered

most economically important tick species infesting livestock and

transmittinga number of diseases like babesiosisand anaplasmosis

(Ghosh et al., 2007). This tick population has immense potential for

rapidly developing resistance due to their biological and behavioral

characteristics and resistance to different active ingredients has

been reported in almost all countries where this parasite occurs

(Alonso-Diaz et al., 2006). Although in India the situation is not

very clear, recently a large scale development of resistance inR. (B.)microplus to OP compound, diazinon (Kumar Sachin et al., 2011)

and SPs (Sharma et al., 2012) and moderate resistant in Hyalomma

anatolicum to both OP and SPs (Shyma et al., 2012) has been

reported. In the present work, discriminating dose bioassay results

with resistance factor were correlated with esterase activity and

the presence or absence of a point mutation in the sodium channel

gene. The resistance status to deltamethrin was established in

eighteen isolates collected from four agro-climatic regions, using

AIT, and the resistance factor (RF) was varied from 2.0 to 95.7.

Out of eighteen populations characterized, 3 populations showed

RF below 1.5 and were designated as susceptible populations.

T T C G G C T C C T T C T T C A C C T T G A A T C T A T Mexico, SusceptibleT T C G G C T C C T T C A T C A C C T T G A A T C T A T Mexico, Resistant

T T C G G C T C C T T C T T C A C C T T G A A T C T A T IVRI-I (HQ157236)

T T C G G C T C C T T C T T C A C C T T G A A T C T A T DNP

T T C G G C T C C T T C T T C A C C T T G A A T C T A T BEG

T T C G G C T C C T T C T T C A C C T T G A A T C T A T DRB

T T C G G C T C C T T C T T C A C C T T G A A T C T A T SUL (HQ157234)

T T C G G C T C C T T C T T C A C C T T G A A T C T A T LDH

T T C G G C T C C T T C T T C A C C T T G A A T C T A T S-24P

T T C G G C T C C T T C T T C A C C T T G A A T C T A T SKR (JQ693155)

T T C G G C T C C T T C T T C A C C T T G A A T C T A T UDP (JQ693156)

T T C G G C T C C T T C T T C A C C T T G A A T C T A T IVRI-IV (JQ693158)

Fig. 3. Sequence analysis of domainIII S-6region. Partial nucleotide sequencealignmentof thedomain IIIS-6 regionof sodium channel gene in Indianand Mexican isolates

ofR. (B.) microplus. Mexican resistant isolate showed T to A nucleotide change while no T to A nucleotide changes were recorded in Indian deltamethrin resistant isolates.

The position of mutation is 2134 in thereference sequence of sodium channel gene (accession no.AF134216).

A C C A T C G G T G C C C T C G G G A A C T T G A C C T Australian susceptibleA C C A T C G G T G C C A T C G G G A A C T T G A C C T Australian resistant

A C C A T C G G T G C C C T C G G G A A C T T G A C C T IVRI-I (HM579820)A C C A T C G G T G C C C T C G G G A A C T T G A C C T ALW (JX262011)

A C C A T C G G T G C C C T C G G G A A C T T G A C C T BSW (JX262012)

A C C A T C G G T G C C C T C G G G A A C T T G A C C T DNP

A C C A T C G G T G C C C T C G G G A A C T T G A C C T BEG

A C C A T C G G T G C C C T C G G G A A C T T G A C C T DRB

A C C A T C G G T G C C A T C G G G A A C T T G A C C T LDH (HM579823)

A C C A T C G G T G C C A T C G G G A A C T T G A C C T SUL (HM579821)

A C C A T C G G T G C C A T C G G G A A C T T G A C C T S-24P (HM579824)

A C C A T C G G T G C C A T C G G G A A C T T G A C C T BLW (JX262013)A C C A T C G G T G C C A T C G G G A A C T T G A C C T SKR (JQ693152)

A C C A T C G G T G C C A T C G G G A A C T T G A C C T UDP (JQ693153)

A C C A T C G G T G C C A T C G G G A A C T T G A C C T IVRI-IV (JQ693154)

Fig. 4. Sequence analysis of domainII S4-5 linkerregion. Partial nucleotide sequence alignmentof thedomain II S4-5 linkerregion of para-sodium channel gene of different

isolates ofR. (B.) microplus showing C to A mutation in isolates having high RF and in deltamethrin resistant IVRI-IV line. This position is 190 in the reference sequence,

accession no. AF134216.


8/10



The other fifteen populations were considered resistant at IIV

level according to the classification ofKumar Sachin et al. (2011).

From the data it is very clear that two isolates, SUL and SKR

having RF of 34.9 and 95.7, respectively, were collected from the

areas where SPs are probably not at all effective against the tick

populations. In both the areas use of SPs has reached at alarmingly

high level without maintaining any dose regime (Sharma et al.,2012). Besides, six samples (Table 2) were having RF more than

6.0, a level considered enough to impair the use of deltamethrin in

the field (Patarroyo and Costa, 1980). The isolates characterized as

susceptible were collected from the areas where OP compounds

are more frequently used than SP and thus high level of resistance

to diazinon wasrecordedin these areas (Kumar Sachinet al., 2011).

Esterase based resistance has been demonstrated to be one of

themechanismsfor SPs andOP detoxificationin insects andin R. (B.)

microplus. However, the specific mechanism through which resis-

tance is conferred has not been suitably elucidated (Hemingway

et al., 1993; Rosario-Cruz et al., 1997; Jamrozet al., 2000; Zhu et al.,

2004). In the present study, 73.3% and 55.3% data points for and-esterase, respectively, of field isolates were close to the correla-

tion point with survival percentages confirming esterase mediatedresistant mechanism is operating in R. (B.) microplus population in

India (Table 4).

The in silico analysis was performed to detect point mutations

in three specific regions of the sodium channel gene of the field

isolated, R. (B.) microplus. One major mechanism of resistance tar-

getingthe sodiumchannelgeneis knownas knock down resistance

(kdr) in which there is reduced target site sensitivity for pyrethroids

resulting from one or more point mutations in domain IIS6 of

sodium channel gene. The most frequently encountered mutation

ofkdr found in the house fly include a substitution of leucine by

phenylalanine (L1014F) and a variety of this mutations (L1014S

or L1014H) are found in a range of important agricultural and

disease-transmitting arthropods including tobacco budworm (Park

and Taylor, 1997), horn fly, Haematobia irritans (Guerrero et al.,

1997), diamondback moth, Plutella xylostella (Schuler et al., 1998),

peach-potato aphid,Myzuspersicae (Martinez-Torres et al., 1999a),

mosquitoes,Anopheles gambiae and Culex pipiens (Martinez-Torres

etal., 1999b) and Colorado potato beetle, Leptinotarsa decemlineata

(Lee et al., 1999). Although kdrmutation is the most widely found

mutation associated with pyrethroid resistance, it is not detected

in any of the pyrethroid resistant Mexican isolates of southern cat-

tle tick, R. (B.) microplus (He et al., 1999; Jamroz et al., 2000). The

present investigation also failed to detect mutation in this region

of sodium channel gene (domain IIS6) in the resistant isolates ofR.

(B.) microplus from India (Fig. 3).

Another nucleotide substitution at position 2134 (T2134A) in

domain IIIS6 transmembrane segment of the sodium channel gene

was detected in San Felipe and Corrales isolates ofR. (B.) microplus

in Mexico that were extremely resistant to pyrethroid permethrin(He et al., 1999). To date this mutation in domain IIIS6 has been

detected in many tick isolates from North America (Guerrero et al.,

2002; Rosario-Cruz et al., 2005; Miller et al., 2007; Chen et al.,

2009; Aguirre et al., 2010; Rodriguez-Vivas et al., 2012). Resis-

tance conferring mutations in the domain IIIS6 transmembrane

segment of the sodium channel gene have also been identified in

several pyrethroid resistant arthropods such as fruitfly, Dorsophila

melanogaster (Pittendrigh et al., 1997; Martin et al., 2000), two-

spotted spider mites, Tetranychusurticae (Tsagkarakou et al., 2009),

itchmites, Sarcoptes scabiei (Pasay et al., 2008) and mosquito,Aedes

aegypti (Yanolaet al., 2010). The double stranded sequence analysis

fromeighteenpyrethroidresistant tickisolatesand fromlaboratory

established deltamethrin resistantIVRI-IV line did notdetect muta-

tions in the domain IIIS6 region of sodium channel gene of Indianisolates ofR. (B.) microplus. The absence of T2134A mutation has

also been reported in various pyrethroid resistant tickisolates from

Australia and Brazil (Li et al., 2007; Chen et al., 2009; Rosario-Cruz

et al., 2009; Andreotti et al., 2011).

A mutation which included substitution of adenine (A) by cyto-

sine (C) (CTC to ATC) was reported at position 190 in the domain

II S4-5 linker of the sodium channel gene of Parkhurst isolate ofR.

(B.) microplus from Australia, which was resistant to all pyrethroids

including flumethrin, cyhalothrin and deltamethrin (Morgan et al.,2009). A similar mutation has been discovered in whitefly,B. tabaci

(Morin et al., 2002) and head lice, Pediculus capatis (Lee et al., 2000)

in whichit confers resistance to SPs. In thepresent investigations,a

mutation in the domainII S4-5 linker region of the sodium channel

gene has been detected in six populations having high resistance

factors (level IIlevel IV). This is the first report from India detec-

ting a point mutation in the para-sodium channel gene possibly

responsible for conferring high level of resistance against SP in R.

(B.) microplus.

In the present study, a direct correlation between RF, esterase

activity and mutation (C190A) in the domain II S4-5 linker of para-

sodium channel gene was observed when RF is reached more than

7.6. The results gives a significant clue to develop a monitoring and

warning system to restrict the use of SPs in area (s) where RF hasreached above the threshold level of 7.6.

The analysis of mutation in the sodium channel gene of R.

(B.) microplus from Australia, Brazil, Mexico and India leads to

the conclusion that different resistance mechanism have appar-

ently developed between these isolates ofR. (B.) microplus. These

results suggest that distinct sodium channel gene mutations may

be selected in differentarthropod species in response to pyrethroid

drug pressure and due to geographical isolation (He et al., 1999;

Pasayet al., 2006).In a recentreview Guerrero et al. (2012) reported

that Domain III mutation seems to be localized to North America,

the Morgan et al. (2009) mutation was discovered in Australia but

also reported in Brazil (Nogueira Domingues et al., 2012) while the

Jonsson et al. (2010) mutation is only reported in Australia. The

present information added new dimension to the distribution of

domain II mutation in the cattle tick, R. (B.) microplus.

5. Conclusions

In India, the R. (B.) microplus populations have developed

resistanceto deltamethrinand mechanismof development of resis-

tance has possibly been mediated by over-expression of esterase

enzymes and mutation in domain II S4-5 linker region of para-

sodium channel gene.

Acknowledgements

The authors are grateful to Indian Council of Agricul-

tural Research, New Delhi for funding through World Bank

funded National Agricultural Innovation Project No. NAIP/Comp-

4/C2066/2008-09. Authors are also grateful to the Veterinary

officers posted at different tick collection spots for their support.

References

Aguirre, M., Flores, E.A., Alvarez, G., Molina, A., Rodriguez, I ., Ponce, G., 2010. Anovel amino acid substitutionin thepara-sodiumchannelgenein Rhipicephalusmicroplus(Acari, Ixodidae)associatedwith knockdownresistance.Experimentaland Applied Acarology 52, 377382.

Alonso-Diaz, M.A.,Rodriguez-Vivas, R.I.,Fragoso-Sanchez,H., Rosario-Cruz, R.,2006.Ixodicide resistance of the Boophilus microplus tick to ixodicides. Archivos deMedicina Veterinaria 38, 105114.

Andreotti, R., Guerrero,F.D., Soares, M.A., Barros, J.C., Miller, R., Perez De Leon, A.A.,2011.AcaricideresistanceofRhipicephalus(Boophilus) microplus inStateof MatoGrossodo Sul,Brazil.Revista Brasileirade Parasitologia Veterinria 20, 127133.

Barker, S.C., Murrell, A., 2004. Systematics and evolution of ticks with a list of validgenus and species names.Parasitology 129, S15S36.Benavides, O.E., Romero, N.A., Rodriguez, J.L., Silva, Z.J., 1999. Evidencia preliminar

de la aparicion de resistencia a lactonas macrociclicas en cepas de garrapata


9/10


10/10



Tsagkarakou, A.,Van Leeuwen,T., Khajehali,J., Ilias,A., Grispou,M., Williamson, M.S.,Tirry, L.,Vontas,J., 2009.Identificationof pyrethroidresistanceassociated muta-tions in the para sodium channel of the two-spotted spider mite Tetranychusurticae (Acari, Trtranychidae). Insect Molecular Biology 18, 583593.

Yanola, J., Somboon, P., Walton, C., Nachaiwieng, W., Prapanthadara, L., 2010. Anovel F1552/C1552 point mutation in theAedes aegypti voltage-gated sodium

channel geneassociated withpermethrinresistance.PesticideBiochemistry andPhysiology 96, 127131.

Zhu, Y.C., Snodgrass, G.L., Chen, M.S., 2004. Enhanced esterase gene expres-sion and act ivit y in a malath ion -re sistant s tr ain o f t he t ar nishe d plantbug, Lygus lineolaris. Insect Biochemistry and Molecular Biology 34,11751186.

Sodium Channel Mutation in acaricide resitant Ticks in India

Documents