SI Appendix Reproducible Copy Number Variation Patterns among Single Circulating Tumor Cells of Lung Cancer Patients Xiaohui Ni, Minglei Zhuo, Zhe Su, Jianchun Duan, Yan Gao, Zhijie Wang, Chenghang Zong, Hua Bai, Alec Chapman, Jun Zhao, Liya Xu, Tongtong An, Qi Ma, Yuyan Wang, Meina Wu, Yu Sun, Shuhang Wang, Zhenxiang Li, Xiaodan Yang, Jun Yong, Xiao-Dong Su, Youyong Lu, Fan Bai, X. Sunney Xie, and Jie Wang Supporting Materials: SI Materials and Methods Figs. S1-S17 Tables S1-S5 SI Materials and Methods Patient Recruitment and Clinical Information. We enrolled 16 patients that were initially diagnosed with metastatic lung adenocarcinoma (ADC) or small cell lung cancer (SCLC). A summary of patient information was listed in Table S1. 10 ml of blood samples were drawn from each patient, 7.5 ml for CTC analyses and the other 2.5 ml for blood genomic DNA (gDNA) extraction. Of the 16 participants, 6 patients (Patient 1 – Patient 6) with ADC, 1 patient (Patient 7) with ADC+SCLC, and 4 patients (Patient 8 – Patient 11) with SCLC were chosen for subsequent sequencing study. The tumor cell content was estimated from haematoxylin and eosin (H&E)-stained formalin-fixed paraffin-embedded (FFPE) tumor sections. The fraction of 1 of 30
30
Embed
SI Appendix - PNAS · 2013-12-04 · SI Appendix Reproducible Copy Number Variation Patterns among Single Circulating Tumor Cells of Lung Cancer Patients Xiaohui Ni, Minglei Zhuo,
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
SI Appendix
Reproducible Copy Number Variation Patterns among Single Circulating
Tumor Cells of Lung Cancer Patients
Xiaohui Ni, Minglei Zhuo, Zhe Su, Jianchun Duan, Yan Gao, Zhijie Wang, Chenghang Zong, Hua
Bai, Alec Chapman, Jun Zhao, Liya Xu, Tongtong An, Qi Ma, Yuyan Wang, Meina Wu, Yu Sun,
Shuhang Wang, Zhenxiang Li, Xiaodan Yang, Jun Yong, Xiao-Dong Su, Youyong Lu, Fan Bai, X.
Sunney Xie, and Jie Wang
Supporting Materials:
SI Materials and Methods
Figs. S1-S17
Tables S1-S5
SI Materials and Methods
Patient Recruitment and Clinical Information. We enrolled 16 patients that were initially
diagnosed with metastatic lung adenocarcinoma (ADC) or small cell lung cancer (SCLC). A
summary of patient information was listed in Table S1. 10 ml of blood samples were drawn from
each patient, 7.5 ml for CTC analyses and the other 2.5 ml for blood genomic DNA (gDNA)
extraction. Of the 16 participants, 6 patients (Patient 1 – Patient 6) with ADC, 1 patient (Patient
7) with ADC+SCLC, and 4 patients (Patient 8 – Patient 11) with SCLC were chosen for
subsequent sequencing study. The tumor cell content was estimated from haematoxylin and
eosin (H&E)-stained formalin-fixed paraffin-embedded (FFPE) tumor sections. The fraction of
1 of 30
tumor was estimated to be more than 70% in all FFPE samples by two senior pathologists, which
excluded the possibility of low tumor content in complicating data analyses.
Among the six ADC patients, Patient 1 is a female patient with liver metastasis who never
smoked. She carried EGFR exon 19 deletion mutation. She received palliative resection of her
primary tumor, followed by six cycles of pemetrexed plus carboplatin as a first-line therapy with
partial response (PR). After a 5-month interval without any drug exposure, her liver metastasis
progressed. The patient received erlotinib as the second-line therapy. One month after the start of
the treatment, a response evaluation showed disease progression and erlotinib failure by CT scan
(Fig 1). A 7.5 ml of blood was drawn for CTC isolation and genomic analyses were performed.
The CTCs exhibited genomic characteristic of small cell lung cancer. Biopsy of the liver
metastasis showed histological type of SCLC, which was confirmed by neuroendocrine
immunohistochemical staining with synaptophysin (Fig. 1). To exclude the possibility that
metastatic SCLC in liver derived from the mixture of ADC and SCLC within the primary
pulmonary tumor, serial sections from four paraffin blocks from different regions of resected
samples were examined and the histology was confirmed by H&E staining and tissue-specific
markers such as thyroid transcription factor 1 (TTF-1) to be ADC without visible SCLC
component. Etoposide plus cisplatin was administered for 6 cycles with a dramatic clinical
response. Patients 2, 3 and 5 received pemetrexed or docetaxel plus platinum as first-line
therapy; their CTCs were obtained before initiating first-line chemotherapy. Patient 4’s tumor
tissues were not obtained at the time point of CTC isolation. Sequencing of CTCs revealed
EGFR exon 19 deletion mutation in Patient 4. Patient 6 carried EGFR mutation and her CTCs
were obtained during the first cycle of pemetrexed plus carboplatin.
2 of 30
Patient 7 was diagnosed as a mixture of ADC and SCLC in the lung. CTCs from Patient 7
were obtained before the start of first-line therapy. Docetaxel plus nedaplatin was administered
for 6 cycles followed by 4 cycles of docetaxel. This patient has PR at cycles 2, 4, 6, 8, and PD at
cycle 10. Biopsy of the liver metastasis showed histological type of SCLC. This patient received
irinotecan as second-line therapy.
Among the 4 SCLC patients with extensive-stage SCLC, Patient 8’s CTCs were isolated at
three time points: before chemotherapy, after partial response to first-line chemotherapy with
etoposide plus platinum for 2 cycles, and after disease progression to second-line chemotherapy
with topotecan. CTCs from the other 3 SCLC patients were isolated before first-line
chemotherapy.
This study was approved by the institutional ethics committee at Peking University Cancer
Hospital & Institute and the Committee on the Use of Human Subjects at Harvard University. All
participants provided written informed consent form.
Copy Number Determination from Whole-genome Sequencing Data. The copy number
variant regions were identified according to the procedure in Ref. 1. Briefly, the likely diploid
regions were determined from the normalized (by total reads) coverage at a bin size of 500 kb
using the hidden Markov model (HMM) with the coverage from single leukocytes from eight
patients as control. A binary array, which indicates whether a single cancer cell has higher
coverage than the normal leukocyte, is taken as emission in our HMM. Three states, one, two, or
three copies, have been assumed to exist in our coverage data.
Two constants, a and b, were empirically chosen to represent the rate per bin for abnormal
copy number to begin and end, respectively. In our HMM, transitions among the three states can
be described with a transition matrix:
3 of 30
For a state with copy number s, the emission probability for observing more coverage in the
cancer cells is assumed as p(X1*s/2>Xo), where X1 and Xo are random variables retrieved from
the observed distribution of coverage in the normal leukocyte. Given the above parameters, the
likely state path can be solved using Viterbi algorithm, which provides a coverage normalization
factor so that regions determined to be diploid would have a mean coverage of 2.
After the above procedures, we employed a second HMM which allows six hidden states (N
= 0 to 5 copies) for a more precise identification of variations. The emissions of this model are
the coverage of the cancer cells, normalized by normal leukocytes.
The transition matrix for the second HMM is similar to the first one except that all transitions
to an abnormal copy number state have a probability a/N, and transitions from an abnormal state
to the diploid state have a probability b.
The coverage of the diploid regions determined in the previous step was used to represent the
emission probabilities of the two copy state, denoted by p2. The single copy state emission
probabilities p1 was assumed to satisfy p2=p1 p1, where denotes convolution. Once p1 is
solved by deconvolution, the emission probabilities for higher copy states can be determined
from the iterative relation pn=pn-1 p1.
The Viterbi algorithm is again applied to determine the most likely state path. The
determined diploid regions are then used to provide an updated normalization factor for further
repeat. We used twenty iterations to ensure sufficient convergence.
Validation of SNVs and CNVs. Blood genomic DNA and a normal leukocyte from each patient
were sequenced as a control for variant calling.
4 of 30
Our study yielded 410 non-synonymous mutations across 28 (24 CTCs, 4 FFPE tissues)
samples in four ADC patients (Patients 1-4). We validated 10 SNVs in 10 genes (RB1, PIK3CA,
followed by Sanger sequencing or deep sequencing. The distribution of SNVs among CTCs,
primary and metastatic tumors are shown in Fig. 2A and Fig. S1. The genes and primer pairs for
the validation are listed in Table S5. The validation was performed by 38 cycles of PCR reaction
followed by Sanger sequencing. In order to reduce PCR bias, we performed a total of 30 cycles
of two-step PCR reactions with different primer pairs in each step, followed by deep sequencing,
to check RB1 and PIK3CA mutations in the primary tumor.
Of 29 SNVs in CTCs, one was considered to be wild type by Sanger sequencing,
corresponding to a false positive rate of 1/29. Of the 19 wild type CTC samples that SNV was
detected in other CTCs or tumor tissues of the same patient, Sanger sequencing confirmed they
are all true negative (0/19). The false positive rate was 1/7 in tumor tissues. To estimate the rate
of false negative SNV calls in tumors, we checked SNVs that detected in CTCs and/or metastatic
(primary) tumor but not in the primary (metastatic) tumor of the same patient. 3 out of 7 SNVs
were confirmed to exist in the primary (metastatic) tumor. False negatives of SNVs in the tumors
could be due to the low mutation frequency instead of sequencing errors of next-generation
sequencing platforms. We didn’t exclude those false negative findings in Fig. 2 and Fig. S1 for a
better understanding of tumor heterogeneity.
None of the eight leukocytes from four ADC and four SCLC patients have shown distinct
CNVs. We further verified the amplification of c-Myc gene and TERT gene in CTC using the
digital PCR technique. One CTC and one normal leukocyte from the same patient were
respectively lysed and aliquoted to 24 tubes to ensure that multiple copies of DNA were
5 of 30
distributed into different tubes. The whole genome amplification product of each aliquot was
subjected to PCR reactions targeting c-Myc gene (forward primer,
CCGGCGAGAGAAAGAAGAAA; reverse primer: GGGAGGCAGTCTTGAGTTAAA) and
TERT gene (forward primer, CACTGCTGGCCTCATTCA; reverse primer:
CCCTTTGCAGATGTGGTCT). The PCR products were loaded in a 1.5% agarose gel. The
bands that appeared in the gel were counted (Fig. S11). Six copies (hexaploid) of c-Myc gene and
five copies of TERT gene were found in CTC. Two copies (diploid) of c-Myc gene and TERT
gene were found in the normal leukocyte. This result was consistent with our observation that the
chromosome region containing c-Myc gene was amplified in 19 of 19 CTCs of ADC patients 2-6
and TERT gene was amplified in 17 of 19 CTCs of ADC patients 2-6.
References
1. Zong C, Lu S, Chapman AR, Xie XS (2012) Genome-wide detection of single-nucleotide and
copy-number variations of a single human cell. Science 338(6114):1622-1626.
6 of 30
A B
WT
Mutant (hetero.)
Mutant (homo.)
C
Fig. S1. Detection of SNVs and INDELs in CTCs and metastatic tumors. (A) Non-synonymousheterozygous (hetero.) and homozygous (homo.) mutations in CTCs and the metastatic (Meta.)tumor of Patient 2 (mutations without coverage in CTCs are excluded). (B) Non-synonymousmutations in CTCs and the metastatic tumor of Patient 3. (C) Non-synonymous mutations inCTCs of Patient 4. Blank region represents no sequence coverage.
Fig. S4. Copy number variations in Patient 2. Normalized sequence reads and copy
numbers are visualized in a Circos (A) and a linear plot (B). The copy numbers were
segmented (blue and red lines) with HMM (see Materials and Methods).
Patient 3
A B
Fig. S5. Copy number variations in Patient 3. Normalized sequence reads and copy numbers are
visualized in a Circos (A) and a linear plot (B).
9 of 30
Patient 4
A
B
Fig. S6. Copy number variations in Patient 4.
Normalized sequence reads and copy
numbers are visualized in a Circos (A) and a
linear plot (B).
Fig. S7. Copy number variations in Patient 5.
Fig. S8. Copy number variations in Patient 6.
Fig. S9. Copy number variations in Patient 7.
This patient has a mixture of ADC and SCLC
in the lung.
10 of 30
q value Fig. S10. Statistical
significance of gain and
loss regions in CTCs of
ADC patients (Patients 2-
6). The gains (red) and
losses (blue) are plotted
across the genome (Y-
axis). The q value (X-axis)
at each chromosome
position is calculated
(Materials and Methods).
A significant level of 10-
4.76 for gains and 10-4.18 for
losses (black lines) are
given according to the q
values of gains and losses
in eight normal
leukocytes. Important
cancer associated genes in
the significant gain or loss
regions are marked.
Normal leukocyte CTC
Normal leukocyte CTC
C-Myc
TERT
Fig. S11. Validation of c-Myc gene and TERT gene amplification in CTC with digital PCR.
One CTC and one normal leukocyte from the same patient were lysed and aliquoted,
respectively, to 24 tubes to ensure that multiple copies of DNA were distributed into different
tubes. The whole genome amplification product of each aliquot was subjected to PCR
reactions targeting c-Myc gene and TERT gene. The bands appeared in the gel were counted.
Two copies (diploid) of c-Myc gene and two copies of TERT gene were found in the normal
leukocyte. Six copies (hexaploid) of c-Myc gene and five copies of TERT gene were found in
the CTC.
11 of 30
Patient 8
A
B
Fig. S12. Copy number variations in Patient 8
(before chemotherapy). Normalized sequence
reads and copy numbers are visualized in a
Circos (A) and a linear plot (B).
12 of 30
Patient 9
A B
Fig. S13. Copy number variations in Patient 9. Normalized sequence reads and copy numbers
are visualized in a Circos (A) and a linear plot (B).
Patient 10
A B
Fig. S14. Copy number variations in Patient 10. Normalized sequence reads and copy numbers
are visualized in a Circos (A) and a linear plot (B).
13 of 30
Patient 11
A
B
Fig. S15. Copy number variations in Patient
11. Normalized sequence reads and copy
numbers are visualized in a Circos (A) and a
linear plot (B).
14 of 30
WT Mutant (hetero.) Mutant (homo.)
Before chemo. First-line chemo. Second-line chemo.
Fig. S16. Detection of SNVs and INDELs in CTCs and metastatic tissue of Patient 8. Non-synonymous heterozygous (hetero.) and homozygous (homo.) mutations in CTCs before, andduring first-line and second-line chemotherapy were shown (mutations with low coverage inCTCs are excluded). Blank region represents no sequence coverage.
Table S2. Common chromosome regions with gain or loss in CTCs of ADC patients 2-6.
Common gain regions were found in more than 16 CTCs and loss regions were found in more than 7 CTCs. *Genes in these regions with most frequent CNVs or genes that listed in Cancer Gene Census (http://www.sanger.ac.uk/genetics/CGP/Census), or Kyoto Encyclopedia of Genes and Genomes (KEGG) Pathway in Cancer.
Percentage of coverage for target and its flanking (200 bp outside the target region boundaries) regions for individual CTCs, normalleukocytes, primary (Pri.) and/or metastastic (Meta.) tumors from each patient. The percentage of target regions that were covered at>1x, >4x, >10x, >20x were shown.
8
Table S3. Exome capture sequence coverage.
Target regions at x Fold Coverage (%)Mean Depth
Patient
Coverage(%)
SampleYield bases
(Mb)
Mapped Bases(%)
19 of 30
Chr PositionWild
typeMutant
Change
typeGene name Trancript_ID
Exon
RankEffect
old_AA/
new_AA
Old_codon/
New_codonCodon# Dist.
1 19415329 C T SNP UBR4 NM_020765 98 NON_SYNONYMOUS R/H cGc/cAc 4785 C/M
1 26671625 A G SNP AIM1L NM_001039775 2 SYNONYMOUS S/S tcT/tcC 508 P/M
1 35824705 A G SNP ZMYM4 NM_005095 3 NON_SYNONYMOUS N/D Aat/Gat 89 C/M
1 177133576 G A SNP ASTN1 NM_207108 1 SYNONYMOUS V/V gtC/gtT 79 C/M
1 186275982 C T SNP PRG4 NM_005807 7 SYNONYMOUS T/T acC/acT 377 C
1 199997039 G A SNP NR5A2 NM_003822 1 NON_SYNONYMOUS V/M Gtg/Atg 22 M
1 204378887 C T SNP PPP1R15B NM_032833 1 SYNONYMOUS E/E gaG/gaA 551 C/M
2 74007164 C T SNP DUSP11 NM_003584 1 NON_SYNONYMOUS E/K Gag/Aag 27 P/C/M
2 112933344 G A SNP FBLN7 NM_153214 4 NON_SYNONYMOUS G/R Gga/Aga 154 M
2 125521689 T C SNP CNTNAP5 NM_130773 16 NON_SYNONYMOUS L/P cTt/cCt 832 M
2 179423113 C A SNP TTN NM_003319 155 NON_SYNONYMOUS D/Y Gac/Tac 19960 P/C/M
2 179596666 T C SNP TTN NM_133378 55 NON_SYNONYMOUS I/V Att/Gtt 4402 C
2 179612324 T C SNP TTN NM_133379 46 NON_SYNONYMOUS I/V Atc/Gtc 4935 P/C/M
2 200813085 A T SNP TYW5 NM_001039693 2 SYNONYMOUS A/A gcT/gcA 63 C/M
2 206869847 C T SNP INO80D NM_017759 11 NON_SYNONYMOUS E/K Gag/Aag 777 P
2 209212646 C T SNP PIKFYVE NM_015040 35 NON_SYNONYMOUS S/F tCt/tTt 1758 C/M
2 220366721 C T SNP GMPPA NM_013335 5 STOP_GAINED R/* Cga/Tga 131 C/M
3 27431460 T A SNP SLC4A7 NM_003615 22 NON_SYNONYMOUS I/L Ata/Tta 1099 P
3 30691922 G A SNP TGFBR2 NM_003242 3 NON_SYNONYMOUS E/K Gag/Aag 142 C/M
3 51907931 G A SNP IQCF5 NM_001145059 2 NON_SYNONYMOUS R/C Cgt/Tgt 89 C/M
3 118906753 C T SNP UPK1B NM_006952 3 SYNONYMOUS I/I atC/atT 67 C/M
3 127298688 G C SNP TPRA1 NM_016372 2 SYNONYMOUS L/L ctC/ctG 51 P/C/M
3 142274740 * +T INS ATR NM_001184 10 FRAME_SHIFT -/? -/A 774 C
3 155615734 A G SNP GMPS NM_003875 3 SYNONYMOUS G/G ggA/ggG 76 C
3 178936091 G A SNP PIK3CA NM_006218 10 NON_SYNONYMOUS E/K Gag/Aag 545 C/M
4 183651411 G A SNP ODZ3 NM_001080477 14 NON_SYNONYMOUS V/I Gta/Ata 882 C/M
5 112179782 C T SNP APC NM_000038 16 NON_SYNONYMOUS P/S Cct/Tct 2831 C/M
5 127647024 T C SNP FBN2 NM_001999 39 NON_SYNONYMOUS Y/C tAc/tGc 1681 P/C
5 140209662 G A SNP PCDHA6 NM_018909 1 SYNONYMOUS T/T acG/acA 662 M
5 141353167 A T SNP RNF14 NM_001201365 3 NON_SYNONYMOUS D/V gAt/gTt 5 C/M
5 159680609 G A SNP CCNJL NM_024565 7 STOP_GAINED Q/* Cag/Tag 362 C/M
6 12015758 G A SNP HIVEP1 NM_002114 SPLICE_SITE_ACCEPTOR C/M
6 28542592 G A SNP SCAND3 NM_052923 3 SYNONYMOUS P/P ccC/ccT 630 C
6 31473633 A C SNP MICB NM_005931 2 NON_SYNONYMOUS K/Q Aag/Cag 104 P/C/M
6 34835056 C A SNP UHRF1BP1 NM_017754 16 NON_SYNONYMOUS A/D gCt/gAt 1156 P
6 35423973 G A SNP FANCE NM_021922 2 NON_SYNONYMOUS R/K aGa/aAa 233 C/M
6 52996883 C A SNP GCM1 NM_003643 4 NON_SYNONYMOUS K/N aaG/aaT 121 M
6 133767828 A G SNP EYA4 NM_004100 4 SYNONYMOUS P/P ccA/ccG 48 C/M
7 11446018 C T SNP THSD7A NM_015204 21 SYNONYMOUS V/V gtG/gtA 1382 C
7 55242465 *
-GGAATTAAGAGAAGC
DEL EGFR NM_005228 19CODON_CHANGE_PLUS_C
ODON_DELETIONKELREA/K
aaggaattaagagaagca/
aaa745 P/C/M
7 64439463 T C SNP ZNF117 NM_015852 4 SYNONYMOUS E/E gaA/gaG 162 C/M
7 110763611 T A SNP LRRN3 NM_018334 2 NON_SYNONYMOUS N/K aaT/aaA 261 M
7 142881465 G C SNP TAS2R39 NM_176881 1 SYNONYMOUS L/L ctG/ctC 318 P/C/M
8 73480124 C T SNP KCNB2 NM_004770 2 NON_SYNONYMOUS T/M aCg/aTg 52 C/M
9 15203853 G A SNP TTC39B NM_152574 7 NON_SYNONYMOUS L/F Ctc/Ttc 243 C/M
9 88284462 T C SNP AGTPBP1 NM_015239 8 SYNONYMOUS G/G ggA/ggG 200 C
10 94835050 C T SNP CYP26A1 NM_057157 4 NON_SYNONYMOUS R/W Cgg/Tgg 215 C/M
10 100174885 G A SNP PYROXD2 NM_032709 1 NON_SYNONYMOUS A/V gCa/gTa 3 P
10 116093049 C T SNP AFAP1L2 NM_032550 3 NON_SYNONYMOUS D/N Gat/Aat 51 C/M
11 1094855 C T SNP MUC2 NM_002457 32 SYNONYMOUS Y/Y taC/taT 1977 P
11 5221097 G A SNP OR51V1 NM_001004760 1 SYNONYMOUS S/S tcC/tcT 278 C/M
11 30928186 C T SNP DCDC5 NM_020869 11 SYNONYMOUS L/L ctG/ctA 442 C/M
11 64677277 G A SNP ATG2A NM_015104 14 SYNONYMOUS G/G ggC/ggT 661 C/M
11 100863155 C G SNP TMEM133 NM_032021 1 NON_SYNONYMOUS P/R cCc/cGc 39 C/M
11 123484217 C T SNP GRAMD1B NM_020716 15 NON_SYNONYMOUS S/F tCt/tTt 550 P/C/M
11 125888323 A G SNP CDON NM_016952 5 NON_SYNONYMOUS V/A gTa/gCa 181 P/C/M
12 11174534 T C SNP TAS2R19 NM_176888 1 NON_SYNONYMOUS S/G Agc/Ggc 213 P/C
12 57642536 C T SNP STAC3 NM_145064 4 NON_SYNONYMOUS E/K Gaa/Aaa 129 P
12 81762589 G A SNP PPFIA2 NM_003625 13 NON_SYNONYMOUS S/L tCg/tTg 466 M
12 100478342 A C SNP UHRF1BP1L NM_015054 10 SYNONYMOUS V/V gtT/gtG 400 P
12 105600927 G A SNP APPL2 NM_018171 8 NON_SYNONYMOUS S/F tCc/tTc 178 C/M
13 48941648 C T SNP RB1 NM_000321 10 STOP_GAINED R/* Cga/Tga 320 C/M
13 95095801 T C SNP DCT NM_001922 7 NON_SYNONYMOUS I/V Att/Gtt 424 C
13 96743296 G A SNP HS6ST3 NM_153456 1 SYNONYMOUS A/A gcG/gcA 60 M
14 20711536 G T SNP OR11H4 NM_001004479 1 NON_SYNONYMOUS A/S Gct/Tct 196 C/M
14 20760258 G A SNP TTC5 NM_138376 9 NON_SYNONYMOUS P/S Cct/Tct 363 C/M
14 21875094 C T SNP CHD8 NM_020920 14 NON_SYNONYMOUS R/H cGt/cAt 664 C/M
15 80445418 G A SNP FAH NM_000137 1 NON_SYNONYMOUS E/K Gag/Aag 8 M
16 89805613 G A SNP FANCA NM_000135 41 SYNONYMOUS V/V gtC/gtT 1365 P
17 7578466 G A SNP TP53 NM_000546 5 NON_SYNONYMOUS T/I aCc/aTc 155 C/M
17 10204904 G A SNP MYH13 NM_003802 40 SYNONYMOUS S/S agC/agT 1928 P
17 33316621 T A SNP LIG3 NM_002311 4 NON_SYNONYMOUS N/K aaT/aaA 276 C
17 33884155 G A SNP SLFN14 NM_001129820 1 SYNONYMOUS V/V gtC/gtT 309 M
17 42957991 T C SNP EFTUD2 NM_004247 8 NON_SYNONYMOUS T/A Act/Gct 184 C
17 43181196 G A SNP NMT1 NM_021079 10 SYNONYMOUS Q/Q caG/caA 428 C
17 56663238 G T SNP TEX14 NM_031272 18 SYNONYMOUS G/G ggC/ggA 998 P
17 80202688 G A SNP CSNK1D NM_001893 9 NON_SYNONYMOUS S/F tCc/tTc 406 P
18 30847211 A G SNP C18orf34 NM_198995 13 SYNONYMOUS S/S agT/agC 409 P
Table S4. Summary of non-synonymous and synonymous SNVs and INDELs identified in CTCs and tumor tissues from five patients.
Patient 1
20 of 30
18 61649004 T C SNP SERPINB8 NM_002640 4 NON_SYNONYMOUS L/S tTg/tCg 119 C
18 67365812 C T SNP DOK6 NM_152721 5 SYNONYMOUS F/F ttC/ttT 194 P/C
19 11036381 C T SNP YIPF2 NM_024029 5 SYNONYMOUS R/R cgG/cgA 116 P
19 49867931 G A SNP DKKL1 NM_014419 2 NON_SYNONYMOUS D/N Gat/Aat 35 P
19 50361847 G A SNP PTOV1 NM_017432 10 SYNONYMOUS Q/Q caG/caA 326 P/C/M
19 50550285 G A SNP ZNF473 NM_015428 5 NON_SYNONYMOUS R/H cGt/cAt 862 C/M
19 53572491 T C SNP ZNF160 NM_033288 6 SYNONYMOUS K/K aaA/aaG 432 C/M
20 62195987 G C SNP PRIC285 NM_033405 3 NON_SYNONYMOUS F/L ttC/ttG 827 P
21 46032482 C T SNP KRTAP10-8 NM_198695 1 SYNONYMOUS C/C tgC/tgT 155 P/C/M
22 19504166 G A SNP CDC45 NM_003504 16 SYNONYMOUS K/K aaG/aaA 519 C/M
22 38710124 C T SNP CSNK1E NM_001894 2 SYNONYMOUS R/R cgG/cgA 13 C/M
X 55479352 G C SNP MAGEH1 NM_014061 1 NON_SYNONYMOUS R/T aGg/aCg 182 C/M
X 77913105 A T SNP ZCCHC5 NM_152694 2 SYNONYMOUS T/T acT/acA 271 M
X 101972299 G A SNP GPRASP2 NM_138437 4 SYNONYMOUS V/V gtG/gtA 834 C/M
X 102931628 C T SNP MORF4L2 NM_012286 4 NON_SYNONYMOUS E/K Gaa/Aaa 110 C/M
X 123519644 C T SNP ODZ1 NM_014253 28 NON_SYNONYMOUS E/K Gag/Aag 1980 C/M
X 132887970 C T SNP GPC3 NM_004484 3 NON_SYNONYMOUS A/T Gcc/Acc 191 M
X 148797710 C G SNP MAGEA11 NM_005366 5 NON_SYNONYMOUS I/M atC/atG 188 C/M
Chr Position WT MutantChange
typeGene name Trancript_ID
Exon
RankEffect
old_AA/
new_AA
Old_codon/
New_codonCodon# Dist.
1 12835964 C T SNP PRAMEF12 NM_001080830 2 NON_SYNONYMOUS A/V gCc/gTc 189 C/M
1 26369939 G T SNP SLC30A2 NM_032513 3 NON_SYNONYMOUS D/E gaC/gaA 125 C/M
1 26608819 A C SNP UBXN11 NM_183008 16 NON_SYNONYMOUS C/G Tgt/Ggt 512 M
1 36557425 A T SNP ADPRHL2 NM_017825 3 NON_SYNONYMOUS K/M aAg/aTg 172 C/M
1 65247070 A G SNP RAVER2 NM_018211 4 NON_SYNONYMOUS Q/R cAg/cGg 265 C/M
1 89323019 C T SNP GTF2B NM_001514 6 SYNONYMOUS Q/Q caG/caA 229 C/M
1 91382527 C A SNP ZNF644 NM_201269 6 NON_SYNONYMOUS R/L cGa/cTa 1271 C
1 100342070 A G SNP AGL NM_000645 9 NON_SYNONYMOUS H/R cAt/cGt 430 C/M
1 103352545 T C SNP COL11A1 NM_080630 61 NON_SYNONYMOUS E/G gAa/gGa 1443 C
1 110033758 T C SNP ATXN7L2 NM_153340 10 NON_SYNONYMOUS C/R Tgc/Cgc 525 C/M
1 152279848 T C SNP FLG NM_002016 3 NON_SYNONYMOUS H/R cAt/cGt 2505 C
1 152325783 T G SNP FLG2 NM_001014342 3 SYNONYMOUS T/T acA/acC 1493 M
1 152671515 *
-
CAGCTCTGGGGG
CTGCTGCGGC
TCCAGCTCTGGG
GGCTGCTG
DEL LCE2A NM_178428 2 CODON_DELETIONPSSGGCCG
SSSGGCC/P
cccagctctgggggctgctg
cggctccagctctgggggct
gctgc/ccc
46 C
1 157095030 T A SNP ETV3 NM_001145312 5 NON_SYNONYMOUS K/M aAg/aTg 381 M
1 158300811 A G SNP CD1B NM_001764 2 NON_SYNONYMOUS S/P Tcc/Ccc 35 C/M
1 158607978 A T SNP SPTA1 NM_003126 36 SYNONYMOUS T/T acT/acA 1678 C/M
1 165324772 C T SNP LMX1A NM_177398 2 NON_SYNONYMOUS E/K Gag/Aag 9 M
1 176564502 C A SNP PAPPA2 NM_021936 3 NON_SYNONYMOUS P/T Ccc/Acc 588 M
1 179561979 A C SNP TDRD5 NM_173533 2 NON_SYNONYMOUS K/Q Aaa/Caa 77 M
1 183086480 G C SNP LAMC1 NM_002293 9 NON_SYNONYMOUS Q/H caG/caC 530 C/M
1 192548318 C A SNP RGS1 NM_002922 5 NON_SYNONYMOUS P/T Cca/Aca 166 C/M
1 201178637 C G SNP IGFN1 NM_001164586 12 NON_SYNONYMOUS A/G gCa/gGa 1539 C/M
1 201178768 A G SNP IGFN1 NM_001164586 12 NON_SYNONYMOUS S/G Agt/Ggt 1583 C/M
1 203036843 T A SNP PPFIA4 NM_015053 13 NON_SYNONYMOUS I/N aTc/aAc 518 M
1 248263328 T C SNP OR2L13 NM_175911 3 SYNONYMOUS C/C tgT/tgC 217 M
1 248343406 T C SNP OR2M2 NM_001004688 1 NON_SYNONYMOUS M/T aTg/aCg 40 M
2 27800497 G C SNP C2orf16 NM_032266 1 NON_SYNONYMOUS G/A gGg/gCg 353 C/M
2 31467243 G A SNP EHD3 NM_014600 2 NON_SYNONYMOUS G/R Ggg/Agg 111 C/M
2 84848361 G T SNP DNAH6 NM_001370 25 NON_SYNONYMOUS W/L tGg/tTg 1280 C/M
2 110922728 T G SNP NPHP1 NM_207181 7 NON_SYNONYMOUS Y/S tAt/tCt 210 C/M
2 113676198 T C SNP IL37 NM_173205 4 NON_SYNONYMOUS Y/H Tat/Cat 131 M
2 165984491 T C SNP SCN3A NM_001081676 18 NON_SYNONYMOUS I/V Att/Gtt 966 C
2 170518915 T A SNP C2orf77 NM_001085447 5 NON_SYNONYMOUS R/W Agg/Tgg 232 M
2 185803724 A T SNP ZNF804A NM_194250 4 NON_SYNONYMOUS T/S Act/Tct 1201 M
2 186657513 A T SNP FSIP2 NM_173651 16 NON_SYNONYMOUS T/S Acc/Tcc 1973 C/M
2 207041328 T C SNP GPR1 NM_005279 3 NON_SYNONYMOUS Y/C tAt/tGt 215 C/M
2 220416251 C A SNP OBSL1 NM_015311 20 NON_SYNONYMOUS G/C Ggc/Tgc 1895 C/M
2 238820348 G T SNP RAMP1 NM_005855 3 NON_SYNONYMOUS V/L Gtg/Ttg 124 M
3 40286080 C G SNP MYRIP NM_015460 13 SYNONYMOUS V/V gtC/gtG 748 C/M
3 69171510 G C SNP LMOD3 NM_198271 1 NON_SYNONYMOUS Q/E Caa/Gaa 10 M
3 75787989 G C SNP ZNF717 NM_001128223 5 NON_SYNONYMOUS P/R cCa/cGa 262 C/M
3 118623523 C A SNP IGSF11 NM_152538 8 STOP_GAINED E/* Gaa/Taa 275 C/M
3 129267887 C A SNP H1FOO NM_153833 3 NON_SYNONYMOUS A/D gCc/gAc 141 M
3 130289707 G A SNP COL6A6 NM_001102608 6 NON_SYNONYMOUS S/N aGc/aAc 816 C/M
3 132233509 C T SNP DNAJC13 NM_015268 46 NON_SYNONYMOUS P/L cCa/cTa 1827 C/M
3 183898893 G T SNP AP2M1 NM_004068 7 NON_SYNONYMOUS V/L Gtg/Ttg 196 C/M
3 186269006 G T SNP TBCCD1 NM_018138 7 NON_SYNONYMOUS T/K aCa/aAa 536 C/M
3 194140670 A T SNP ATP13A3 NM_024524 30 NON_SYNONYMOUS L/I Tta/Ata 1114 C/M
4 6865741 T C SNP KIAA0232 NM_014743 7 NON_SYNONYMOUS L/S tTg/tCg 1211 M
4 8621087 C T SNP CPZ NM_003652 10 NON_SYNONYMOUS P/S Ccc/Tcc 557 M
4 13604215 C T SNP BOD1L1 NM_148894 10 NON_SYNONYMOUS G/S Ggc/Agc 1437 C
4 39439550 A T SNP KLB NM_175737 3 NON_SYNONYMOUS T/S Acg/Tcg 514 C/M
4 42403241 A C SNP SHISA3 NM_001080505 2 NON_SYNONYMOUS T/P Aca/Cca 164 C/M
4 56448304 C A SNP PDCL2 NM_152401 2 NON_SYNONYMOUS R/L cGt/cTt 36 C/M
4 69097014 C T SNP TMPRSS11B NM_182502 7 STOP_GAINED W/* tGg/tAg 198 C/M
4 85747991 G A SNP WDFY3 NM_014991 10 NON_SYNONYMOUS A/V gCa/gTa 367 M
4 126371409 A G SNP FAT4 NM_024582 9 NON_SYNONYMOUS T/A Act/Gct 3080 M
4 183659631 G T SNP ODZ3 NM_001080477 17 STOP_GAINED E/* Gaa/Taa 1105 C/M
5 11364920 T C SNP CTNND2 NM_001332 8 NON_SYNONYMOUS I/M atA/atG 420 C/M