Top Banner
Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha Dudek, MS LCGC Genetic Counselor Senior Associate Obstetrics and Gynecology Division of Maternal-Fetal Medicine Vanderbilt School of Medicine 1 [email protected] #marthadudek
39

Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Dec 27, 2019

Download

Documents

dariahiddleston
Welcome message from author
This document is posted to help you gain knowledge. Please leave a comment to let me know what you think about it! Share it to your friends and learn new things together.
Transcript
Page 1: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies?

Marta Martha Dudek, MS LCGC Genetic Counselor

Senior Associate Obstetrics and Gynecology

Division of Maternal-Fetal Medicine

Vanderbilt School of Medicine 1

[email protected] #marthadudek

Page 2: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Notice of Disclosure I have no relevant financial relationships with

commercial interests to disclose. The views and opinions expressed here are my own.

They are not necessarily those of Vanderbilt University Medical Center and they may not be used for advertising or product endorsement purposes.

40th Annual High Risk Obstetrics Seminar 2

Page 3: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Objectives

• Review of traditional prenatal maternal serum screening and update on cell free DNA (cfDNA) for chromosomes abnormalities (CA) in pregnancy.

• Present a protocol for cfDNA screening for the average risk population for CA in pregnancy.

• Discuss how to manage high risk cfDNA/ non-invasive prenatal screening (NIPS) results.

• Discussion of how to choose a laboratory for cfDNA/NIPS for CA in pregnancy.

40th Annual High Risk Obstetrics Seminar 3

Page 4: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

0

20

40

60

80

100

20 25 30 35 40 45

Down syn. likelihood atdelivery

4 Maternal Age

% 48 yrs ~6.3% 1 in 16 women

35 yrs ~0.3% 1 in 365 women

40 yrs ~1% 1 in 109 women

45 yrs ~ 3% 1 in 32 women 25 yrs ~ 0.08%

1 in 1200 women

30 yrs ~0.1% 1 in 885 women

Page 5: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Ultrasound Detection rate is operator and patient/fetus dependent Minimal risk

Serum screening 1st &/or 2nd (combined or sequential)

5% False positive No risk of loss 80-90% detection

Invasive testing CVS ~0.5-1% SAB Amnio 1/200-1/500 SAB >99% detection

5

Traditional prenatal screening/testing for Trisomy

Page 6: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Evolution of Trisomy Risk Assessment

NIPS using cfDNA

ACOG Practice Bulletin No. 77. Obstet Gynecol 2007;109:217-27.

FPR=5.0% FPR<0.1% Detection rate for Down syndrome

Page 7: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Cell-free DNA

8

Page 8: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Cell-free DNA in Maternal Blood • Cell-free DNA (cfDNA) are short DNA fragments • In pregnancy, cfDNA from both the mom and fetus are in maternal blood • Amount of fetal cfDNA present is a small fraction of the maternal cfDNA

Page 9: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Non-Invasive Prenatal Screening (NIPS)

• Blood draw > 10 weeks

gestation • Initially offered for patients

considered at “high risk” for fetal chromosomal aneuploidy

• Turn around time 3-14 days • Cost

• List price $795-$2700 • Patient out of pocket cost

dependent on insurance

Page 10: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

NIPS Products by Assay

12

Massively Parallel Shotgun

Sequencing (MPSS)

Targeted Sequencing

Sequenom MaterniT21TM

Verinata Verifi®

Ariosa

HarmonyTM

Targeted Sequencing

Natera

PanoramaTM

COUNTING SNPs

October 2011

February 2011

December 2012

May 2012

Illumina LabCorp

October 2014

Page 11: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Massively Parallel Shotgun Sequencing

40th Annual High Risk Obstetrics Seminar 13

Page 12: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10

Counting Method

GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10

Sequencing tells you which chromosome the ccf fragment comes from

TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y

14

Page 13: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

21 18 13

Mom’s Blood Mom’s DNA

1

2

3

1

2

3

1

2

3

Trisomy 21 (Down syndrome)

Fetal Fraction

Expected ratio for Trisomy

4% 1.02

10% 1.05

20% 1.10

40% 1.20

Counting Method

Page 14: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

MPSS vs. Directed

Chr 21, 18, 13, X, Y cfDNA Other Chr cfDNA Unmapped cfDNA

cfDNA in blood

Massively Parallel Shotgun Sequencing

(MPSS) Directed analysis

Page 15: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10

Counting Method

GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 ACAGTGGTGGGGCCCATCCCTGGGTGAGGCTCAGTT chr21 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10 GACACGGTGGAGCTCGGCCACACCAGGCCCAGCTGG chr14 GGCCCTGGGGACAGTCTCCAATCCACTGAGTCATCT chr10

Directed or Targeting sequencing of Reference chromosomes and chromosomes of interest

TCCGCCCAGGCCATGAGGGACCTGGAAATGGCTGAT chr21

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y

17

Page 16: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

SNP = Single Nucleotide Polymorphism

• Polymorphisms occur when a single base pair (nucleotide) is changed: A, T, C, or G

• These are normal genetic changes that occur in every person and mark where people differ from one another

18

Page 17: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

SNP patterns

19

Buffy coat contains mainly maternal DNA

plasma mixture of maternal and fetal DNA

Page 18: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Buffy coat = Maternal DNA

Plasma = Maternal + Fetal

DNA SNP

Sequencing

SNP Sequencing

Maternal Genotype

Maternal + Fetal Genotype

Fetal Genotype

19K+ SNPs are simultaneously targeted

Maternal blood

Algorithm to predict the most probable fetal genotype

20

Page 19: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

40th Annual High Risk Obstetrics Seminar NIPS for ALL 21

How accurate is NIPS?

Modified from Rebecca Carter’s presentation at PLIDA 2014

Maternal age

QUAD screen

First trimester screen

NIPS/ cfDNA

ACCURACY

Am

nio C

VS

Page 20: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

The technology is fabulous!

40th Annual High Risk Obstetrics Seminar 22

NEJ MED 369; 6 8/8/13 p499

NIPS Sensitivity

(true positive of test )

Specificity

(true negative of test)

Positive predictive value

PPV (varies with disease

incidence)

Trisomy 21 99-100% 99.8-100% ?

Trisomy 13 80-100% 99-100% ?

Trisomy 18 97-100% 99.6-100% ?

Sex chromosome abnormalities

96%-100 99.7-100% ?

Page 21: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Source: 2009. Provider handbook for The California Prenatal Screening Program

Should average risk patients be offered

NIPS?

23

Majority of babies born with Down

syndrome are born to women LESS than

35 ys of age

Page 22: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Update on NIPS

• Microdeletion panels (Panorama & MaterniT21PLUS) • Change in practices regarding fetal fraction reporting • Sex chromosome abnormality reporting • Ability to report in multiples • Addition of other labs using Illumina platform and

Verifi algorithm • Validation in the average risk population

40th Annual High Risk Obstetrics Seminar NIPS for ALL 24

Page 23: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Our Current NIPS Protocol

• Offered only to high risk patients • All patients undergo genetic counseling* • NIPS is presented as a screen within the

context of all other screening and diagnostic options

• Written informed consent obtained • NT/ nasal bone ultrasound still in place * NSGC Position Statement; Benn et al, 2011; Bianci et al., 2014

Page 24: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

NIPS for ALL

• Provider initiated discussion of patient desire for information – Written information provided – Decision aides used

• NT ultrasound or anatomy US for those desiring information

• Patients who desire NIPS meet with a genetic counselor for written informed consent

Wolfberg, AJ et al. (2014)

Page 25: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Suggested Follow up of NIPS

• After LOW RISK NIPS: – msAFP 15-21 6/7 wks (screen for ONTD) – Anatomy ultrasound ~>20 wks gestation

• HIGH RISK NIPS should be confirmed by: – CVS 11-13 6/7 wks OR – Amniocentesis (>16 weeks) OR – Blood chromosomes at delivery

Page 26: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Suggested Follow up of NIPS

• Genetic Counselor consult for high risk NIPS – Review of results including positive predicted

value – Review condition – Review testing options – Discussion of prenatal care and delivery plan – Offer written resources and support – Follow up with referring provider

40th Annual High Risk Obstetrics Seminar NIPS for ALL 28

Page 27: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

How to choose a NIPS lab/product

1. Accuracy, Accuracy, Accuracy 2. Transparency 3. Reporting 4. Cost 5. Customer support and easy of ordering

40th Annual High Risk Obstetrics Seminar 29

Page 28: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Reporting differences

40th Annual High Risk Obstetrics Seminar 30

Maternit21 Illumina Harmony Panorama

Result reporting

Positive/ Negative

Positive/negative/ aneuplody suspected

Risk assessment range 0.1% to 99%

Risk assessment range 0.1% to 99%

Y only No no yes no

45, X only No no no Yes

Sex chromosome aneuploidy

If noted will report

Opt-in 45,X always reported others as noted

Triplody/ vanishing twin detection

no no no Yes

Microdeletion panel

Yes (opt-OUT)

n/a n/a Yes (opt-IN except for 22q)

Page 29: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

What is Fetal Fraction? • Percentage of cell free

DNA originating from pregnancy

• 4% fetal fraction • Some women require

a re-draw • NIPT may not be

possible for all patients – Women with larger

body mass

Illustration modified from: Greenwood Genetics, Genetic Counseling Aids, 6th Edition, 2013

Page 30: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Why is Fetal Fraction important?

• Maternal serum from two NON-pregnant patients were sent to labs

• Two lab reported normal female

• Two labs were unable to provide report due to low Fetal fraction

Measures ff

Reports ff

Sequnom MarterniT21

Yes No

Illumina Verifi

No No

Harmony Ariosa

Yes Yes

Panorama Natera

Yes Yes

40th Annual High Risk Obstetrics Seminar 32 Takoudes, T. and Hamar Benjamin. (2014)

Page 31: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

NIPS Products

33

Massively Parallel Shotgun

Sequencing (MPSS)

Targeted Sequencing

Sequenom MaterniT21TM

Illumina Verifi®

Ariosa

HarmonyTM

Targeted Sequencing

Natera

PanoramaTM

COUNTING SNPs

List price $2762 $1200 $795 $2600

TAT 5-7 days 3-6 days 7 days 7-10 days

40th Annual High Risk Obstetrics Seminar

Page 32: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Incidence of conditions

34 Incidence out of 100,000 Live Births

40th Annual High Risk Obstetrics Seminar

Page 33: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Additional Panels

Natera (Panorama) • 22q11.2 DiGeorge (in/out) • 1p36 Deletion • 15q Angelman/Prader-Willi • 5p Cri-du-chat

• Triploidy/vanishing twin

Sequnom (MaterniT21 PLUS) • 22q11.2 DiGeorge 1p36 deletion syndrome • 4p deletion Wolf- Hirschhorn • 5p Cri-du-chat 8q Langer-Giedion 11q Jacobsen • 15q Prader-Willi/Angelman

Trisomy 16 Trisomy 22

35 40th Annual High Risk Obstetrics Seminar

Page 34: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

More Common Than Down Syndrome in Younger Women

36

Maternal Age

Microdeletions Panel

Down Syndrome

Down Syndrome prevalence from Snijders, et al. Ultrasound Obstet Gynecol 1999;13:167–170. Total prevalence shown for 6 microdeletions using higher end of published ranges from Gross et.

al., Prenatal Diagnosis 2011; 39, 259-266; and www.genetests.org. Total prevalence may range from 1/1049 - 1/2113.

1/2000

1/1000

1/500

1/250

20 22 24 26 28 30 32 34

Page 35: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Pitfalls and Challenges

• When you have a hammer, is everything a nail?

• What will be missed by NIPS? • Ambiguous results • Discordant results for gender • Some samples fail. No results and

patient further in gestational age.

37 40th Annual High Risk Obstetrics Seminar

Page 36: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Are we better off?

40th Annual High Risk Obstetrics Seminar 38

Know and know

know that I don’t know

Don’t know that I

know

don’t know don’t know

NIPS +21 Family and

provider notified

NIPS – Low risk /

patient understand limitations

Suspected DX by screening

BUT All testing declined

NIPS – But falsely reassured

Page 37: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Resources

• National Society of Genetic Counselors nsgc.org

• National coalition for Health Professional Education in Genetics nchpeg.org

• Society of Maternal Fetal Medicine smfm.org

• American College of Medical Genetics acmg.net

• Genetics Home Reference ghr.nlm.nih.gov

40th Annual High Risk Obstetrics Seminar

Page 38: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

References 1. Ashoor G, Syngelaki A, Wagner M, et. al. (2012) “Chromosome-selective sequencing of maternal plasma cell–free DNA for

first-trimester detection of trisomy 21 and trisomy 18” Am J Obstet Gynecol, 206:322.e1-5. 2. Benn PA, Borrell A, Cuckle H, Dugoff L, Gross S, Johnson J, Maymon R, Odibo A, Schielen P, Spencer K, Wright D, Yaron Y.

(2011) “Prenatal detection of Down syndrome using massively parallel sequencing (MPS): a rapid response position statement from a committee on behalf of the Board of the International Society for Prenatal Diagnosis.”

3. Bianchi DW and Wilkins-Haug L, (2014) "Integration of Noninvasive DNA Testing for Aneuploidy into Prenatal Care: What Has Happened Since the Rubber Met the Road?," Clinical Chemistry, 60;1:78-87.

4. Canick, JA, et al. (2012). “DNA sequencing of maternal plasma to identify Down syndrome and other trisomies in multiple gestations”. Prenatal Diagnosis. 32: 730-734.

5. Devers P, Cronister A, Ormond K, Facio F, Brasington K and Flodman P, (2013) "Noninvasive Prenatal Testing/Noninvasive Prenatal Diagnosis: the Position of the National Society of Genetic Counselors," J Genet Counsel (2013) 22:291–295

6. Fairbrother, G, et al. (2013). “Clinical experience of noninvasive prenatal testing with cell-free DNA for fetal trisomies 21, 18, and 13, in a general screening population”. Prenatal Diagnosis. 33: 580-583.

7. Gregg AR, Gross SJ, Best RG, Monaghan KG,Bajaj K, Skotko BG, Thompson BH, Watson MS. 2013. “ACMG statement on noninvasive prenatal screening for fetal aneuploidy.” Genet Med 15(5):395-398.

8. Livingston, Deborah, (2013)"ACMG Suggests Broader Application for Noninvasasive Prenatal Screening Tests NIPS tests shouldn’t be limited to high-risk pregnancies, " The AJMG Sequence: Decoding news and trends for the medical genetics community, DOI: 10.1002/ajmg.a.36087

9. Nicolaides, K, et al. (2012). “Noninvasive prenatal testing for fetal trisomies in a routinely screened first-trimester population”. American Journal of Obstetrics and Gynecology. 207: 374.e1-6.

10. Takoudes, T. and Hamar Benjamin. (2014), “Non-invasive prenatal testing performance when fetal cell-free DNA is absent,” Ultrasound Obstet Gynecol doie:10.1002/ugo.14715.

11. Wolfberg, AJ et al. (2014), “Nuchal translucency measurement plus non-invasive prenatal testing to screen for aneuploidy in a community-based average-risk population,” Ultrasound Obstet Gynecol 44: 491–494.

40th Annual High Risk Obstetrics Seminar

Page 39: Should we be offering Non-Invasive Prenatal Screening for ... · Should we be offering Non-Invasive Prenatal Screening for Chromosome Abnormalities in ALL pregnancies? Marta Martha

Genetic Counselors Board certified and licensed genetic counselors:

Martha Dudek Jill Nichols Caitlin Grabarits

Genetic counseling appointments available: One Hundred Oaks Clarksville Springfield Franklin

615-343-5700