Sequence diversity of the nucleoprotein gene of peanut bud necrosis virus isolates from the South India

For Peer Review

Sequence diversity of the nucleoprotein gene of peanut bud

necrosis virus isolates from the South India

Journal: Journal of Phytopathology

Manuscript ID: JPHY-13-255

Manuscript Type: Original Article

Date Submitted by the Author: 27-Jun-2013

Complete List of Authors: Yeturu, Sivaprasad; Institute of Frontier Technology, Genomics Lab; Sri Venkateswara University, Tirupati, Department of Virology B.V.B, Bhaskara Reddy; Institute of Frontier Technology, Genomics Lab Asadhi, Sujitha; Institute of Frontier Technology, Genomics Lab D.V.R, Sai; Sri Venkateswara University, Tirupati, Department of Virology

Keywords: Peanut bud necrosis virus, Tospovirus, RT-PCR, Sequence identities

JPH Manuscript Proof

For Peer Review

1

Sequence diversity of the peanut bud necrosis virus NP gene 1

2

1Department of Plant Pathology, Regional Agricultural Research Station, Acharya N.G.Ranga 3

Agricultural University, Tirupati-517502, Andhra Pradesh, India. 4

Sequence diversity of the nucleoprotein gene of peanut bud necrosis virus isolates 5

from the South India 6

7

Yeturu Sivaprasad1&2

, Bommu Veera Bhaskara Reddy1*

, Asadhi Sujitha1 and Divi 8

Venkata Ramana Sai Gopal2

9

Authors’ addresses: 1Department of Plant Pathology, Regional Agricultural Research 10

Station, Acharya N.G.Ranga Agricultural University, Tirupati-517502, Andhra Pradesh, 11

India; 12

2Department of Virology, SVU College of Sciences, Sri Venkateswara University, 13

Tirupati-517502, Andhra Pradesh, India. 14

15

*Corresponding Author to B.V.Bhaskara Reddy. E-mail: [email protected] 16

17

18

19

20

21

22

23

Page 1 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

2

Abstract 24

Peanut bud necrosis virus (PBNV), a member of the genus Tospovirus, family 25

Bunyaviridae is an important viral pathogen infecting peanut and other crops in South 26

India. Peanut bud necrosis virus naturally infecting groundnut, brinjal, tomato, black 27

gram, field bean, cowpea, cotton, jute, taro and calotropis plants were collected from 28

different regions of South India and characterized. PBNV infection was confirmed by 29

direct antigen coating enzyme linked immunosorbent assay (DAC-ELISA) using PBNV 30

specific antiserum. The coat protein gene was further amplified using PBNV coat protein 31

specific primers. The amplicon (830 bp) was cloned, sequenced and sequence analysis 32

revealed that the N gene shared 93-100% and 95-100% sequence identity with PBNV at 33

nucleotide and amino acid levels respectively. 34

35

Keywords Nucleocapsid protein, Peanut bud necrosis virus, Tospovirus, RT-PCR, 36

Sequence identities, ELISA 37

38

Introduction 39

40

Groundnut/Peanut bud necrosis, which is a reemerging as one of the most important viral 41

disease on several crops was thought initially to be caused by a strain of tomato spotted 42

wilt virus (Reddy et al. 1983) but is now classified as a distinct virus in the genus 43

Tospovirus and species groundnut bud necrosis (Reddy et al. 1992). The disease was 44

reported from South and Southeast Asia including China, under different names viz., bud 45

blight, groundnut mosaic, groundnut ring mosaic, bunchy top, chlorosis, ring mottle, ring 46

Page 2 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

3

spot and spotted wilt from India (Reddy 1988). The causal virus of this disease was first 47

identified as TSWV in India (Ghanekar et al. 1979). After characterization of virus 48

identified as a distinct Tospovirus and named as groundnut bud necrosis virus or peanut 49

bud necrosis virus, which is placed in Serogroup IV (Reddy et al. 1992; Adam et al. 50

1993; Satyanaraya et al. 1996a). The disease is reported to occur in all prominent 51

groundnut growing are of India. The incidence of bud necrosis of groundnut ranges from 52

5 to 80 percent in different parts of the Indian sub containment. World wide it causes 53

losses of over one billion dollars annually (Goldbeach et al. 1994; Moyer 1999; Prins et 54

al. 1995). The Peanut yellow spot virus (PYSV) S-RNA was cloned and sequenced and 55

the sequence was comparison with distinct species, different from GBNV (Satyanarayana 56

et al. 1998). The Watermelon bud necrosis virus (WBNV) N gene was cloned and 57

sequenced, and its sequence was different from those of PYSV and GBNV (Jain et al. 58

1998). In recently the natural infection of jute and taro (Sivaprasad et al. 2011) and 59

calotropis (Bhaskara Reddy et al. 2011) with PBNV was also reported. 60

GBNV is the species of genus Tospovirus and family Bunyaviridae. The virus is 61

transmitted by thrips vector, Thrips palmi in a persistant manner (Reddy & Devi 2003). 62

In recent years, thrips and Tospoviruses have become a serious problem in various 63

Leguminosae, Solanaceae and Cucurbitaceae crops all over India. The disease is 64

characterized by mosaic and a chlorotic spot on leaves, severe necrosis of buds and 65

petiole and the affected plant has stunted growth was observed on the infected plants. The 66

virus is enveloped, quasi-spherical particles of 80-120 nm diameter and a tripartite, 67

single-stranded, ambi-sense RNA genome. The RNAs are named L (large), M (medium) 68

and S (small), and have a size of approximately 8.9, 4.8 and 2.9 kb respectively. They 69

Page 3 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

4

bound by nucleocapsid (N) protein (Fauquet et al. 2005). The L-RNA codes for the RNA-70

dependent RNA polymerase and is translated from the viral complementary sense RNA 71

(VC). The m-RNA encodes a non structural (NSm) protein in the viral (V) sense and the 72

precursor for the glycoprotein’s G1 and G2 in the VC sense. The S-RNA encodes NSs 73

protein in the V sense and N protein in the VC sense. 74

The coat protein gene from eleven GBNV isolates originating from oil seed crop 75

like peanut (Arachis hypogaea L.); legumes such as cowpea (Vigna unguiculata), black 76

gram (Vigna mungo) and filedbean (Dolichos lablab); fiber crops like cotton (Gossypium 77

herbacium) and Jute (Corchorus capsularis); vegetable crops like tomato (Lycopersicon 78

esculentum), brinjal (Solanum melongena) and taro (Colocasia esculenta) and weed like 79

Calotropis gigantea were cloned, sequenced and compared with other members of 80

Tospovirus genus. The present study describes these aspects in detail. 81

82

Materials and Methods 83

84

Virus isolates and maintenance 85

GBNV infected different plants used in this study were collected from different places in 86

Andhra Pradesh and Tamil Nadu, India. Naturally affected groundnut samples showing 87

chlorotic and necrotic ring spots on leaves and necrosis of stem and bud in groundnut 88

were observed. Mosaic, chlorotic and necrotic spots on leaves and stems in cowpea, field 89

bean, tomato, brinjal, black gram, jute, cotton, taro and calotropis were also observed. 90

Association of a Tospovirus with the samples was first established by direct antigen 91

coated enzyme linked immunosorbent assay (Clark and Joseph 1984) using polyclonal 92

Page 4 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

5

antiserum directed against the CP of GBNV. The virus isolates were then sap inoculated 93

to cowpea (cv-C-152, a diagnostic assay host) plants using chilled 0.05M phosphate 94

buffer (pH-7.0) containing 0.1% 2-mercapto ethanol. 95

96

Isolation of total RNA and RT-PCR 97

The total RNA from 100mg of healthy and GBNV infected leaf tissues of groundnut, 98

cowpea, field bean, tomato, brinjal, black gram, cotton, jute, taro and calotropis was 99

isolated using RNase plant minikit according to the manufacture’s instructions (Qiagen, 100

USA). The resulting total RNA was incubated with GBNV-CP gene specific reverse 101

primer at 72ºC for 5 min and snap-chilled on ice for 2 min. cDNA was synthesized using 102

M-MuLV reverce transcriptase (Fermentas, USA) at 42ºC for 1 h. The genome sense 103

primer, 5’ATGTCTAACGT(C/T) AAGCA (A/G) CTC 3’ and antisense primer, 5’-104

TTACAATTCCAGCGAAGGACC 3’ were used to amplify the complete CP gene of 105

GBNV (Sathyanarayana et al. 1996). Two µl of cDNA was amplified in a 25 µl reaction 106

volume containing 2.5U of Taq DNA Polymerase (Fermentas, USA), 10 pmol of 107

forward (GBNV-CP-F) and reverse primer (GBNV-CP-R), 2.5mM MgCl2 and 10 mM 108

each dNTP’s. PCR amplification conditions included an initial denaturation cycle of 2 109

min at 94ºC, followed by 35 cycles of denaturation for 30 sec at 94ºC, annealing for 1 110

min at 56ºC and extension for 1 min at 72ºC with a final extension 60 min at 72ºC. 111

Amplified products were resolved following electrophoresis through a 1% agarose gel 112

containing ethidium bromide (10 mg/ml). 113

114

115

Page 5 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

6

Cloning and genome sequencing analysis 116

The PCR product was eluted by QIAquick gel extraction kit (Qiagen, USA) and cloned 117

into pTZ57R/T vector (Fermentas, USA) according to the manufacture’s instructions. 118

The resulting recombinant plasmids were transformed into E.coli strain DH5α cells. 119

Recombinant clones were identified by restriction endonuclease digestion and colony 120

PCR. The resulted clones with expected size DNA inserts were sequenced using M13 121

universal primers at Eurofins Genomics India Pvt. Ltd, Bangalore. Multiple sequence 122

alignments were generated using CLUSTAL W (Thompson et al. 1994). Sequence 123

phylograms were constructed using TREEVIE W software (Bootstrap analysis with 1000 124

replicates) (Page 1996). The Coat Protein genes of other known Tospovirus (Table 1) 125

were collected from GenBank (Benson et al. 1999). Both nucleotide and amino acid 126

sequences of CP gene of different Tospovirus species were compared and the 127

corresponding phylogenetic trees were generated. 128

129

Results 130

The symptoms of GBNV first appear in the young leaflets in the form of mosaic, 131

chlorotic spots and mild mottle, which later develop into chlorotic and necrotic rings, 132

streaks and extended to petiole and to the growing terminal bud. The symptomatic 133

leaflets become flaccid and droop. Infection at young age results in the death of the plant 134

due to severe necrosis. As a result of terminal bud, various secondary symptoms like 135

stunting and proliferation of auxiliary shoots occurs. Infection at later stage of the growth 136

results in symptoms on few branches or in apical parts of the plants. The suspected 137

samples were reacted with polyclonal antiserum which were raised against CP of GBNV 138

Page 6 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

7

and were easily sap transmitted to cowpea (Cv-c-152). Both localized as well as systemic 139

infection was observed on cowpea plants. After three days inoculation, the chlorotic 140

lesions were observed on cowpea leaves, which later turned into necrotic spots, followed 141

by veinal necrosis. Finally became leaves showed chlorotic or pale yellow in color before 142

senescence. Newly emerging leaves showed systemic infection symptoms which 143

consisted mild mosaic, chlorotic ring spots and necrotic spots. The virus affected plants 144

reacted with the polyclonal antiserum directed against nucleocapsid protein of GBNV 145

(A405 = 1.45). 146

In RT-PCR, a single band of expected size (~800bp) corresponding to CP gene 147

was observed when total RNA extracted from infected tissue was used. The identity of 148

the 800 bp product (Fig.1) was confirmed by cloning and sequencing. The selected clones 149

(Groundnut-TPT, Cowpea-TPT, Field bean-TPT, Brinjal-TPT, Tomato-TPT, Groundnut-150

TN, Groundnut-NLR, Groundnut-Coimbatoor, Groundnut-KNL, Cotton-TPT and Black 151

gram-TPT, Taro-NLR, Jute-TPT, Calotropis-NLR and Groundnut-Kadapa) were 152

sequenced and deposited in NCBI GenBank (Accession No.EF179100, EF179099, 153

EF532937, FJ447355, FJ447359, HM770022, HM770021, HM770020, HM131489, 154

HQ324113, HQ324114, HQ199845, HQ324115, HQ199844 and JF968416) respectively. 155

The CP gene of Groundnut Bud Necrosis Virus was 831 nucleotides long and its code for 156

a protein of 276 amino acids. The CP gene of present study isolates was compared with 157

corresponding genes from known Tospovirus (Table 1) at the nucleotide and amino acid 158

levels respectively. The CP gene sequence of our isolates was compared with 159

corresponding genes from other recognized Tospovirus species at nucleotide and amino 160

acid level. Present study isolates (Groundnut-NLR, Calotropis-NLR, Cotton-TPT, 161

Page 7 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

8

Groundnut-TN, Groundnut-Coimbatoor and Groundnut-TPT) grouped together along 162

with Tomato-Pune, Brinjal-KA, Potato-Rajastan and Groundnut-ATP formed a separate 163

clade (Clade 1). Tomato-TPT grouped together along with Brinjal-Maharashtra, 164

Soyabean-Delhi and Groundnut-Delhi formed a separate clade (Clade 2). Brinjal-TPT, 165

Groundnut-Kurnool, Groundnut-Kadapa and Fieldbean-TPT grouped together along with 166

Tomato-KA and Potato-MP formed a separate clade (Clade-3). Cowpea-TPT grouped 167

together along with Carrot-HYD Groundnut-Gadag, Mungbean-Maharashtra, Cowpea-168

TPT, Blackgram-HYD, Chilli-Raipur formed a separate clade (Clade-4). Blackgram-TPT 169

and Jute-TPT formed a separate clade (Clade-5). Cotton-Delhi, Tomato-Coimbatoor, 170

Tomato-Delhi and Cowpea-Coimbatoor differentiated to form a separate clade (Clade-6) 171

(Fig 2). The nucleotide sequence homology studies revealed that our isolates has 97-99% 172

and amino acid sequence homology studies reveled that our isolates has 97-100% with in 173

Tospovirus (Table 2). In contract, 93-99% nucleotide sequence and 95-99% amino acid 174

identity was observed with CP gene of other members of Tospoviruses. 175

176

Discussion 177

The peanut bud necrosis virus is easily sap-transmissible to the members of Leguminosae, 178

Solanaceae, Cucurbitaceae and Fabaceae was observed in localized and systemic 179

infection. Various symptoms exhibited by different hosts included chlorotic/necrotic 180

lesions and ring spots, followed by leaf yellowing, venial necrosis, leaf deformation. 181

Other symptoms were stunting, bud necrosis, stem necrosis and wilting. 182

Groundnut is one of the most important food crop, grown in many countries of the 183

world. It is an essential crop to small-hold farmers who grown groundnut for food, oil, 184

Page 8 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

9

feed and confectionary purposes. Black gram, cowpea and field bean is an important 185

widely cultivated legume crops grown in India. Cotton and Jute is one of the most 186

important fiber crops and it is grown in different countries of tropics and subtropics 187

regions around the world. Tomato and Brinjal is an important vegetable crop and grown 188

all over the world. 189

Earlier reports indicated that GBNV infecting Leguminacae family members such 190

as Black gram has broad host range. Similar reports indicating cross infectivity of the 191

viral pathogen of GBNV on several leguminous and Solanaceous hosts such as cowpea, 192

groundnut, mungbean, potato, soybean and tomato (Bhat et al. 2001; Thien Huan et al. 193

2003; Umamaheswaran et al. 2003; Jain et al. 2004). Watermelon bud necrosis virus 194

(WBNV) is another Tospovirus; it is a severe pathogen infecting cucurbits in India (Jain 195

et al. 1998; Mandal et al. 2003). Iris yellow spot virus (IYSV) infecting onion in India 196

(Ravi et al. 2006). The host range properties, thrips transmission, virion morphology and 197

antigenic relationships and the virus were initially was used to identified and classified 198

tospoviral infections including GBNV (Srinivasulu et al. 1991a; Reddy et al. 1992; Adam 199

et al. 1993). The classification of different tospoviruses into district species and 200

serogroups leads to confusing and misleading. The genomes of several tospoviruses 201

either partially or completely sequence from 1990 onwards and the phylogenitic relation 202

ships determined (Moyer 1999). The L, M and S RNAs of GBNV was completely 203

sequenced, based on the phylogenitic relationships was determined (Satynarayana et al. 204

1996a; Gowda et al. 1998). GBNV was placed in serogroup IV based on N or NSs 205

protein sequences. The N gene sequence of several natural isolates from different crops 206

was compared with the N gene of type GBNV (Bhat et al. 2002a; Thien et al. 2003; Jain 207

Page 9 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

10

et al. 2004). The comparative sequence analysis revealed that the tospovirus isolates from 208

different crops in India shared more than 95% sequence identity and thus they have been 209

identified as strains/isolates of GBNV. Akram et al., 2004 analyzed the nucleotide and 210

amino acid sequence of the movement protein (NSm) genes of five isolates of GBNV 211

originating from different hosts in India. At amino acid level they shared 98-100% 212

identity of GBNV isolates. Strains of GBNV have been identified by serology and 213

nucleic acid hybridization in infected legumes by tospoviruses around Delhi. (Bhat et al. 214

2001; Bhat et al. 2002a). From India it was reported that GBNV shares 82% sequence 215

similarity in another tospovirus i.e., Watermelon bud necrosis virus (WBNV) (Jain et al. 216

1998). GYSV, a distinct tospovirus that belongs to serogroup V of tospoviruses occurs 217

widely on groundnut in India and Thailand. Both the viruses differ in symptomatology on 218

groundnut experimental hosts, thrpis vector transmission, serology and nucleotide 219

sequence of the genome (Reddy et al. 1991; Satynarayana et al. 1996b; 1998). In recently 220

mosaic, chlorotic spotting and necrotic flecking of leaves were observed on taro in 221

Nellore district of Andhra Pradesh, India (Sivaprasad et al. 2011). Subsequently it is also 222

showed mosaic, chlorotic and necrotic lesions on young leaves and stems on jute in 223

Tirupati of Andhra Pradesh, India (Sivaprasad et al. 2011). 224

The variability studies of GBNV not only is useful in establishing differences 225

among strains that infect different crops, but also aids in evolving transgenic plants with 226

resistance to GBNV. Studies on host-vector-virus relationship pertaining to GBNV 227

infection in various crop species are also one area of study that needs attention. Since, the 228

GBNV in all the hosts is transmitted by thrips (Reddy & Devi 2003), detailed 229

investigations on management of vector population and their role in transmission of 230

Page 10 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

11

disease at different time intervals is necessitated. Incorporating host plant resistance 231

through transgenic in varieties that have innate resistance to thrips incidence is also an 232

emerging concept in virus disease control. 233

234

Acknowledgements The authors are thankful to the Acharya N.G Ranga Agricultural 235

University, Hyderabad for financial assistance. 236

237

References 238

Adam G, Yeh SD, Reddy DVR Green SK. (1993) The serological comparison of 239

Tospovirus isolates from Taiwan and India with Impatiens necrotic virus and 240

different tomato spotted wilt virus isolates. Arch Virol 130: 237-250. 241

Akram M, Jain RK, Chaudhary V, Ahlawat YS, Khurana SMP. (2004) Comparison of 242

groundnut bud necrosis virus isolates based on movement protein (NSm) gene 243

sequencs. Ann. Appl. Biol 145:285-290. 244

Benson DA, Boguski MS, Lipman DJ, Ostell J. (1999) GenBank. Nucleic Acids Res 24: 245

1-5. 246

Bhaskara Reddy BV, Sivaprasad Y, Sai Gopal DVR. (2011) First report of Peanut bud 247

necrosis virus infecting Calotropis gigantea. Journal of Plant Pathology S4.63-248

S4.89. 249

Bhat AI, Jain RK, Varma A, Lal SK. (2001) Tospovirus(es) infecting grain legumes in 250

Delhi-their identification by serology and nucleic acid hybridization. Indian 251

Phytopath 54:112-116. 252

Page 11 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

12

Bhat AI, Jain RK, Varma A, Lal SK. (2002) Nucleocapsid protein gene sequence studies 253

suggest that soyabean bud blight is caused by a strain of groundnut bud necrosis 254

virus. Curr Sci 82: 1389–1392. 255

Clark MF, Bar-Joseph M. (1984) Enzyme immunosorbant assays in plant virology. 256

Methods Virol 7:51–85. 257

Fauquet CM, Mayo MA, Maniloff J, Desselberges U, Ball LA. (eds), Virus Taxonomy, 258

Eighth Report of the International Committee on Taxonomy of Viruses, Academic 259

Press, San Diego, 2005. 260

Ghanekar AM, Reddy DVR, Izuka N, Amin PW, Gibson RW. (1979) Bud necrosis of 261

groundnut (A. hypogaea) in India caused by tomato spotted wilt virus. Ann. Appl. 262

Biol 93: 175–179. 263

Goldbach R, Peters D. (1994) Possible causes of the emergence of tospovirus diseases. 264

Sem Virol 5: 113-120. 265

Gowda S, Satyanarayana T, Naidu RA, Mushegian A, Dawson WO, Reddy DVR. (1998) 266

Characterization of the large (L) RNA of peanut bud necrosis tospovirus. Arch 267

Virol 143: 2381–2390. 268

Jain RK, Pappu HR, Pappu SS, Reddy MK, Vani A. (1998) Watermelon bud necrosis 269

tospovirus is a distinct virus species belonging to serogroup IV. Arch. Virol 143: 270

1637–1644. 271

Jain RK, Paul Khurana SM, Bhat AI, Chaudhary V. (2004) Nucleocapsid protein gene 272

sequence studies confirm that potato stem necrosis disease is caused by a strain of 273

groundnut bud necrosis virus. Indian Phytopath 57: 169–173. 274

Page 12 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

13

Mandal B, Jain RK, Choudhary V, Varma A. (2003) First report of natural infection of 275

Luffa acutangula by Watermelon bud necrosis virus in India. Plant Dis 87: 598. 276

Moyer JW. (1999) Tospovirus [Bunyaviridae]. In Encyclopedia of virology [Eds.A 277

Granoff and R.G.Webster], Academic press Newyork. pp: 1803-1807. 278

Page RDM. (1996) Treeview: An application to display phylogenetic trees on personal 279

computers. Cabios.12: 357-358. 280

Prins M, Dehaan, Luyten PR, Veller MV, Grinsven MV, Goldbach R. (1995) Broad 281

resistance to tospoviruses in transgenic tobacco plants expressing three tospoviral 282

nucleoprotein gene sequences. Mol Plant Microbe Interact 8: 85-91. 283

Ravi KS, Kaitkaru AS, Winter S. (2006) Iris yellow spot virus in onions: a new 284

Tospovirus record from India. Plant Pathol 55:288. 285

Reddy DVR, Devi KT. (2003) Peanuts. In: Viruses and virus-like diseases of major crops 286

in developing countries, pp 397-423. (Eds. Gad Loebenstein and George 287

Thottappilly). Kluwer Acadamic Publishers, Dorderecht. 288

Reddy DVR. (1988) Groundnut virus disease occurring in India. In.Monograph of 289

groundnut, pp 508-525) (eds P.S. Reddy). Indian council of Agricultural 290

Research, New Delhi, India. 291

Reddy DVR, Ratna AS, Sudarshana MR, Kiran K. (1992) Serological relationships and 292

purification of bud necrosis virus, a tospovirus occurring in peanut in India. Ann. 293

Appl. Biol 120: 279-286. 294

Reddy DVR, Amin PW, Mcdownald D, Ghanekar AM. (1983). Epidemiology and 295

control of groundnut bud necrosis and other diseases of legume crops in India 296

Page 13 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

14

caused by tomato spotted wilt virus. Plant virus epidemiology, ed. RT Plumb, JM 297

Thrash, pp: 93-102. 298

Reddy M, Reddy DVR, Appa Rao A. (1968) A new record of virus disease on peanut. 299

Plant Disease Reporter 52: 449-450 300

Satyanarayana T, Mitchell SE, Reddy DVR, Brown S, Kresovich S, Jarret R, Naidu RA, 301

Demski JW. (1996) Peanut bud necrosis tospovirus S RNA: complete nucleotide 302

sequence, genome organization and homology to other tospoviruses. Arch Virol 303

141: 85-98. 304

Satyanarayana T, Gowda S, Reddy KL, Mitchell SE, Dawson WO, Reddy DVR. (1998) 305

Peanut yellow spot virus is a member of a new serogroup of tospovirus genus 306

based on small (S) RNA sequence and organization. Arch Virol 143: 353–364. 307

Satyanarayana T, Mitchell SE, Reddy DVR, Brown S, Kresovich S, Jarret R, Naidu RA, 308

Demski JW. (1996) The complete nucleotide sequence and genome organization 309

of the M RNA segment of peanut bud necrosis tospovirus and comparison with 310

other tospoviruses. J. Gen. Virol 77: 2347–2352. 311

Sivaprasad Y, Bhaskara Reddy BV, Naresh Kumar CVM, Raja Reddy K, Sai Gopal 312

DVR. (2011) Jute (Corchorus capsularis): a new host of Peanut bud necrosis 313

virus. New Disease Reports 23: 33. [doi:10.5197/j.2044-0588.2011.023.033]. 314

Sivaprasad Y, Bhaskara Reddy BV, Naresh Kumar CVM, Raja Reddy K, Sai Gopal 315

DVR. (2011) First report of Groundnut Bud Necrosis Virus infecting Taro 316

(Colocasia esculenta). Australasian Plant Dis. Notes 6:30–32. [DOI 317

10.1007/s13314-011-0011-0 ]. 318

Page 14 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

15

Sreenivasulu P, Demski JW, Reddy DVR, Naidu RA, Ratna AS. (1991) Purification and 319

serological relationships of tomato spotted wilt virus isolates occurring on peanut 320

(Archis hypogaea) in the USA. Plant Pathol 40: 503-507. 321

Thein HX, Bhat AI, Jain RK. (2003) Mungbean necrosis disease is caused by a strain of 322

groundnut bud necrosis virus. Indian Phytopath 56: 54-60. 323

Thompson JD, Higgins DG, Gibson TJ. (1994) CLUSTAL W: Improving the sensitivity 324

of progressive multiple sequence alignment through sequence weighting, position-325

specific gap penalties and weigh matrix choice. Nucleic Acids Res 22: 4673-4680. 326

Umamaheswaran K, Jain RK, Bhat AI, Ahlawat YS. (2003) Biological and molecular 327

characterization of a tospovirus isolate from tomato and its relationship with other 328

tospoviruses. Indian Phytopath 56: 168–173. 329

330

Fig. 1. RT-PCR amplicons resolved by 1% agarose gel electrophoresis. 331

M: 1 Kb DNA Ladder, 1: Groundnut-TPT, 2: Groundnut-NLR, 3: Groundnut-KNL, 332

4: Groundnut-TN, 5: Groundnut-Coimbatoor, 6: Brinjal-TPT, 7: Tomato-TPT, 8: Black 333

gram-TPT, 9: Cowpea-TPT, 10: Field bean-TPT, 11: Cotton-TPT, 12: Taro-NLR, 13: 334

Jute- TPT, 14: Calotropis-NLR, 15: Groundnut-KDP and H: Healthy. 335

Fig. 2. Cluster dendrogram illustrating phylogenetic relationships based on the multiple 336

alignments of the coat protein (CP) gene sequences of 19 known Tospovirus species and 337

our isolates. Sequences for comparisons were obtained from gene bank and designation 338

given to each of the isolates and their GenBank accession numbers are given in Table.1 & 339

2. The phylogram was constructed using neighbor-joining method with bootstrapping 340

(500 replicates). 341

Page 15 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

16

Table.1. Members of the genus Tospovirus used for sequence analysis in the present 342

study 343

Table. 2. Percent nucleotide sequence identity of GBNV coat protein (CP) gene between 344

our isolates and other Tospovirus isolates 345

346

347

348

349

350

351

352

353

354

355

356

357

Page 16 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

Fig. 1. RT-PCR amplicons resolved by 1% agarose gel electrophoresis. M: 1 Kb DNA Ladder, 1: Groundnut-

TPT, 2: Groundnut-NLR, 3: Groundnut-KNL, 4: Groundnut-TN, 5: Groundnut-Coimbatoor, 6: Brinjal-

TPT, 7: Tomato-TPT, 8: Black gram-TPT, 9: Cowpea-TPT, 10: Field bean-TPT, 11: Cotton-TPT, 12: Taro-

NLR, 13: Jute- TPT, 14: Calotropis-NLR, 15: Groundnut-KDP and H: Healthy.

249x98mm (96 x 96 DPI)

Page 17 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

Fig. 2. Cluster dendrogram illustrating phylogenetic relationships based on the multiple alignments of the coat protein (CP) gene sequences of 19 known Tospovirus species and our isolates. Sequences for

comparisons were obtained from gene bank and designation given to each of the isolates and their GenBank accession numbers are given in Table.1 & 2. The phylogram was constructed using neighbor-joining method

with bootstrapping (500 replicates). 164x188mm (96 x 96 DPI)

Page 18 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

1

Table.1. Members of the genus Tospovirus used for sequence analysis in the present study

S. No PBNV Virus Isolates GenBank

Acc. No.

Reference

1 Groundnut-TPT EF179100

Present Study

2 Groundnut-NLR HM770021

3 Groundnut-KNL HM131489

4 Groundnut-TN HM770022

5 Groundnut- Coimbatoor HM770020

6 Grounndut-KDP JF968416

7 Brinjal-TPT FJ447355

8 Tomato-TPT FJ447359

9 Black gram-TPT HQ324114

10 Field bean-TPT EF532937

11 Cowpea-TPT EF179099

12 Cotton-TPT HQ324113

13 Taro-NLR HQ199845

14 Jute-TPT HQ324115

15 Calotropis-NLR HQ199844

Page 19 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

2

16 Brinjal-Maharashtra DQ375811 Bhanupriya,M et al.,2006

17 Soyabean-Delhi AF467289 Bhat,I et al., 2002

18 Blackgram-HYD AY512650

Ravi,K et al.,2004

19 Brinjal-KA AY512648

20 Chilli-Raipur AY882003

21 Mungbean-Maharashtra AY529713

22 Tomato-Pune AY882000

23 Carrot-HYD AY512651

24 Groundnut-Gadag AY512647

25 Potato-Rajasthan AF515821

Jain,R.K et al., 2002 26 Cotton-Delhi AY426317

27 Potato-MP AF515820

28 Groundnut-ATP FJ355951 Vemana,K et al., 2008

29 Groundnut-Delhi FJ355952

30 Tomato-KA AY184354 Savithri, H.S et al., 2003

31 Tomato-Coimbatore AY472081 Venkatesan,S et al.,2003

32 Tomato-Delhi AY463968 Raja,P et al.,2004

33 Cowpea-Coimbatore DQ058078 Karunakaran,S et al.,2005

Page 20 of 21JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960

For Peer Review

Table 2 Sequence identity of present isolates at amino acid (above the diagonal) and nucleotide (below the diagonal) levels respectively with other reported GBNV isolates

Isolates

HQ199845

HQ199844

HQ324113

HQ324114

HQ324115

EF179100

FJ447355

FJ447359

EF532937

EF179099

HM13148

9

HM77002

1

HM77002

2

HM77002

0

JF968416

AY184354

AY512650

AY472081

AY463968

DQ058078

AY882003

AF467289

AY529713

AY882000

AF515821

DQ375811

AY512648

AY512648

AY512651

AY512647

FJ355952

AY426317

AF515820

HQ199845 100 99.6 99.6 99.2 99.2 99.2 99.2 99.2 97.8 98.1 99.2 99.6 99.6 99.6 98.9 97.8 97.8 95.2 95.6 95.6 99.2 98.1 98.1 99.2 98.9 98.9 98.9 98.5 98.5 97.8 98.5 95.2 98.1

HQ199844 99.8 100 1 99.6 99.6 99.6 99.6 99.6 98.1 98.5 99.6 100 100 100 99.2 98.1 98.1 95.6 96 96 99.6 98.5 98.5 99.6 99.2 99.2 99.2 98.9 98.9 98.1 98.9 95.6 98.5

HQ324113 99.8 100 100 99.6 99.6 99.6 99.6 99.6 98.1 98.5 99.6 100 100 100 99.2 98.1 98.1 95.6 96 96 99.6 98.5 98.5 99.6 99.2 99.2 99.2 98.9 98.9 98.1 98.9 95.6 98.5

HQ324114 97.3 97.4 97.4 100 100 100 100 100 98.5 98.9 100 99.6 99.6 99.6 99.6 98.5 98.5 96 96.3 96.3 100 98.9 98.9 100 99.6 99.6 99.6 99.2 99.2 98.5 99.2 96 98.9

HQ324115 97.4 97.5 97.5 98.4 100 100 100 100 98.5 98.9 100 99.6 99.6 99.6 99.6 98.5 98.5 96 96.3 96.3 100 98.9 98.9 100 99.6 99.6 99.6 99.2 99.2 98.5 99.2 96 98.9

EF179100 99.3 99.5 99.5 97.4 97.3 100 100 100 98.5 98.9 100 99.6 99.6 99.6 99.6 98.5 98.5 96 96.3 96.3 100 98.9 98.9 100 99.6 99.6 99.6 99.2 99.2 98.5 99.2 96 98.9

FJ447355 98 98.1 98.1 97.3 97.2 98.4 100 100 98.5 98.9 100 99.6 99.6 99.6 99.6 98.5 98.5 96 96.3 96.3 100 98.9 98.9 100 99.6 99.6 99.6 99.2 99.2 98.5 99.2 96 98.9

FJ447359 98 98.1 98.1 97.5 97.2 98.4 98.3 100 98.5 98.9 100 99.6 99.6 99.6 99.6 98.5 98.5 96 96.3 96.3 100 98.9 98.9 100 99.6 99.6 99.6 99.2 99.2 98.5 99.2 96 98.9

EF532937 97.4 97.5 97.5 97.2 96.8 97.5 97.7 0.977 100 98.9 98.5 98.1 98.1 98.1 98.1 98.1 98.5 95.6 96 96 98.5 97.4 98.9 98.5 98.1 98.1 98.1 97.8 99.2 98.5 97.8 95.6 98.9

EF179099 97.4 97.5 97.5 97.4 97.5 97.5 97.7 0.977 98 100 98.9 98.5 98.5 98.5 98.5 98.5 98.9 96.7 97.1 97.1 98.9 97.8 99.2 98.9 98.5 98.5 98.5 98.1 99.6 98.9 98.1 96.7 99.2

HM131489 98.1 98.3 98.3 97.4 97.5 98.3 99.1 0.984 97.8 0.98 100 99.6 99.6 99.6 99.6 98.5 98.5 96 96.3 96.3 100 98.9 98.9 100 99.6 99.6 99.6 99.2 99.2 98.5 99.2 96 98.9

HM770021 99.8 100 100 97.4 97.5 99.5 98.1 0.981 97.5 97.5 98.3 100 100 100 99.2 98.1 98.1 95.6 96 96 99.6 98.5 98.5 99.6 99.2 99.2 99.2 98.9 98.9 98.1 98.9 95.6 98.5

HM770022 99.7 99.8 99.8 97.3 97.4 99.6 98 0.983 97.4 97.4 98.1 99.8 100 100 99.2 98.1 98.1 95.6 96 96 99.6 98.5 98.5 99.6 99.2 99.2 99.2 98.9 98.9 98.1 98.9 95.6 98.5

HM770020 99.6 99.7 99.7 97.2 97.3 99.7 98.1 0.981 97.3 97.3 98 99.7 99.8 100 99.2 98.1 98.1 95.6 96 96 99.6 98.5 98.5 99.6 99.2 99.2 99.2 98.9 98.9 98.1 98.9 95.6 98.5

JF968416 97.3 97.4 97.4 97.3 96.9 97.7 98 0.978 97.4 97.4 98.1 97.4 97.5 97.4 100 98.1 98.1 95.6 96 96 99.6 98.5 98.5 99.6 99.2 99.2 99.2 98.9 98.9 98.1 98.9 95.6 98.5

AY184354 97.4 97.5 97.5 97.2 96.8 97.5 97.7 0.977 98.1 97.9 97.8 97.5 97.4 97.3 97.7 100 98.1 95.2 95.6 95.6 98.5 97.4 98.5 98.5 98.1 98.1 98.1 97.8 98.9 98.1 97.8 95.2 98.5

AY512650 97.5 97.7 97.7 97.3 96.9 98 98.1 0.98 98.1 98.6 98.1 97.7 97.8 97.8 98 98 100 95.6 96 96 98.5 97.4 98.9 98.5 98.5 98.1 98.1 97.8 99.2 98.5 97.8 95.6 98.9

AY472081 93.6 93.7 93.7 93.8 94.1 93.9 93.8 0.938 93.9 94.4 93.9 93.7 93.6 93.7 93.6 93.8 93.9 100 99.6 99.6 96 94.9 96 96 95.6 95.6 95.6 95.2 96.3 95.6 95.2 98.9 96

AY463968 94.1 94.2 94.2 94.3 94.5 94.2 94.1 0.943 94.4 95 94.4 94.2 94.1 93.9 94.1 94.3 94.5 98.7 100 100 96.3 95.2 96.3 96.3 96 96 96 95.6 96.7 96 95.6 99.2 96.3

DQ058078 94.3 94.4 94.4 94.5 94.8 94.4 94.3 0.945 94.7 95 94.7 94.4 94.3 94.2 94.3 94.5 94.5 99 99.5 100 96.3 95.2 96.3 96.3 96 96 96 95.6 96.7 96 95.6 99.2 96.3

AY882003 97.1 97.2 97.2 97.2 97.1 97.7 97.2 0.972 96.6 97.1 97.3 97.2 97.3 97.4 96.9 96.6 97.1 93.7 93.9 94.2 100 98.9 98.9 100 99.6 99.6 99.6 99.2 99.2 98.5 99.2 96 98.9

AF467289 97.2 97.3 97.3 96.7 96.6 97.3 97.4 0.979 96.8 96.8 97.5 97.3 97.2 97.1 96.7 96.8 96.9 93.2 93.7 93.9 96.3 100 97.8 98.9 98.5 98.5 98.5 98.1 98.1 97.4 98.9 94.9 97.8

AY529713 97.1 97.2 97.2 96.6 96.2 97.4 97.8 0.971 97.4 97.7 97.4 97.2 97.1 97.2 97.1 97.5 98.1 94.3 94.5 94.5 96.7 96.5 100 98.9 98.5 98.5 98.5 98.1 99.6 98.9 98.1 96 99.2

AY882000 98.6 98.7 98.7 97.4 97.3 99.2 98.6 0.986 97.8 97.8 98.5 98.7 98.9 99 97.9 97.8 98.3 94.2 94.4 94.7 97.8 97.5 97.7 100 99.6 99.6 99.6 99.2 99.2 98.5 99.2 96 98.9

AF515821 98.3 98.4 98.4 97.3 97.2 98.4 98 0.98 97.7 97.7 98.1 98.4 98.3 98.1 97.5 97.7 97.8 93.8 94.3 94.8 97.2 97.2 97.3 98.6 100 99.2 99.2 98.9 98.9 98.1 98.9 95.6 98.5

DQ375811 97.3 97.4 97.4 97.3 97.2 97.9 97.8 0.978 97.2 97.2 97.7 97.4 97.5 97.7 97.3 97.2 97.7 93.8 94.1 94.3 97.4 97.2 97.1 98.1 97.5 100 99.2 98.9 98.9 98.1 98.9 96 98.5

AY512648 98.1 98.3 98.3 97.4 97.1 98.7 98.1 0.981 97.8 97.5 98 98.3 98.4 98.5 97.9 97.5 98 93.9 94.2 94.4 97.8 97.1 97.7 99 98.4 97.9 100 98.9 98.9 98.1 98.9 95.6 98.5

FJ355951 97.9 98 98 97.2 97.3 98 97.7 0.979 97.3 97.5 98 98 97.9 97.8 97.2 97.3 97.4 93.9 94.4 94.7 97.1 97.1 96.9 98.3 98.4 97.2 98 100 98.5 97.8 98.5 95.2 98.1

AY512651 97.3 97.4 97.4 96.9 96.6 97.9 98.1 0.977 97.8 97.8 97.5 97.4 97.5 97.7 97.4 97.7 98.3 94.2 94.4 94.7 97.1 96.6 97.4 98 97.4 97.7 97.8 97.1 100 99.2 98.5 96.3 99.6

AY512647 97.3 97.4 97.4 97.1 96.7 97.9 97.8 0.978 97.9 97.9 97.7 97.4 97.5 97.7 97.5 97.8 98.4 93.8 94.1 94.3 96.9 96.7 97.5 98.1 97.8 97.5 97.9 97.2 98.1 100 97.8 95.6 98.9

FJ355952 97.7 97.8 97.8 96.9 97.1 97.5 97.9 0.977 97.1 97.1 98 97.8 97.7 97.5 96.9 97.1 97.2 93.2 93.7 93.9 96.6 97.8 96.7 97.8 97.7 98.1 97.3 97.5 96.8 96.6 100 95.2 98.1

AY426317 93.2 93.3 93.3 93.9 93.9 93.3 93.5 0.935 93.8 94.2 93.8 93.3 93.2 93.1 93.7 93.7 93.7 97.3 98 98 93.3 92.9 93.5 93.7 93.5 93.6 93.6 93.6 94.1 93.5 93.1 100 96

AF515820 98 98.1 98.1 97.5 97.4 98.1 98.3 0.983 98.4 98.4 98.4 98.1 98 97.9 97.8 98.3 98.5 94.5 95 95.3 97.2 97.7 97.8 98.4 98.3 97.8 98.1 97.9 98.1 98.3 97.7 94.2 100

Page 21 of 21 JPH Manuscript Proof

123456789101112131415161718192021222324252627282930313233343536373839404142434445464748495051525354555657585960