Santander et al., Infection and Immunity 1 Title: Inflammatory Effects ...

Santander et al., Infection and Immunity

1

Title: 1

Inflammatory Effects of Edwardsiella ictaluri Lypopolysaccharide Modifications in 2

Catfish Gut 3

4

Authors: 5

Javier Santander1,2*

, Jacquelyn Kilbourne1, Jie-Yeun Park

1, Taylor Martin

1,3, 6

Amanda Loh1,3

, Ignacia Diaz1,4

, Robert Rojas2, Cristopher Segovia

2, Dale DeNardo

3 7

and Roy Curtiss 3rd1,3

. 8

9

1Center for Infectious Diseases and Vaccinology, The Biodesign Institute, Arizona State 10

University, Tempe, AZ 85287; 2Microbiology and Immunity Laboratory, Faculty of 11

Sciences, Universidad Mayor, Huechuraba, Chile 8580745; 3School of Life and Sciences, 12

Arizona State University, Tempe, Arizona 85287; 4Department of Physics, Master 13

Program in Nanoscience, Arizona State University, Tempe, Arizona 85287. 14

15

Keyword: Edwardsiella, Lipopolysaccharide, catfish, intestinal loops 16

17

Running Title: 18

LPS and Fish Intestinal Inflammation 19

*Corresponding Author: Javier Santander. University Mayor, Faculty of Sciences, Center 20

for Genomic and Bioinformatics, Microbiology and Immunity Laboratory, Camino la 21

Piramide 5750, Huechuraba, Santiago 8580745, Chile. Phone: 56-2-2518-92-05; e-mail: 22

[email protected] 23

24

IAI Accepts, published online ahead of print on 27 May 2014Infect. Immun. doi:10.1128/IAI.01697-14Copyright © 2014, American Society for Microbiology. All Rights Reserved.

on March 12, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


2

ABSTRACT 25

Bacterial lipopolysaccharides (LPS) are structural components of the outer membranes of 26

Gram-negative bacteria and also are potent inducers of inflammation in mammals. Higher 27

vertebrates are extremely sensitive to LPS but lower vertebrates, like fish, are resistant to 28

their systemic toxic effects. However, LPS effects on the fish intestinal mucosa remain 29

unknown. Edwardsiella ictaluri is a primitive member of the Enterobacteriaceae family 30

that causes enteric septicemia in channel catfish (Ictalurus punctatus). E. ictaluri infects 31

and colonizes deep lymphoid tissues upon oral or immersion infection. Both gut and 32

olfactory organs are the primary sites of invasion. At the systemic level E. ictaluri 33

pathogenesis is relatively well characterized, but our knowledge about E. ictaluri 34

intestinal interaction is limited. Recently, we observed that E. ictaluri oligo-35

polysaccharide (O-PS) LPS mutants have differential effects on the intestinal epithelia of 36

orally inoculated catfish. Here we evaluate the effects of E. ictaluri O-PS LPS mutants 37

using a novel catfish intestinal loop model and compared it to the rabbit ileal loop model 38

inoculated with Salmonella Typhimurium LPS. We found evident differences in rabbit 39

ileal loop and catfish ileal loop responses to E. ictaluri and S. Typhimurim LPS. We 40

determined that catfish respond to E. ictaluri LPS, but not to S. Typhimurium LPS. We 41

also determined that E. ictaluri inhibits cytokine production and induces disruption of the 42

intestinal fish epithelia in an O-PS dependent fashion. E. ictaluri wild type and wibT 43

LPS mutant caused intestinal tissue damage and inhibited pro-inflammatory cytokine 44

synthesis in contrast to E. ictaluri gne and ugd LPS mutants. We concluded that the E. 45

ictaluri O-PS subunits play a major role during pathogenesis, since that they influence the 46

recognition of the LPS by the intestinal mucosal immune system of the catfish. The LPS 47


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


3

structure of E. ictaluri mutants is need to understand the mechanism of interaction. 48

INTRODUCTION 49

The genus Edwardsiella, which consists of four species E. tarda, E. hoshinae, E. 50

piscida and E. ictaluri, is one of the most primitive members of the Enterobacteriaceae 51

family (1). E. ictaluri is one of the most important pathogens of commercially raised 52

channel catfish (I. punctatus) (2), which account for more than 80% of U.S. aquaculture 53

production, in spite of the recent production decrease (3,4). E. ictaluri infects and 54

colonizes catfish internal lymphoid tissues upon oral or bath infection making it a 55

promising strain to develop effective live attenuated recombinant vaccines for the catfish 56

industry (5). Both gut and olfactory organs are the primary sites of invasion of E. ictaluri 57

in natural outbreaks (6). E. ictaluri crosses the intestinal mucosa of channel catfish in 15 58

min after oral inoculation with 109 CFU (7). Although there are substantial descriptive 59

data relative to the invasion, spread, and persistence of E. ictaluri in channel catfish 60

(7,8,9), little is known about the molecular mechanisms of E. ictaluri fish intestinal 61

pathogenicity and pathogen associate molecular pattern (PAMPs) recognized by fish. 62

One of the most studied PAMPs is the lipopolysaccharide (LPS) that in mammals 63

is recognized by the Toll-like receptor 4 (TLR-4) (10,11,12). LPS is the major component 64

of the external layer of the outer membrane of Gram-negative bacteria. LPS is composed 65

of three distinct parts: carbohydrate subunits or oligo-polysaccharides (O-PS), the 66

oligosaccharide core region and the lipid A that is responsible for the activation of the 67

innate immune response in mammals and confers the endotoxic properties of the LPS 68

(13). On the other hand, fish, in contrast to mammals, are remarkable resistant to the 69

toxic effects of the LPS (14,15,16). 70

LPS is an important virulence factor for E. ictaluri (17,18,19). The E. ictaluri LPS 71


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


4

gene cluster has been identified by transposon mutagenesis (17,18) and recently fully 72

described (19). E. ictaluri LPS O-PS mutants exhibited different levels of virulence, 73

tissue colonization, and intestinal gut inflammation in orally inoculated catfish (19). In 74

deed, E. ictaluri wild type causes diarrhea-like symptoms in orally infected fish in 75

contrast to E. ictaluri LPS mutant strains (19). This observation correlates with the 76

current idea that fish recognize the O-PS of the LPS instead of the lipid A (20) and that 77

fish recognize LPS at the intestinal level. 78

Ligated ileal loops have been used to evaluate the contribution of LPS to 79

intestinal bacterial colitis in rabbit, mice and calves (21,22,23,24). Initially ligated loops 80

of rabbit small intestine have been used as a model to assess the contribution of putative 81

virulence factors to bacterial pathogen-induced diarrhea. This model was used for Vibrio 82

cholerae, where the injection of whole cultures (25,26), culture supernatants (27) and cell 83

extracts (28) caused dilation of the loop due to fluid accumulation. The rabbit ileal loop 84

model also has been used to study pathogenesis of Escherichia coli (29,30,31), 85

Salmonella (21,32,33), Shigella (34), Pseudomonas aeruginosa (35), Clostridium 86

perfringens (36), V. parahemolyticus, V. alcaligenes (37) and Bacillus cereus (38). In the 87

search for a model that mimics the human intestinal bacterial infection and inflammatory 88

responses, murine and bovine ligated ileal loops also have been used (39,40,41). 89

The complete LPS structure of E. ictaluri has not been elucidated. Nevertheless, 90

the composition and structure of the E. ictaluri O-PS has been reported (42). The E. 91

ictaluri typical O-chain was found to be an unbranched linear polymer of a repeating 92

tetrasaccharide unit composed of D-glucose, 2-acetamido-2-deoxy-D-galactose, and D-93

galactose in a 1:2:1 ratio having the structure: [4)--D-Glcp-(14)--D-GalpNAc-94


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


5

(13)--D-GalpNAc-(14)--D-Galp-(1]n (42). The E. ictaluri O-PS biosynthesis 95

enzymes are encoded by four genes, wibT, galF, gne and ugd, located in the O-PS gene 96

cluster (18,19). As mentioned previously, we determined that orally inoculated catfish 97

with E. ictaluri wild type developed diarrhea-like symptoms in contrast to fish inoculated 98

with LPS defective mutants (wibT, gne and ugd) (19). Intestinal diseases often lead 99

to disruption of the intestinal epithelial barrier either trough attachment and 100

internalization mediated effector molecule release, or through stimulation of host 101

inflammatory responses which ultimately compromise junctional integrity (43). Several 102

studies have begun to explore the cellular and molecular composition of mucosal surfaces 103

in salmonids (44,45), carp (46), cod (47), flounder (48) and catfish (49,50,51). Recently, 104

it has been suggested that E. ictaluri survive in intestinal macrophages (19) and caused 105

intestinal barrier disruption and immune suppression (49). Using a novel the catfish 106

intestinal loop model we corroborated that E. ictaluri caused intestinal barrier disruption 107

and immune suppression in a LPS O-PS dependent fashion. Furthermore, we determined 108

that E. ictaluri LPS O-PS plays a mayor role during catfish intestinal infection and 109

immune protective stimulation by a live attenuated E. ictaluri vaccine. 110

111

MATERIALS AND METHODS 112

113

Ethics statement. All research involving fish was conducted as per Protocol #09-1042R, 114

approved by the Arizona State University Institutional Animal Care and Use Committee. 115

116

Bacterial strains, media, and regents. The bacterial strains and plasmids are listed in 117


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


6

Table 1. Bacteriological media and components are from Difco (Franklin Lakes, NJ). 118

Antibiotics and reagents are from Sigma (St. Louis, MO). LB broth (tryptone, 10 g; yeast 119

extract 5 g; NaCl, 10 g; dextrose 1 g; ddH2O, 1L) (56) and Bacto-Brain Heart Infusion 120

(BHI) were used routinely. When required, the media were supplemented with 1.5% agar 121

or colistin sulphate (Col; 12.5 μg/ml). Bacterial growth was monitored 122

spectrophotometrically and/or by plating. 123

124

Bacteria inoculate preparation. Bacterial strains were grown overnight standing and 125

then the cultures were diluted 1:20 in prewarmed BHI broth and grown with mild 126

aeration (180 rpm) at 28C to an OD600 of 0.8 to 0.9 (~108 CFU/ml). Bacteria were 127

sedimented 10 min by centrifugation (7,000 rpm) at room temperature and resuspended 128

in saline (NaCl 0.85%) to appropriate densities for inoculation. 129

130

Bile Sensitivity. Sensitivity to bile was determined by the microplate serial dilution 131

assay. This assay was performed using flat bottom 96-well clear microtitre plates. Ox bile 132

and sodium deoxycholate were serially diluted in BHI broth and then inoculated with 133

mid-log-phase cultures of the E. ictaluri strains. The plates were incubated during 48 h 134

28C. 135

136

LPS purification and analysis. LPS extraction was performed by using TRI-regent 137

(Sigma) as described previously (57). LPS profile was evaluated by sodium dodecyl 138

sulfate-polyacrylamide gel electrophoresis and visualized by silver staining (58,59). 139

Protein contamination was evaluated by SYPROTM

Ruby (Invitrogene) staining and UV 140


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


7

scanning visualization (Typhoon Trio multi-mode imager, GE Healthcare) compared to 141

commercial LPS (Sigma). 142

143

Outer membrane protein (OMPs) preparation and purification. Sarkosyl-insoluble 144

outer membrane proteins (OMPs) were obtained as previously described (60). The outer 145

membrane proteins were LPS detoxified and normalized to 25 μg/μl by using the 146

nanodrop spectrophotometer (ND-1000, NanoDrop) and separated by 10% (wt/vol) 147

sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis for verification. 148

Coomassie blue staining was performed to visualize proteins. The residual LPS was 149

removed from the OMPs by Detoxi-GelTM Endotoxin columns (Thermo) and verified by 150

LPS profiles. 151

152

Rabbit surgery. The rabbits were fasted (but provided ad lib water) overnight 153

(maximum 16 hours) and then pre-medicated with 30 mg/kg ketamine and 6 mg/kg 154

xylazine intra muscular (i.m). Then, while masked with isoflurane in oxygen to a surgical 155

level of anesthesia (as indicated by lack of toe pinch, ear twitch reflexes and stable heart 156

rate via pulse oximetry), the ventral surface of the neck was shaved and disinfected by 157

sequential washes of chlorhexidine and alcohol. A cut down tracheotomy was performed 158

and an endotracheal tube placed to ensure a patent airway throughout the procedure. At 159

this point, mask administration of isoflurane was discontinued and further administration 160

was delivered via the endotracheal tube. Additionally, an intravenous catheter was placed 161

in an ear vessel to deliver lactated Ringers solution. The rabbits were monitored for depth 162

of anesthesia using pulse oximetry (heart rate and SpO2), ventilatory rate, and the lack of 163

a toe pinch reflex. Abdominal hair was removed along the mid-ventral body wall and the 164


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


8

skin disinfected using sequential washes with chlorhexidine and alcohol. An 165

approximately 10 cm midline incision was made through the skin and body wall. The 166

distal most region of the ileum was isolated, and a 4-6 cm section was double-ligated at 167

each end. Working proximally up the intestine, 6 more intestinal loops were created, each 168

1-2 cm apart. Throughout the procedure, sterile saline and moist gauze were used to keep 169

the viscera and body walls moist. After creation of all loops, 1.0 ml of LPS (100 g) or 170

bacterial culture (about 107 CFU) or sterilized saline (NaCl 0.85%) as a negative control 171

was injected into each loop. The body wall and skin were separately closed using a 172

simple continuous suture pattern. The rabbit was anesthetized for six hours, being 173

continuously observed. After 6 h, the rabbit was euthanized using an overdose of sodium 174

pentobarbital (150 mg/kg) injected intravenously. The intestinal loops were then 175

removed, the length of each segment measured, and the intestinal fluid extracted with the 176

volume-to-length ratio in milliliters per centimeter for each loop recorded. A piece of the 177

intestinal tissue was fixed in 10% formalin and subjected to histopathological study. Each 178

slide was graded on the basis of degree of mucosal disruption, cellularity, and vascular 179

congestion. 180

181

Channel catfish surgery. Thirty five outbreed channel catfish specific-pathogen-free 182

with a mean weight of 2 kg ± 10 g were used. The animals were acclimatized during 1 183

week prior to surgery in 100-liter tanks at 26 ± 1°C. Each tank is equipped with a re-184

circulating, biofiltered, mechanical filtered, and U.V. water treated system with 12 h light 185

cycle per day. The fish were fed daily with commercial Aquamax (Purina Mills Inc., St. 186

Louis, MO). The water quality was monitored for pH, NO2, and NO3 with standard kits. 187

Two days prior surgery the animals were fastened. The fish were anesthetized with 188


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


9

buffered tricaine methanesulfonate (pH 7.5)(61). Four anesthesia doses were used, fish 189

handling dose (15 mg/L; 25-26C), fish surgery dose (100 mg/L; 20-22C), recovery (30 190

mg/L; 20C-22C) and euthanasia (300 mg/L; 10-15C). From the acclimatization tanks, 191

the fish were moved to the handling anesthesia dose during at least 20 min. Then the fish 192

was moved to the surgery platform in a supine position (Fig. 1) and connected to the 193

surgical anesthesia dose. The fish platform developed here is a modified version of 194

previously described fish surgery platforms (62,63). The body is partially submerged in 195

water (the surgical site will remain above the water line) and the recirculating water flows 196

continuously through the mouth and over the gills (Figs. 1A and 1B). This permitted to 197

have the fish in position for the surgery while effectively ventilating the fish. Once the 198

fish was fully anesthetized, its body wall was cut and the coelomic cavity entered via 199

blunt dissection (Fig. 1C). The lower small intestine was isolated and up to 6 sections of 200

3 cm each were prepared by double-ligation (Fig. 1D). One hundred μg of purified LPS 201

in 500 l of phosphate saline buffer (PBS) or 500 l of 107 CFU/ml of E. ictaluri strains 202

were injected into each intestinal section (Fig. 1E). The control consisted in loops 203

inoculated with PBS, OMPs (100 g) or peptidoglycan from Staphylococcus aureus (100 204

g; Sigma). After injection, the body wall was sutured closed (Fig. 1F), and the fish was 205

moved to a bath containing a recovery anesthesia dose where it remained for up to 6 h to 206

allow time for the intestine to respond to the inoculate (Fig. 1G). After this period, the 207

fish was euthanized with a high concentration of buffered tricaine (300 mg/L) followed 208

by the harvesting of vital organs as a secondary method. The intestinal loops were then 209

removed, the length of each segment measured, and the intestinal fluid extracted with the 210

volume-to-length (V:L) ratio in milliliters per centimeter for each loop recorded. A piece 211


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


10

of the intestinal tissue was fixed in 10% formalin and subjected to histopathological 212

study. Each slide was graded on the basis of degree of mucosal disruption, cellularity, 213

and vascular congestion. 214

215

Quantitative real-time polymerase chain reaction (qRT- PCR). Gut samples were 216

frozen in liquid nitrogen prior to grinding. Total RNA was isolated using TRIzol®

LS 217

Reagent (Invitrogen) according to manufacturer’s instructions. Extracted RNA was 218

quantified by UV absorption using a NanoDrop ND-1000 spectrophotometer (NanoDrop 219

Technologies). The RNA was stored at -80℃ before use in complementary DNA (cDNA) 220

synthesis. Double-stranded cDNA was synthesized using Super Script®

III 1st Strand 221

Synthesis Kit (Invitrogen) in a final volume of 20 µl containing 2 µg of total RNA, 50 ng 222

of random hexamers, 1 µl dNTP (10 mM), 2 l DTT (0.1M), 2 μl 10 x RT buffer, 4 μl 223

MgCl2 (25 mM), 1 μl RNase-out (40U/μl), and 1 μl SuperScript III RT (200 U/μl) and 224

incubated at 50℃ for 50 min and at 85℃ for 5 min to terminate the reactions. 1 l of cDNA 225

was subsequently used as template in quantitative real time PCR using catfish specific 226

inflammatory cytokine primers listed in Table 2. RT-PCR were performed using the iQTM

227

SYBR®

Green Supermix (Bio-Rad) on the Multicolor Real-Time PCR Detection System 228

(Bio-Rad) with programmed thermal cycling conditions consisting of 40 cycles of 95°C 229

for 10 sec, 60 °C for 30 sec, and 72 °C for 30 sec. Each samples normalized to the 230

equivalent of the house-keeping gene, β-actin. The relative expression of the target gene 231

was estimated from the threshold cycles (Ct) according to the 2-ΔΔCt

methods (64). 232

Statistical analyses were performed using GraphPad Prism Version 6.00 for Windows 233

(Graph-Pad Software). Statistical comparison was performed using unpaired Student’s t-234


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


11

test. The significance level of the student t-test was set at P<0.05. 235

236

Statistics. An ANOVA (SPSS Software) analysis, followed by LSD (Least Significant 237

Difference) method, was used to evaluate differences in bacterial titers discerned to 95% 238

confidence intervals. P<0.05 was considered statistically significant. 239

240

RESULTS 241

242

E. ictaluri bile sensitivity. Bile is one of the main antibacterial components of the 243

intestinal fluids. Thus, we evaluate whether the E. ictaluri LPS (Fig. 2) mutant strains are 244

sensitive to Ox bile and sodium deoxycholate (Table 1). All the strains used in this study 245

were highly resistant to bile, suggesting that the LPS does not play role on bile resistance 246

in E. ictaluri. 247

248

Rabbit intestinal ileal loops inoculated with purified LPS. S. Typhimurium LPS 249

triggered significant fluid secretion with presence of blood (Fig. 3A), which correlated 250

with the intestinal inflammation and tissue damage (Fig. 4). In contrast, E. ictaluri wild 251

type LPS triggered low fluid secretion (Fig. 3A) and mild inflammation of the intestinal 252

epithelia without severe tissue damage (Fig. 4). E. ictaluri LPS mutants, including 253

wibT, gne and ugd, did not trigger fluid secretion (Fig. 3A). E. ictaluri wibT and 254

gne LPS triggered mild epithelial damage (Fig. 4). In contrast, E. ictaluri ugd LPS did 255

not cause tissue damage on the rabbit ligated loops (Fig. 4). Loops injected with OMPs or 256

peptidoglycan did not show any differences compared to the control. 257

258


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


12

Catfish intestinal loops inoculated with LPS. All purified LPS molecules from S. 259

Typhimurium or E. ictaluri triggered similar and significant levels of fluid secretion in 260

the catfish gut (Fig. 3B). However, S. Typhimurium LPS did not cause evident tissue 261

damage in contrast to E. ictaluri wild-type LPS that caused massive tissue damage and 262

gut inflammation (Fig. 4 and 5). Purified LPS from E. ictaluri wibT caused notorious 263

tissue damage in contrast to E. ictaluri gne LPS, which did not cause tissue damage or 264

significant inflammation (Figs. 4 and 5). E. ictaluri ugd LPS triggered a mild 265

inflammation with evident epithelial cell-cell junction disruption (Figs. 4 and 5). Loops 266

injected with OMPs or peptidoglycan did not show differences with respect to the 267

control. It has been established that fish intra-coelomic injected with LPS or fish 268

macrophages exposed to LPS do not generate an inflammatory immune response (20). 269

However, fish macrophages exposed to peptidoglycan mount an inflammatory immune 270

response (20). Catfish intestinal loops injected with purified peptidoglycan (100 g/dose) 271

did not show differences compared to the control (Fig. 6). 272

273

Catfish intestinal loops inoculated with E. ictaluri strains. E. ictaluri wild-type and S. 274

Typhimurium triggered significant fluid secretion in contrast with the mock negative 275

control (Figs. 3C and 4). However, E. ictaluri wild type caused extensive tissue damage 276

and inflammation in contrast with S. Typhimurium, which did not cause tissue damage 277

nor inflammation (Figs. 4 and 5). We noted that purified LPS form E. ictaluri gne, ugd 278

and S. Typhimurium stimulates goblet cells and mucus secretion (Fig. 7). Both E. ictaluri 279

and S. Typhimurium were recovered from the intestinal fluids and tissue in similar levels. 280

E. ictaluri wild type and S. Typhimurium were able to grow in the intestinal milieu (Fig. 281


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


13

8A) and colonized intestinal epithelial tissues (Fig. 8B). 282

E. ictaluri wibT caused significant levels of fluid secretion (Fig. 3C) and 283

significant tissue damage, similar to E. ictaluri wild-type (Figs. 4 and 5). We noted that 284

E. ictaluri gne, ugd and S. Typhimurium stimulate goblet cells and mucus secretion 285

without casing tissue damage (Figs. 4, 5 and 7). E. ictaluri wibT titers increased one log 286

fold in the intestinal milieu (Fig. 8A) and colonized epithelial tissues similar to the E. 287

ictaluri wild type (Fig. 8B). E. ictaluri gne generated significant low fluid secretion, 288

causing a mild inflammation with low tissue damage (Figs. 3C, 5 and 6). E. ictaluri gne 289

grow in the intestinal fluids in similar levels than the E. ictaluri wild type (Fig. 8A). 290

However, E. ictaluri gne was recovered in higher numbers from the intestinal 291

epithelium than E. ictaluri wild type (Fig. 8B). These results are in concordance with the 292

low tissue damage observed (Figs. 4 and 5) where epithelial cells containing E. ictaluri 293

are not in the intestinal fluids like the loops infected with E. ictaluri wild type and wibT. 294

Previous studies suggested that E. ictaluri gne is attenuated and immune protective 295

when orally administered to the fish, triggering a mild intestinal inflammation without 296

significant tissue damage (19). These results are coincident with our results, suggesting 297

that the gne mutant is a good candidate for oral live attenuated vaccine development. E. 298

ictaluri ugd titers recovered form the intestinal fluids and intestinal tissue were similar 299

to E. ictaluri wild type (Figs. 8A and 8B). 300

301

Cytokine expression. Cytokines play a major role in inflammatory responses. 302

Interleukins (IL) and tumor necrosis factors (TNFs) are a large group of cytokines 303

involved in innate immunity. In catfish only IL-1a, IL-1b, TNF- and IL-8 have been 304


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


14

identified (65,66,67). IL-1 plays a pivotal role in early pro-inflammatory cytokines that 305

enable the fish to respond to infection and enhance immune response induced by vaccines 306

(68). Also, it has been reported that in salmonid species IL-1, TNF- are induced in 307

presence of LPS and Gram-negative bacteria (69,70), triggering synthesis of IL-8 (71). 308

However, these studies focused on internal tissues like, spleen, liver and head kidney and 309

few studies have focused on the fish gut. Recently, we found that orally inoculated catfish 310

with E. ictaluri LPS O-PS mutants trigger lower inflammatory symptoms in contrast to 311

the wild type inoculated catfish (19), suggesting that LPS plays a role in inflammation at 312

the intestinal level in fish. Thus, here we evaluated expression of IL-1a, TNF- and IL-313

8 in the intestinal tissues 6 h post inoculation. During qRT-PCR settings, we detected that 314

the primers described for IL-1b generate two bands, one with the described molecular 315

weight and other just with the same sizes of -actin amplification fragment. Therefore, 316

here IL-1b was not measured. We found that E. ictaluri wild type and wibT down 317

regulated IL-1a, IL-8 and TNF- in contrast to gne and ugd which up regulated these 318

cytokines (Figs. 9A-C). S. Typhimurium slightly down regulated IL-a in a similar 319

fashion than E. ictaluri wild type, but with a significant difference between the fish and 320

non-fish bacterial pathogen (Fig. 9C). Although, TNF- and IL-8 levels were slightly up 321

regulated in S. Typhimurium inoculated loops, no significant differences were observed 322

in contrast to E. ictaluri WT (Figs. 9B-C). These results suggest that E. ictaluri wild type 323

and wibT have the ability to inhibit early innate immunity detection. Results from the 324

loops inoculated with gne and ugd indicate that this inhibitory ability might be LPS 325

mediated. Therefore, catfish intestinal loops were injected with purified LPS. Similar 326

results, but with ~10-fold increase in gne and ugd LPS samples, were found in loops 327


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


15

injected with purified LPS (Figs. 9D-F). This suggests that E. ictaluri LPS play an innate 328

immunity inhibitory role during fish intestinal colonization. Also, indicates that E. 329

ictaluri gne and ugd LPS molecules have intestinal immunestimulatory activity in the 330

fish gut, but the structure of these molecules is required to better understand these 331

interactions. Although the significant fold differences between the whole bacteria and the 332

purified LPS are evident, the results in both conditions have the same pattern. This might 333

be due to the fact that in the entire bacteria the LPS is in the outer membrane, not totally 334

accessible to interact with its putative receptor in contrast to the purified LPS. 335

336

DISCUSSION 337

338

In mammals, the lipid A portion of the LPS acts as a toxin by over-stimulating the 339

TLR-4 innate immune signaling, which induces pathogenic inflammatory responses. The 340

LPS is recognized by the serum circulating protein LBP (72) that facilitates the transfer 341

of LPS to the co-stimulatory molecule CD14 (73) and then to the myeloid differentiation 342

protein 2 (MD2; also called LY96) (74). MD2 is associated with the Toll-like receptor 4 343

(TLR4) and specifically recognized the endotoxic lipid A molecule (75), triggering a 344

downstream signaling that involves several intracellular TIR domain-containing adaptors, 345

like MDy88 and TICAM (76,77). 346

On the other hand, it is well established that fish and amphibians are very resistant 347

to the toxic effects of LPS (14). Several reports suggest that fish do not respond to LPS 348

because of the lack of PLB, CD14, LY96 and TCAM2, essential components for the 349

TLR4 function (20). Until today, functional LBP, CD14, MD2 and TCAM2 molecules 350

have not been described in fish. Indeed, more evolutionary advanced pufferfish lack 351


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


16

TLR4 ortholog (78,79). Also, it is suggested that LBP, CD14, MD2 and TCAM2 have 352

recently arisen during vertebrate evolution, being limited only to higher vertebrates 353

(20,80). This is supported by the extant literature indicating that fish are resistant to LPS 354

toxicity (14,19,20,81). It is evident that lower vertebrates interact with much higher 355

bacterial load in their living environment than land vertebrates, especially trough the 356

mucosal tissues. Perhaps due to the environmental selective pressure, imposed by the 357

aquatic “bacterial soup”, fish evolution did not favor high sensitivity to LPS. 358

However, several reports indicate that fish macrophages detect and respond to 359

high doses of LPS (15,16,19,20,80), but the mechanisms of detention and response are 360

unknown. 361

In the context of bacterial pathogenesis, recently we observed that catfish orally 362

infected with E. ictaluri wild type presented diarrhea-like symptoms, excreting mucoid 363

feces with high E. ictaluri titers (104-10

5 CFU/ml of feces) (19). In contrast, catfish orally 364

inoculated with E. ictaluri wibT, gne, or ugd (O-PS mutants) did not present 365

diarrhea-like symptoms (19). These results suggested that fish respond to LPS at the gut 366

level influencing E. ictaluri infection. These observations prompted us to investigate the 367

role of E. ictaluri LPS during intestinal inflammation by using the catfish intestinal loop 368

model and comparing it to the rabbit intestinal loop model and S. Typhimurium LPS. 369

Intestinal ligated loops have been used since 1950s to investigate intestinal interaction 370

with bacterial pathogens and their virulence factors. As mentioned previously all these 371

studies have been done in mammals, including mice, rats, rabbits, and calves 372

(22,23,24,27). In contrast to mammals, little is known about fish intestinal interaction 373

with bacterial pathogen LPS. 374

We observed that E. ictaluri LPS has effects on fish intestinal inflammation, 375


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


17

which is O-PS depending in fish but not in mammals (Figs. 3, 4 and 5). For instance, we 376

determined that purified E. ictaluri wild-type LPS triggers a mild inflammation in rabbit 377

ligated ileal loops in contrast to S. Typhimurium LPS that caused massive tissue damage 378

and inflammation (Figs. 4 and 5). The opposite results were observed in catfish intestinal 379

loops inoculated with purified E. ictaluri wild-type LPS. Catfish ligated loops inoculated 380

with S. Typhimurium LPS did not show significant tissue damage and inflammation in 381

contrast with E. ictaluri LPS that caused evident inflammation and tissue damage (Figs. 382

4, 5 and 6). E. ictaluri wibT LPS caused inflammation in both rabbits and fish ligated 383

loops, indicating that the E. ictaluri wibT LPS molecule is recognized by the innate 384

immune systems of fish and mammals. E. ictaluri gne LPS trigger a reduced epithelial 385

damage in rabbits, but no tissue damage was detected in intestinal fish loops. Although, 386

the LPS profile of E. ictaluri wibT and gne are similar, their glycosil compositions are 387

different (Fig. 2), suggesting that the structure of the O-PS is relevant to bacteria-fish 388

intestinal epithelia interaction and pathogenesis. E. ictaluri ugd LPS did not cause 389

effects on rabbit ligated loops, but in fish trigger a mild inflammation with an epithelial 390

cell-cell junction disruption (Figs. 4 and 5). 391

Immune stimulants represent a promising tool in aquaculture for enhancing 392

disease and stress resistance in cultured fish. It has been shown that oral administration of 393

LPS prevents disease in fish (82,83). However, the mechanisms of this oral immune 394

stimulation are unknown. Here we determined that purified LPS from E. ictaluri gne 395

and ugd mutants trigger synthesis of pro-inflammatory cytokines like IL-1, IL-8 and 396

TNF- in contrast to LPS from E. ictaluri wild type and wibT (Fig. 9). 397

IL-1 plays a pivotal role in early pro-inflammatory cytokines that enable 398


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


18

organism to respond to infection. Also, IL-1 has the potential to enhance immune 399

response induced by vaccines (68) and recombinant IL-1 has been use as an immune 400

stimulant for vaccines in sheep (84,85), pigs (86), cattle (87) and sea bass (88,89). In 401

teleost, the administration of immunostimulants, such as -1,3 glucan and peptidoglycan, 402

helps to prevent infections through activation of phagocytes, such as neutrophils, 403

monocytes, and macrophages, suggesting that the activation of innate immunity in teleost 404

fish by immune stimulants is a useful method of disease prevention that can replace the 405

use of antibiotics. Recent studies showed that orally administered LPS form Pantoea 406

agglomerans has a preventive effect against infection in fish such as yellowtail, carp, and 407

ayu (82). Among the possible receptors for LPS in fish it has been suggested that 2-408

integrin could play a role in LPS recognition (90,91). 2 integrins are one of the most 409

abundant receptor found in macrophages and they transmit intracellular activation signal 410

through MAP kinases and NF-B (90,91). 2 integrins recognize the hydrophilic 411

carbohydrate moiety that is buried in the outer bacterial membrane, but not the 412

hydrophobic lipid A (92). Also, the concentrations of LPS required to activate integrin 2 413

mediated activation of NF-B are high (93,94). We observed that the response to LPS at 414

the gut level is O-PS dependent (Fig. 9), suggesting an interaction with integrin 2 415

receptors or another carbohydrate receptor. This idea is supported by previous 416

observations, where fish intravenously injected with LPS and fish macrophages 417

inoculated with LPS respond in an O-PS dependent fashion (20). We observed that LPS 418

derived from gne and ugd E. ictaluri form supramolecules or aggregates, which seems 419

to increase interaction with fish macrophages (20). This observation correlates with the 420

increased stimulation of IL-1, IL-8 and TNF synthesis in the intestinal loops inoculated 421


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


19

with gne and ugd LPS, suggesting their potential utility as immune stimulants for fish. 422

Currently, there is a need for effective orally delivered vaccines (95). Thus studies 423

about fish gut bacterial interaction become important to develop effective oral vaccines 424

for aquaculture. Recently, we determined that an E. ictaluri gne strain conferred 425

immune protection to orally immunized fish (19). In contrast to the rest of E. ictaluri LPS 426

mutants study here, only gne confers immune protection to the orally immunized fish 427

(19). We observed that E. ictaluri gne do not cause tissue damage and fluid secretion, 428

increasing its colonization and interaction with lymphoid intestinal cells, influencing 429

positively the immune response to E. ictaluri. Perhaps, the immune stimulatory properties 430

of E. ictauri gne LPS, combines to its increased colonization of intestinal mucosa, lower 431

capability to survive in catfish macrohages, resistance to the antimicrobial peptides and 432

motility (19) make of E. ictauri gne a good candidate to be use as live attenuated 433

vaccine for the catfish aquaculture industry. 434

Here we have developed a catfish intestinal loop model to study the bacterial 435

interaction with the fish intestinal epithelia. By using this model, we determined that the 436

response to LPS at the intestinal level could differ depending on the LPS molecule and 437

the host. For instance, E. ictaluri LPS did not case inflammation in rabbit, perhaps its 438

lipid A has a different structure. The fish intestinal loop model is a useful methodology to 439

study pathogenesis and intestinal immunology, but also could be applied to evaluate 440

feeding diets, probiotics and therapeutic drugs. 441

442

443

444


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


20

445

446

ACKNOWLEDGMENTS 447

448

This work was supported by USDA grant CRIS-ARZR-2009-01801 and 449

Comisión Nacional de Investigación Científica y Tecnológica (CONICYT), Gestión 450

Propia Fellowship, Chile. We thank Tim Corsi and Joanne Tetens for their assistance at 451

The Biodesign Institute, Arizona State University, animal facility, and to Erika Arch, 452

Paul Hartig and Tina Hartig for their logistic support. 453

454

455

456

457

458

459

460

461

462

463

464

465

466

467

468


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


21

469

470

Table 1. Bacterial strains used in this study. 471

Strain Relevant characteristics Source or

reference

3761 S. Typhimurium Wild-type UK-1 (52, 53)

J100 E. ictaluri Wild-type 2003/c; Isolated from Channel

catfish, Ictalurus punctatus; pEI1+; pEI2

+

API20E 40040057 100% E. ictaluri; smooth

LPS; Colr; Pmb

r; Pro

r; H2S

–; H2O2

+; Ox bile

and sodium deoxicholate resistance >60 mg/ml

(54, 55)

J124 E. ictaluri wibT90, J100 derivative; pEI1+; pEI2

+

API20E 40040057 100% E. ictaluri; rough

LPS; Colr Pmb

r Pro

r H2S

– H2O2

+; Ox bile and

sodium deoxicholate resistance >60 mg/ml

(19)

J126 E. ictaluri gne-31 J100 derivative; pEI1+; pEI2

+


LPS; Colr Pmb

r Pro

r H2S

– H2O2

+; Ox bile and


(19)

J135 E. ictaluri ugd-11 J100 derivative; pEI1+; pEI2

+


LPS; Cols Pmb

s Pro

s H2S

– H2O2

+; Ox bile and

(19)


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


22

472

473

474

475

476

477

478

479

480

481

482

483

Table 2. Primers used for Q Real time-PCR. 484

485

F: forward primer; R: reverse primer 486

487


Gene Primer sequences Reference

β-actin

F AGAGAGAAATTGTCCGTGACATC

(67)

R CTCCGATCCAGACAGAGTATTTG

TNF-α F GGCCTCTACTTCGTCTAC

(66) R GCAGCAGCTTCTCGTCCAT

IL-1βa F CGGCAGATGTGACCTGCACA

(65) R CAGAGTAAAAGCCAGCAGAAG

IL-8 F CACCACGATGAAGGCTGCAACTC

(67) R TGTCCTTGGTTTCCTTCTGG


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


23

488

489

490

491

492

493

494

495

496

497

498

499


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


24

REFERENCES 500

501

1. Abayneh, T., D. J. Colquhoun, and H. Sorum. 2013. Edwardsiella piscicida 502

sp. nov., a novel species pathogenic to fish. J Appl Microbiol 114:644-654. 503

2. Shoemaker, C. A., P. H. Klesius, C. R. Arias, and J. J. Evans. 2009. Uses of 504

modified live vaccines in the aquaculture. J World Aqua Soc 5:573e85. 505

3. Hanson, T. and D. Sites. 2012. Catfish database 2011. 506

http://www.aces.edu/anr/fish/aquaculture/files/2012/03/2011-catfish-report-507

whole1.pdf 508

4. Harvey, D. 2006. Aquaculture Outlook. USDA, ERS, LDP – AQS-23. 509

5. Santander, J. and R. Curtiss III. 2012. Presented at the AFRI/NRI Animal 510

Health and Walfare Annual Project Director Meeting, Chicago IL. 511

6. Shotts, E. B., V. S. Blazer, and W. D. Waltman. 1986. Pathogenesis of 512

experimental Edwardsiella ictaluri infections in channel catfish (Ictalurus 513

punctatus). Can J Fish Aquat Sci 43:36-42. 514

7. Baldwin, T. J., and J. C. Newton 1993. Pathogenesis of enteric septicemia of 515

channel catfish, caused by Edwardsiella ictaluri: bacteriologic and light and 516

electron microscopic findings. J Aquat Anim Health 5:189–198. 517

8. Thune, R. L., D. H. Fernandez, J. L. Benoit, M. Kelly-Smith, M. L. Rogge, N. 518

J. Booth, C. A. Landry, and R. A. Bologna. 2007. Signature-tagged 519

mutagenesis of Edwardsiella ictaluri identifies virulence-related genes, including 520

a salmonella pathogenicity island 2 class of type III secretion systems. Appl 521

Environ Microbiol 73:7934-7946. 522


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


25

9. Morrison, R. N., G. A. Cooper, B. F. Koop, M. L. Rise, A. R. Bridle, M. B. 523

Adams, and B. F. Nowak. 2006. Transcriptome profiling the gills of amoebic gill 524

disease (AGD)-affected Atlantic salmon (Salmo salar L.): a role for tumor 525

suppressor p53 in AGD pathogenesis? Physiol Genomics 26:15-34. 526

10. Poltorak, A., K. Peppel, and B. Beutler. 1994. Receptor-mediated label-transfer 527

assay (RELAY): a novel method for the detection of plasma tumor necrosis factor 528

at attomolar concentrations. J Immunol Methods 169:93-99. 529

11. Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. 530

Takeda, and S. Akira. 1999. Cutting edge: Toll-like receptor 4 (TLR4)-deficient 531

mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the LPS 532

gene product. J Immunol 162:3749-3752. 533

12. Qureshi, S. T., L. Lariviere, G. Leveque, S. Clermont, K. J. Moore, P. Gros, 534

and D. Malo. 1999. Endotoxin-tolerant mice have mutations in Toll-like receptor 535

4 (Tlr4). J Exp Med 189:615-625. 536

13. Raetz, C. R., and C. Whitfield. 2002. Lipopolysaccharide endotoxins. Annu Rev 537

Biochem 71:635-700. 538

14. Berczi, I., L. Bertok, and T. Bereznai. 1966. Comparative studies on the toxicity 539

of Escherichia coli lipopolysaccharide endotoxin in various animal species. Can J 540

Microbiol 12:1070-1071. 541

15. MacKenzie, S., J. V. Planas, and F. W. Goetz. 2003. LPS-stimulated expression 542

of a tumor necrosis factor-alpha mRNA in primary trout monocytes and in vitro 543

differentiated macrophages. Dev Comp Immunol 27:393-400. 544

16. Pelegrin, P., J. Garcia-Castillo, V. Mulero, and J. Meseguer. 2001. 545

Interleukin-1beta isolated from a marine fish reveals up-regulated expression in 546


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


26

macrophages following activation with lipopolysaccharide and lymphokines. 547

Cytokine 16:67-72. 548

17. Lawrence, M., M. Banes, and M. Williams. 2001. Phenotype and virulence of a 549

transposon- derived lipopolysaccharide O side-chain mutant of Edwardsiella 550

ictaluri. J Aquat Anim Health 13:291-299. 551

18. Lawrence, M. L., M. M. Banes, P. Azadi, and B. Y. Reeks. 2003. The 552

Edwardsiella ictaluri O polysaccharide biosynthesis gene cluster and the role of 553

O polysaccharide in resistance to normal catfish serum and catfish neutrophils. 554

Microbiol 149:1409-1421. 555

19. Santander, J., T. Martin, A. Loh, C. Pohlenz, D. M. Gatlin, and R. Curtiss 556

III. 2013. Mechanisms of intrinsic resistance to antimicrobial peptides of 557

Edwardsiella ictaluri and its influence on fish gut inflammation and virulence. 558

Microbiol 159:1471-1486. 559

20. Iliev, D. B., J. C. Roach, S. Mackenzie, J. V. Planas, and F. W. Goetz. 2005. 560

Endotoxin recognition: in fish or not in fish? FEBS Lett 579:6519-6528. 561

21. Everest, P., J. Ketley, S. Hardy, G. Douce, S. Khan, J. Shea, D. Holden, D. 562

Maskell, and G. Dougan. 1999. Evaluation of Salmonella typhimurium mutants 563

in a model of experimental gastroenteritis. Infect Immun 67:2815-2821. 564

22. Kong, Q., D. A. Six, Q. Liu, L. Gu, S. Wang, P. Alamuri, C. R. Raetz, and R. 565

Curtiss, 3rd. 2012. Phosphate groups of lipid A are essential for Salmonella 566

enterica serovar Typhimurium virulence and affect innate and adaptive immunity. 567

Infect Immun 80:3215-3224. 568


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


27

23. Menge, C., M. Blessenohl, T. Eisenberg, I. Stamm, and G. Baljer. 2004. 569

Bovine ileal intraepithelial lymphocytes represent target cells for Shiga toxin 1 570

from Escherichia coli. Infect Immun 72:1896-1905. 571

24. Menge, C., I. Stamm, P. M. Van Diemen, P. Sopp, G. Baljer, T. S. Wallis, and 572

M. P. Stevens. 2004. Phenotypic and functional characterization of intraepithelial 573

lymphocytes in a bovine ligated intestinal loop model of enterohaemorrhagic 574

Escherichia coli infection. J Med Microbiol 53:573-579. 575

25. De, S. N., M. L. Ghose, and A. Sen. 1960. Activities of bacteria-free 576

preparations from Vibrio cholerae. J Pathol Bacteriol 79:373-380. 577

26. Syngkon, A., S. Elluri, H. Koley, P. K. Rompikuntal, D. R. Saha, M. K. 578

Chakrabarti, R. K. Bhadra, S. N. Wai, and A. Pal. 2010. Studies on a novel 579

serine protease of a hapA prtV Vibrio cholerae O1 strain and its role in 580

hemorrhagic response in the rabbit ileal loop model. PLoS One 5. 581

27. De, S. N., and D. N. Chatterje. 1953. An experimental study of the mechanism 582

of action of Vibriod cholerae on the intestinal mucous membrane. J Pathol 583

Bacteriol 66:559-562. 584

28. Burrows, W., and G. M. Musteikis. 1966. Cholera infection and toxin in the 585

rabbit ileal loop. J Infect Dis 116:183-190. 586

29. Kohler, E. M. 1971. Enterotoxic activity of whole cell lysates of Escherichia coli 587

in young pigs. Am J Vet Res 32:731-737. 588

30. Moon, H. W., S. C. Whipp, G. W. Engstrom, and A. L. Baetz. 1970. Response 589

of the rabbit ileal loop to cell-free products from Escherichia coli 590

enteropathogenic for swine. J Infect Dis 121:182-187. 591


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


28

31. Smith, H. W., and S. Halls. 1967. Observations by the ligated intestinal segment 592

and oral inoculation methods on Escherichia coli infections in pigs, calves, lambs 593

and rabbits. J Pathol Bacteriol 93:499-529. 594

32. Fromme, I., and S. Schlecht. 1973. [Influence of aeration conditions in 595

fermentation cultures on the chemical composition of Salmonella 596

lipopolysaccharides (author's transl)]. Zentralbl Bakteriol Orig A 224:331-344 597

33. Wallis, T. S., S. M. Paulin, J. S. Plested, P. R. Watson, and P. W. Jones. 1995. 598

The Salmonella dublin virulence plasmid mediates systemic but not enteric phases 599

of salmonellosis in cattle. Infect Immun 63:2755-2761. 600

34. Taylor, J., M. P. Wilkins, and J. M. Payne. 1961. Relation of rabbit gut reaction 601

to enteropathogenic Escherichia coli. Br J Exp Pathol 42:43-52. 602

35. Kubota, Y., and P. V. Liu. 1971. An enterotoxin of Pseudomonas aeruginosa. J 603

Infect Dis 123:97-98. 604

36. Duncan, C. L., H. Sugiyama, and D. H. Strong. 1968. Rabbit ileal loop 605

response to strains of Clostridium perfringens. J Bacteriol 95:1560-1566. 606

37. Bhattacharya, S., A. K. Bose, and A. K. Ghosh. 1971. Permeability and 607

enterotoxic factors of nonagglutinable vibrios Vibrio alcaligenes and Vibrio 608

parahaemolyticus. Appl Microbiol 22:1159-1161. 609

38. Spira, W. M., and J. M. Goepfert. 1972. Bacillus cereus-induced fluid 610

accumulation in rabbit ileal loops. Appl Microbiol 24:341-348. 611

39. Frost, A. J., A. P. Bland, and T. S. Wallis. 1997. The early dynamic response of 612

the calf ileal epithelium to Salmonella typhimurium. Vet Pathol 34:369-386. 613


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


29

40. Santos, R. L., S. Zhang, R. M. Tsolis, A. J. Baumler, and L. G. Adams. 2002. 614

Morphologic and molecular characterization of Salmonella typhimurium infection 615

in neonatal calves. Vet Pathol 39:200-215. 616

41. Wallis, T. S., R. J. Hawker, D. C. Candy, G. M. Qi, G. J. Clarke, K. J. 617

Worton, M. P. Osborne, and J. Stephen. 1989. Quantification of the leucocyte 618

influx into rabbit ileal loops induced by strains of Salmonella typhimurium of 619

different virulence. J Med Microbiol 30:149-156. 620

42. Vinogradov, E., L. Nossova, M. B. Perry, and W. W. Kay. 2005. The structure 621

of the antigenic O-polysaccharide of the lipopolysaccharide of Edwardsiella 622

ictaluri strain MT104. Carbohydr Res 340:1509-1513. 623

43. Guttman, J. A., and B. B. Finlay. 2009. Tight junctions as targets of infectious 624

agents. Biochim Biophys Acta 1788:832-841. 625

44. Niklasson, L., H. Sundh, F. Fridell, G. L. Taranger, and K. Sundell. 2011. 626

Disturbance of the intestinal mucosal immune system of farmed Atlantic salmon 627

(Salmo salar), in response to long-term hypoxic conditions. Fish Shellfish 628

Immunol 31:1072-1080. 629

45. Komatsu, K., S. Tsutsui, K. Hino, K. Araki, Y. Yoshiura, A. Yamamoto, O. 630

Nakamura, and T. Watanabe. 2009. Expression profiles of cytokines released in 631

intestinal epithelial cells of the rainbow trout, Oncorhynchus mykiss, in response 632

to bacterial infection. Dev Comp Immunol 33:499-506. 633

46. Rombout, J. H., S. J. van der Tuin, G. Yang, N. Schopman, A. Mroczek, T. 634

Hermsen, and J. J. Taverne-Thiele. 2008. Expression of the polymeric 635

Immunoglobulin Receptor (pIgR) in mucosal tissues of common carp (Cyprinus 636

carpio L.). Fish Shellfish Immunol 24:620-628. 637


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


30

47. Rajan, B., J. M. Fernandes, C. M. Caipang, V. Kiron, J. H. Rombout, and M. 638

F. Brinchmann. 2011. Proteome reference map of the skin mucus of Atlantic cod 639

(Gadus morhua) revealing immune competent molecules. Fish Shellfish Immunol 640

31:224-231. 641

48. Palaksha, K. J., G. W. Shin, Y. R. Kim, and T. S. Jung. 2008. Evaluation of 642

non-specific immune components from the skin mucus of olive flounder 643

(Paralichthys olivaceus). Fish Shellfish Immunol 24:479-488. 644

49. Li, C., Y. Zhang, R. Wang, J. Lu, S. Nandi, S. Mohanty, J. Terhune, Z. Liu, 645

and E. Peatman. 2012. RNA-seq analysis of mucosal immune responses reveals 646

signatures of intestinal barrier disruption and pathogen entry following 647

Edwardsiella ictaluri infection in channel catfish, Ictalurus punctatus. Fish 648

Shellfish Immunol 32:816-827. 649

50. Hebert, P., A. J. Ainsworth, and B. Boyd. 2002. Histological enzyme and flow 650

cytometric analysis of channel catfish intestinal tract immune cells. Dev Comp 651

Immunol 26:53-62. 652

51. Skirpstunas, R. T., and T. J. Baldwin. 2002. Edwardsiella ictaluri invasion of 653

IEC-6, Henle 407, fathead minnow and channel catfish enteric epithelial cells. Dis 654

Aquat Organ 51:161-167. 655

52. Hassan, J. O., and R. Curtiss, 3rd. 1990. Control of colonization by virulent 656

Salmonella typhimurium by oral immunization of chickens with avirulent delta 657

cya delta crp S. typhimurium. Res Microbiol 141:839-850. 658

53. Luo, Y., Q. Kong, J. Yang, G. Golden, S. Y. Wanda, R. V. Jensen, P. B. 659

Ernst, and R. Curtiss, 3rd. 2012. Complete genome sequence of the universal 660


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


31

killer Salmonella enterica Serovar Typhimurium UK-1 (ATCC 68169). J 661

Bacteriol 193:4035-4036. 662

54. Santander, J., Xin, W., Yang, Z. and Curtiss, R., III. 2010. The aspartate-663

semialdehyde dehydrogenase of Edwardsiella ictaluri and its use as balanced-664

lethal system in fish vaccinology. Plos One 5: e15944. 665

55. Petrie-Hanson, L., C. L. Romano, R. B. Mackey, P. Khosravi, C. M. Hohn, 666

and C. R. Boyle. 2007. Evaluation of zebrafish Danio rerio as a model for enteric 667

septicemia of catfish (ESC). J Aquat Anim Health. 19:151-158. 668

56. Bertani, G. 1951. Studies on lysogenesis. I. The mode of phage liberation by 669

lysogenic Escherichia coli. J Bacteriol 62:293-300. 670

57. Yi, E. C., and M. Hackett. 2000. Rapid isolation method for lipopolysaccharide 671

and lipid A from gram-negative bacteria. Analyst 125:651-656. 672

58. Hitchcock, P. J., and T. M. Brown. 1983. Morphological heterogeneity among 673

Salmonella lipopolysaccharide chemotypes in silver-stained polyacrylamide gels. 674

J Bacteriol 154:269-277. 675

59. Tsai, C. M., and C. E. Frasch. 1982. A sensitive silver stain for detecting 676

lipopolysaccharides in polyacrylamide gels. Anal Biochem 119:115-119. 677

60. Santander, J., G. Golden, S. Y. Wanda, and R. Curtiss III. 2012. The Fur 678

Regulated Iron Uptake System of Edwardsiella ictaluri and its Influence on 679

Pathogenesis and Immunogenicity in the Catfish Host. Infect Immun 80:2689-680

2703. 681

61. Popovic, N. T., I. Strunjak-Perovic, R. Coz-Rakovac, J. Barisic, M. Jadan, A. 682

Persin, Berakovic, R. Sauerborn Klobucar. 2012. Tricaine methane-sulfonate 683

(MS-222) application in fish anaesthesia. J Appl Ichthyol 28:553-564. 684


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


32

62. Brown, L. A. 1987. Recirculation anaesthesia for laboratory fish. Lab Anim 685

21:210-215. 686

63. Harms, C. A. 2005. Surgery in fish research: common procedures and 687

postoperative care. Lab Anim (NY) 34:28-34. 688

64. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression 689

data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. 690

Methods 25:402-408. 691

65. Wang, Y., Q. Wang, P. Baoprasertkul, E. Peatman, and Z. Liu. 2006. 692

Genomic organization, gene duplication, and expression analysis of interleukin-693

1beta in channel catfish (Ictalurus punctatus). Mol Immunol 43:1653-1664. 694

66. Zou, J., C. J. Secombes, S. Long, N. Miller, L. W. Clem, and V. G. Chinchar. 695

2003. Molecular identification and expression analysis of tumor necrosis factor in 696

channel catfish (Ictalurus punctatus). Dev Comp Immunol 27:845-858. 697

67. Chen, L., C. He, P. Baoprasertkul, P. Xu, P. Li, J. Serapion, G. Waldbieser, 698

W. Wolters, and Z. Liu. 2005. Analysis of a catfish gene resembling interleukin-699

8: cDNA cloning, gene structure, and expression after infection with Edwardsiella 700

ictaluri. Dev Comp Immunol 29:135-142. 701

68. Nash, P. V., and A. M. Mastro. 1993. Activation of primary lymphocytes 702

requires prolonged lectin stimulation. J Leukoc Biol 53:73-78. 703

69. Peddie, S., J. Zou, and C. J. Secombes. 2002. Immunostimulation in the 704

rainbow trout (Oncorhynchus mykiss) following intraperitoneal administration of 705

Ergosan. Vet Immunol Immunopathol 86:101-113. 706


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


33

70. Secombes, C. J., T. Wang, S. Hong, S. Peddie, M. Crampe, K. J. Laing, C. 707

Cunningham, and J. Zou. 2001. Cytokines and innate immunity of fish. Dev 708

Comp Immunol 25:713-723. 709

71. Wang, Z., X. Liu, A. Dacanay, B. A. Harrison, M. Fast, D. J. Colquhoun, V. 710

Lund, L. L. Brown, J. J. Li, and E. Altman. 2007. Carbohydrate analysis and 711

serological classification of typical and atypical isolates of Aeromonas 712

salmonicida: A rationale for the lipopolysaccharide-based classification of A-713

salmonicida. Fish & Shellfish Immunology 23:1095-1106. 714

72. Mathison, J. C., P. S. Tobias, E. Wolfson, and R. J. Ulevitch. 1992. Plasma 715

lipopolysaccharide (LPS)-binding protein. A key component in macrophage 716

recognition of gram-negative LPS. J Immunol 149:200-206. 717

73. Tobias, P. S., K. Soldau, J. A. Gegner, D. Mintz, and R. J. Ulevitch. 1995. 718

Lipopolysaccharide binding protein-mediated complexation of lipopolysaccharide 719

with soluble CD14. J Biol Chem 270:10482-10488. 720

74. Gioannini, T. L., A. Teghanemt, D. Zhang, E. N. Levis, and J. P. Weiss. 2005. 721

Monomeric endotoxin:protein complexes are essential for TLR4-dependent cell 722

activation. J Endotoxin Res 11:117-123. 723

75. Akashi, S., S. Saitoh, Y. Wakabayashi, T. Kikuchi, N. Takamura, Y. Nagai, 724

Y. Kusumoto, K. Fukase, S. Kusumoto, Y. Adachi, A. Kosugi, and K. 725

Miyake. 2003. Lipopolysaccharide interaction with cell surface Toll-like receptor 726

4-MD-2: higher affinity than that with MD-2 or CD14. J Exp Med 198:1035-727

1042. 728

76. O'Neill, L. A., and A. G. Bowie. 2007. The family of five: TIR-domain-729

containing adaptors in Toll-like receptor signalling. Nat Rev Immunol 7:353-364. 730


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


34

77. Vogel, S. N., and M. Fenton. 2003. Toll-like receptor 4 signalling: new 731

perspectives on a complex signal-transduction problem. Biochem Soc Trans 732

31:664-668. 733

78. Oshiumi, H., T. Tsujita, K. Shida, M. Matsumoto, K. Ikeo, and T. Seya. 2003. 734

Prediction of the prototype of the human Toll-like receptor gene family from the 735

pufferfish, Fugu rubripes, genome. Immunogenetics 54:791-800. 736

79. Jault, C., L. Pichon, and J. Chluba. 2004. Toll-like receptor gene family and 737

TIR-domain adapters in Danio rerio. Mol Immunol 40:759-771. 738

80. Sepulcre, M. P., F. Alcaraz-Perez, A. Lopez-Munoz, F. J. Roca, J. Meseguer, 739

M. L. Cayuela, and V. Mulero. 2009. Evolution of lipopolysaccharide (LPS) 740

recognition and signaling: fish TLR4 does not recognize LPS and negatively 741

regulates NF-kappaB activation. J Immunol 182:1836-1845. 742

81. Swain, P., S. K. Nayak, P. K. Nanda, and S. Dash. 2008. Biological effects of 743

bacterial lipopolysaccharide (endotoxin) in fish: a review. Fish Shellfish Immunol 744

25:191-201 745

82. Kohchi, C., H. Inagawa, T. Nishizawa, T. Yamaguchi, S. Nagai, and G. Soma. 746

2006. Applications of lipopolysaccharide derived from Pantoea agglomerans (IP-747

PA1) for health care based on macrophage network theory. J Biosci Bioeng 748

102:485-496. 749

83. Kadowaki, T., Y. Yasui, O. Nishimiya, Y. Takahashi, C. Kohchi, G. Soma, 750

and H. Inagawa. 2013. Orally administered LPS enhances head kidney 751

macrophage activation with down-regulation of IL-6 in common carp (Cyprinus 752

carpio). Fish Shellfish Immunol 34:1569-1575. 753


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


35

84. Elhay, M. J., and P. Andersen. 1997. Immunological requirements for a subunit 754

vaccine against tuberculosis. Immunol Cell Biol 75:595-603. 755

85. Lofthouse, S. A., A. E. Andrews, G. J. Barcham, and A. D. Nash. 1995. 756

Parameters related to the application of recombinant ovine interleukin-1 beta as 757

an adjuvant. Vaccine 13:1277-1287. 758

86. Blecha, F., D. N. Reddy, C. G. Chitko-McKown, D. S. McVey, M. M. 759

Chengappa, R. D. Goodband, and J. L. Nelssen. 1995. Influence of 760

recombinant bovine interleukin-1 beta and interleukin-2 in pigs vaccinated and 761

challenged with Streptococcus suis. Vet Immunol Immunopathol 44:329-346. 762

87. Reddy, D. N., P. G. Reddy, H. C. Minocha, B. W. Fenwick, P. E. Baker, W. 763

C. Davis, and F. Blecha. 1990. Adjuvanticity of recombinant bovine interleukin-764

1 beta: influence on immunity, infection, and latency in a bovine herpesvirus-1 765

infection. Lymphokine Res 9:295-307. 766

88. Buonocore, F., M. Mazzini, M. Forlenza, E. Randelli, C. J. Secombes, J. Zou, 767

and G. Scapigliati. 2004. Expression in Escherchia coli and purification of sea 768

bass (Dicentrarchus labrax) interleukin 1beta, a possible immunoadjuvant in 769

aquaculture. Mar Biotechnol (NY) 6:53-59. 770

89. Buonocore, F., M. Forlenza, E. Randelli, S. Benedetti, P. Bossu, S. Meloni, C. 771

J. Secombes, M. Mazzini, and G. Scapigliati. 2005. Biological activity of sea 772

bass (Dicentrarchus labrax L.) recombinant interleukin-1beta. Mar Biotechnol 773

(NY) 7:609-617. 774

90. Ingalls, R. R., and D. T. Golenbock. 1995. CD11c/CD18, a transmembrane 775

signaling receptor for lipopolysaccharide. J Exp Med 181:1473-1479. 776


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


36

91. Ingalls, R. R., M. A. Arnaout, R. L. Delude, S. Flaherty, R. Savedra, Jr., and 777

D. T. Golenbock. 1998. The CD11/CD18 integrins: characterization of three 778

novel LPS signaling receptors. Prog Clin Biol Res 397:107-117. 779

92. Chateau, M. T., and R. Caravano. 1997. The oxidative burst triggered by 780

Salmonella typhimurium in differentiated U937 cells requires complement and a 781

complete bacterial lipopolysaccharide. FEMS Immunol Med Microbiol 17:57-66. 782

93. Santos, D. R., J. B. Calixto, and G. E. Souza. 2003. Effect of a kinin B2 783

receptor antagonist on LPS- and cytokine-induced neutrophil migration in rats. Br 784

J Pharmacol 139:271-278. 785

94. Aurell, C. A., and A. O. Wistrom. 1998. Critical aggregation concentrations of 786

gram-negative bacterial lipopolysaccharides (LPS). Biochem Biophys Res 787

Commun 253:119-123. 788

95. Plant, K. P., and S. E. Lapatra. 2013. Advances in fish vaccine delivery. Dev 789

Comp Immunol 35:1256-1262. 790

791

792

793

794

795

796

797

798

799

800


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


37

FIGURE LEGENDS 801

802

Figure 1. Fish intestinal loops surgery process. A. Fish surgery platform. The arrows 803

indicate the water flow; B. Fish anesthesia application; C. Incision in the catfish to enter 804

the coelomic cavity; D. Catfish intestinal loops; E. Injection of intestinal loop; F. Suture 805

of the incision; G. Recovery bath (MS222 30 mg/l). 806

807

Figure 2. Phenotype of E. ictaluri O-PS mutants. A. Map of E. ictaluri oligo-808

polysaccharide genes; B. LPS profile of E. ictaluri O-PS mutants; C-E. Complementation 809

of O-PS mutants; F. Table LPS glycosyl composition analysis. N.D.: not detected; 810

*Values are expressed as mole per cent of total carbohydrate; Gal: galactose; Glu: 811

glucose; GalNAc: N-acetyl galactosamine; GlcNAc: N-acetyl glucosamine. Adapted 812

from Santander et al., 2013 (21). 813

814

Figure 3. Catfish intestine loops and fluid secretion. A. Rabbit loops 6 h post-815

inoculation with 100 g of LPS; B. Catfish loops 6 h post-inoculation with 100 g of 816

LPS; C. Catfish fluid secretion from the intestinal loops 6 h post-inoculation with 107 817

CFU/ ml of E. ictaluri; S. Typhimurium was used as control 108 CFU/ml. The number of 818

animals per group is 3. The experiment was repeated 3 times independently. The total of 819

animals used per group was 9. The error bars indicate the standard deviation. *: 820

significant difference versus Mock control (P<0.05). 821

822

Figure 4. Comparative intestinal loop histology 6 h post inoculation with 100 μg of 823

LPS or 107 CFU/dose of bacteria. Mock intestinal loops were injected with saline (NaCl 824


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


38

0.85%). The ileal loops were injected with 1 ml of the respective sample. These 825

experiments were repeated 2 to 3 times independently. 826

827

Figure 5. Histopathology score. A. Whole bacteria; B. Purified LPS; C. Combined 828

score; D. Scoring table. 829

830

Figure 6. Catfish intestinal loop histology 6 h post inoculation with peptidoglycane. 831

A. Mock, PAS stained; B. Pepetidoglycan, PAS stained; C. Mock, HE stained; D. 832

Peptidoglycan, HE stained. A and C. Mock intestinal loops were injected with 1 ml of 833

saline (NaCl 0.85%). B and D. Intestinal loops injected with 1 ml of peptidoglycan (100 834

g). These experiments were repeated 2 to 3 times independently. 835

836

Figure 7. Comparative intestinal loop histology 6 h post inoculation with 100 μg of 837

LPS or 107 CFU/dose of bacteria. A. Catfish loop, PAS stained; B. Number of goblet 838

cells in a bacterial injected loop; C. Number of goblet cells in a LPS injected loop. Mock 839

intestinal loops were injected with saline (NaCl 0.85%). Catfish intestinal loops were 840

injected with 1 ml of the respective LPS sample (100 ug). These experiments were 841

repeated 3-4 times independently. Each dot represents a field; *: significant difference 842

(P<0.05). 843

844

Figure 8. E. ictaluri colonization ratio in intestinal loop histology 6 h post-845

inoculation with 107

CFU/dose of bacteria. A. Fluid colonization; B. Tissue 846

colonization; *: significant difference versus wild type (P<0.05). Each dot represents an 847


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


39

independent experiment. Total of 9 animals were used. The error bars indicate the 848

standard deviation. 849

850

Figure 9. qRT-PCT of intestinal catfish cytokines induced by E. ictaluri LPS. A-C. 851

Intestinal response to E. ictaluri O-PS mutants. The intestinal loops were inoculated with 852

107 CFU of each mutant; D-F. Intestinal response to purified E. ictaluri LPS. The 853

intestinal loops were inoculated with 100 g of LPS from each mutant; The experiment 854

was repeated 2 times independently. The total of animals used per group was 6. The error 855

bars indicate the standard deviation; *:significant difference versus wild type. 856


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/


http://iai.asm.org/

Dow

nloaded from

http://iai.asm.org/

Santander et al., Infection and Immunity 1 Title: Inflammatory Effects ...

Documents