Under paddy and rainfed conditions salt levels in theroot medium are unlikely to remain constant as they didin the treatment regime applied in the first experimentThis variation in salt load was better represented in thePlant Accelerator (Experiment 2) where soil was salinisedand then transpired water replaced with fresh water to thesoil surface daily We contend that these contrasting re-gimes of salt application mimicked both steady-state andtransient salinisation including the salt loads imposed onrice paddies following spasmodic tidal surges The rankingof salt-tolerance for both the O sativa lsquostandardrsquo genotypesand the four wild rice relatives was broadly maintainedunder the two experimental regimes we employedIn this study we explored the naturally occurring vari-
ation in salt tolerance among some of ricersquos wild relativesin comparisons to selected O sativa cultivars Despitethe substantial genetic distance between O australiensis(taxon E) and Oryza sativa (taxon A) several studieshave managed to leap this species barrier allowing thesetwo species to be crossed (Morinaga et al 1960 Nezu etal 1960) Another study reported a rapid phenotype re-covery of the recurrent parent after only two backcrosses(Multani et al 1994) Using this backcrossing approachO australiensis accessions have been used in breedingprograms as a source of tolerance to biotic stresses in-cluding bacterial blight resistance (Brar and Khush1997) brown planthopper resistance (Jena et al 2006)and blast resistance (Jeung et al 2007 Suh et al 2009)Our study highlights the potential use of the Australianwild-species alleles in breeding programs to exploit vari-ations in abiotic stress generally and salinity tolerance inparticular However harnessing alleles from wild rela-tives of rice that confer salt tolerance and applying themto modern cultivars remains a long-term objective untilmechanisms of tolerance become clearer
Additional file 1 FigureS1 Relationships between Projected ShootArea (kpixels) 28 and 30 days after salting with Fresh Weight and DryWeight based on 168 individual plants using the fluorescence imagesSquared Pearson correlation coefficients are given on the right (152 kb)
Additional file 2 Table S1 Shoot dry weight shoot fresh weightchlorophyll concentration and photosynthetic rate for the four wild Oryzaaccessions and O sativa controls (15 kb)
Additional file 3 Table S2 Linear correlation (r values) betweenvarious physiological characteristics measured for the four wild Oryzaaccessions and O sativa controls combined at seedling stage grownunder 80 mM NaCl for 30 d = Significant at 5 level of probability and = Significant at 1 level of probability (17 kb)
Additional file 4 Figure 2 Smoothed Projected Shoot Area (describedby kpixels) of Absolute Growth Rates over six intervals within 0ndash28 daysafter salting X-axis represents the salt levels and the error bars representplusmn12 Confidence Interval (85 kb)
Additional file 5 Figure S3 Smoothed Projected Shoot Area(described by kpixels) of Relative Growth Rates over the four salt
treatments within 0ndash25 days after salting Error bars represent plusmn12Confidence Interval (81 kb)
Additional file 6 Figure S4 Absolute growth rates of all testedgenotypes from 0 to 30 DAS including non-salinised controls SmoothedAGR values were derived from projected shoot area (PSA) values to whichsplines had been fitted Thin lines represent individual plants Bold linesrepresent the grand average of the six replicates plants for each treat-ment The vertical broken lines represent the tested intervals (357 kb)
Additional file 7 Table S3 Photosynthetic rate stomatal conductancenumber of tillers and shoot fresh weight of the four wild Oryzaaccessions and O sativa controls The first three traits were evaluated on29 DAS while shoot fresh weight was measured on the termination ofthe experiment on 30 DAS Two measurements were excluded from thestomatal conductance analysis as they gave large negative values (minus 30and minus 50) Reduction values were rounded to the nearest integer (32 kb)
AbbreviationsAGT Absolute Growth Rate ANOVA Analysis of Variance DAS Days AfterSalting DAT Days After Transplanting DF Degrees of Freedom EC ElectricalConductivity FLUO Fluorescence IRRI International Rice Research InstitutePSA Projected Shoot Area PVC Polyvinyl Chloride QTL Quantitative TraitLocus RGB Red-Green-Blue RGR Relative Growth Rate SDW Shoot DryWeight SES Standard Evaluation System SFW Shoot Fresh WeightsPSA Smoothed Projected Shoot Area ST Salinity Tolerance WUI Water UseIndex YFL Youngest Fully Expanded Leaf
AcknowledgementsThe authors acknowledge the financial support of the AustralianGovernment National Collaborative Research Infrastructure Strategy(Australian Plant Phenomics Facility) The authors also acknowledge the useof the facilities and scientific and technical assistance of the Australian PlantPhenomics Facility which is supported by NCRIS The authors would like tothank all staff from the Plant Accelerator at the University of Adelaide forsupport during the experiments We also thank AProf Stuart Roy forconstructive comments on the manuscript
FundingThe research reported in this publication was supported by funding fromThe Australian Plant Phenomics Facility YY was supported by anInternational Postgraduate Research Scholarship
Availability of data and materialsThe datasets used andor analysed during the current study are availablefrom the corresponding author on reasonable request
Authorsrsquo contributionsYY designed and executed the first experiment YY also phenotyped theplants (for both experiments) performed the data analyses for the firstexperiment and wrote the manuscript CB designed the second experimentperformed the spatial correction and conceived of and developed thestatistical analyses for the phenotypic data of the second experiment BBassisted with the phenotypic analyses and revised the manuscript THR andBJA contributed to the original concept of the project and supervised thestudy BJA conceived the project and its components and provided thegenetic material All authors read and contributed to the manuscript
Publisherrsquos NoteSpringer Nature remains neutral with regard to jurisdictional claims inpublished maps and institutional affiliations
Author details1Sydney Institute of Agriculture University of Sydney Sydney Australia2School of Agriculture Food and Wine University of Adelaide AdelaideAustralia 3Australian Plant Phenomics Facility The Plant Accelerator WaiteResearch Institute University of Adelaide Adelaide Australia 4Department ofBiological Sciences Macquarie University Sydney Australia
Received 8 August 2018 Accepted 3 December 2018
ReferencesAl-Tamimi N Brien C Oakey H (2016) Salinity tolerance loci revealed in rice using
high-throughput non-invasive phenotyping Nat Commun 713342Asch F Dingkuhn M Doumlrffling K Miezan K (2000) Leaf K Na ratio predicts
salinity induced yield loss in irrigated rice Euphytica 113109ndash118Atieno J Li Y Langridge P (2017) Exploring genetic variation for salinity tolerance
in chickpea using image-based phenotyping Sci Rep 71ndash11Atwell BJ Wang H Scafaro AP (2014) Could abiotic stress tolerance in wild
relatives of rice be used to improve Oryza sativa Plant Sci 215ndash21648ndash58Ballini E Berruyer R Morel JB (2007) Modern elite rice varieties of the ldquogreen
revolutionrdquo have retained a large introgression from wild rice around thePi33 rice blast resistance locus New Phytol 175340ndash350
Berger B Bas De Regt MT (2012) High-throughput phenotyping in plants shootsMethods Mol Biol 9189ndash20
Brar DS Khush GS (1997) Alien introgression in rice Plant Mol Biol 3535ndash47Brien C J (2018) dae Functions useful in the design and ANOVA of experiments
Version 30-16Brozynska M Copetti D Furtado A (2016) Sequencing of Australian wild rice
genomes reveals ancestral relationships with domesticated rice Plant BiotechJ 151ndash10
Butler DG Cullis BR Gilmour AR Gogel BJ (2009) Analysis of Mixed Models for Slanguage environments ASReml-R reference manual Brisbane DPIPublications
Byrt CS Platten JD Spielmeyer W (2007) HKT15-like cation transporters linked toNa+ exclusion loci in wheat Nax2 and Kna1 Plant Physiol 1431918ndash1928
Campbell MT Du Q Liu K (2017) A comprehensive image-based phenomicanalysis reveals the complex genetic architecture of shoot growth dynamicsin rice Plant Genome 102
Campbell MT Knecht AC Berger B (2015) Integrating image-based phenomicsand association analysis to dissect the genetic architecture of temporalsalinity responses in rice Plant Physiol 1681476ndash1489
Davenport RJ Muntildeoz-Mayor A Jha D (2007) The Na+ transporter AtHKT11controls retrieval of Na+ from the xylem in Arabidopsis Plant CellEnviron 30497ndash507
Flowers TJ (2004) Improving crop salt tolerance J Exp Bot 55307ndash319Fukuda A Nakamura A Tagiri A (2004) Function intracellular localization and the
importance in salt tolerance of a vacuolar Na+H+ antiporter from rice PlantCell Physiol 45146ndash159
Garciadeblaacutes B Senn ME Bantildeuelos MA Rodriacuteguez-Navarro A (2003) Sodiumtransport and HKT transporters the rice model Plant J 34788ndash801
Grattan SR Shannon MC Roberts SR (2002) Rice is more sensitive to salinity thanpreviously thought Calif Agric 56189ndash195
Greenway H Munns R (1980) Mechanisms of salt tolerance in nonhalophytesAnnu Rev Plant Biol 31149ndash190
Gregorio GB Senadhira D (1993) Genetic analysis of salinity tolerance in rice(Oryza sativa L) Theor Appl Genet 86333ndash338
Hairmansis A Berger B Tester M Roy SJ (2014) Image-based phenotyping for non-destructive screening of different salinity tolerance traits in rice Rice 71ndash10
Harris BN Sadras VO Tester M (2010) A water-centred framework to assess theeffects of salinity on the growth and yield of wheat and barley Plant Soil336377ndash389
Hauser F Horie T (2010) A conserved primary salt tolerance mechanismmediated by HKT transporters a mechanism for sodium exclusion andmaintenance of high K+Na+ ratio in leaves during salinity stress Plant CellEnviron 33552ndash565
Henry RJ Rice N Waters DLE (2010) Australian Oryza utility and conservationRice 3235ndash241
IRRI (2013) Standard Evaluation System (SES) for Rice International Rice ResearchInstitute Manila p 38
Islam MR Salam MA Hassan L Collard BCY Singh RK Gregorio GB (2011) QTLmapping for salinity tolerance in rice Physiol Mol Biol Plants 23137ndash146
Ismail AM Horie T (2017) Molecular breeding approaches for improving salttolerance Annu Rev Plant Biol 681ndash30
Jacquemin J Bhatia D Singh K Wing RA (2013) The international Oryza mapalignment project development of a genus-wide comparative genomicsplatform to help solve the 9 billion-people question Curr Opin PlantBiol 16147ndash156
Jena KK Jeung JU Lee JH (2006) High-resolution mapping of a new brownplanthopper (BPH) resistance gene Bph18(t) and marker-assisted selectionfor BPH resistance in rice (Oryza sativa L) Theor Appl Genet 112288ndash297
Jeung JU Kim BR Cho YC (2007) A novel gene Pi40(t) linked to the DNAmarkers derived from NBS-LRR motifs confers broad spectrum of blastresistance in rice Theor Appl Genet 1151163ndash1177
Khatun S Flowers TJ (1995) Effects of salinity on seed set in rice Plant CellEnviron 1861ndash67
Khush GS (1997) Origin dispersal cultivation and variation of rice Plant Mol Biol3525ndash34
Khush GS (2005) What it will take to feed 50 billion rice consumers in 2030 PlantMol Biol 59(1)ndash6
Krishnamurthy P Ranathunge K Franke R (2009) The role of root apoplastictransport barriers in salt tolerance of rice (Oryza sativa L) Planta 230119ndash134
Krishnamurthy P Ranathunge K Nayak S (2011) Root apoplastic barriers blockNa+ transport to shoots in rice (Oryza sativa L) J Exp Bot 624215ndash4228
Lang N Li Z Buu B (2001) Microsatellite markers linked to salt tolerance in riceOmonrice 99ndash21
Lutts S Kinet JM Bouharmont J (1995) Changes in plant response to NaCl duringdevelopment of rice (Oryza sativa L) varieties differing in salinity resistance JExp Bot 461843ndash1852
Lutts S Kinet JM Bouharmont J (1996) NaCl-induced senescence in leaves of rice(Oryza sativa L) cultivars differing in salinity resistance Ann Bot 78389ndash398
Mackinney G (1941) Absorption of light by chlorophyll solutions J Biol Chem140315ndash322
Martinez-Atienza J Jiang X Garciadeblas B (2006) Conservation of the salt overlysensitive pathway in rice Plant Physiol 1431001ndash1012
Menguer PK Sperotto RA Ricachenevsky FK (2017) A walk on the wild side Oryzaspecies as source for rice abiotic stress tolerance Genet Mol Biol 40238ndash252
Morinaga T Kuriyama H (1960) Interspecific hybrids and genomic constitution ofvarious species in the genus Oryza Agric Hortic 351245ndash1247
Multani DS Jena KK Brar DS de los Reyes BG Angeles ER Khush GS (1994)Development of monosomic alien addition lines and introgression of genesfrom Oryza australiensis Domin to cultivated rice O sativa L Theor ApplGenet 88102ndash109
Munns R James RA Gilliham M (2016) Tissue tolerance an essential but elusivetrait for salt-tolerant crops Funct Plant Biol 431103ndash1113
Munns R Tester M (2008) Mechanisms of salinity tolerance Annu Rev Plant Biol59651ndash681
Nezu M Katayama TC Kihara H (1960) Genetic study of the genus Oryza ICrossability and chromosomal affinity among 17 species Seiken Jiho 111ndash11
Ochiai K Matoh T (2002) Characterization of the Na+ delivery from roots toshoots in rice under saline stress excessive salt enhances apoplastictransport in rice plants Soil Sci Plant Nutr 48371ndash378
Qadir M Quilleacuterou E Nangia V (2014) Economics of salt-induced landdegradation and restoration Nat Resour Forum 38282ndash295
R Core Team (2018) R A language and environment for statistical computingVienna Austria R Foundation for Statistical Computing
Rahman ML Jiang W Chu SH (2009) High-resolution mapping of two rice brownplanthopper resistance genes Bph20(t) and Bph21(t) originating from Oryzaminuta Theor Appl Genet 1191237ndash1246
Ren Z-H Gao J-P Li L (2005) A rice quantitative trait locus for salt toleranceencodes a sodium transporter Nat Genet 371141ndash1146
Sabouri H Sabouri A (2008) New evidence of QTLs attributed to salinity tolerancein African J Biotechnol 74376ndash4383
Scafaro AP Galleacute A Van Rie J (2016) Heat tolerance in a wild Oryza species isattributed to maintenance of rubisco activation by a thermally stable rubiscoactivase ortholog New Phytol 211899ndash911
Scafaro AP Haynes PA Atwell BJ (2010) Physiological and molecular changes inOryza meridionalis ng a heat-tolerant species of wild rice J Exp Bot 61191ndash202
Shi H Quintero FJ Pardo JM Zhu JK (2002) The putative plasma membrane Na+H+
antiporter SOS1 controls long-distance Na+ transport in plants Plant Cell 14465ndash477Stein JC Yu Y Copetti D (2018) Genomes of 13 domesticated and wild rice
relatives highlight genetic conservation turnover and innovation across thegenus Oryza Nat Genet 50285ndash296
Yichie et al Rice (2018) 1166 Page 13 of 14
206
Suh JP Roh JH Cho YC (2009) The pi40 gene for durable resistance to rice blastand molecular analysis of pi40-advanced backcross breeding linesPhytopathology 99243ndash250
Suzuki K Costa A Nakayama H (2016) OsHKT221-mediated Na+ influx over K+
uptake in roots potentially increases toxic Na+ accumulation in a salt-tolerantlandrace of rice Nona Bokra upon salinity stress J Plant Res 12967ndash77
Takagi H Tamiru M Abe A (2015) MutMap accelerates breeding of a salt-tolerantrice cultivar Nat Biotechnol 33445ndash449
Thomson MJ de Ocampo M Egdane J (2010) Characterizing the Saltolquantitative trait locus for salinity tolerance in rice Rice 3148ndash160
Wang W Vinocur B Altman A (2003) Plant responses to drought salinity andextreme temperatures towards genetic engineering for stress tolerancePlanta 2181ndash14
Wickham H (2009) ggplot2 Create Elegant Data Visualisations Using theGrammar of Graphics R package version 221
Yadav R Flowers TJ Yeo A (1996) The involvement of the transpirational bypassflow in sodium uptake by high- and low-sodium-transporting lines of ricedeveloped through intravarietal selection Plant Cell Environ 19329ndash336
Yao MZ Wang JF Chen HY Zha HQ Zhang HS (2005) Inheritance and QTLmapping of salt tolerance in rice Rice Sci 1225ndash32
Yeo AR Yeo ME Flowers SA Flowers TJ (1990) Screening of rice (Oryza sativa L)genotypes for physiological characters contributing to salinity resistance andtheir relationship to overall performance Theor Appl Genet 79377ndash384
Yeo AR Yeo ME Flowers TJ (1987) The contribution of an apoplastic pathway tosodium uptake by rice roots in saline conditions J Exp Bot 381141ndash1153
Zeng L Shannon MC Grieve CM (2002) Evaluation of salt tolerance in ricegenotypes by multiple agronomic parameters Euphytica235ndash245
Zhu Q Zheng X Luo J (2007) Multilocus analysis of nucleotide variation of Oryzasativa and its wild relatives severe bottleneck during domestication of riceMol Biol Evol 24875ndash888
Yichie et al Rice (2018) 1166 Page 14 of 14
207
RESEARCH ARTICLEwwwproteomics-journalcom
Salt-Treated Roots of Oryza australiensis Seedlings areEnriched with Proteins Involved in Energetics and Transport
Yoav Yichie Mafruha T Hasan Peri A Tobias Dana Pascovici Hugh D GooldSteven C Van Sluyter Thomas H Roberts and Brian J Atwell
Salinity is a major constraint on rice productivity worldwide Howevermechanisms of salt tolerance in wild rice relatives are unknown Rootmicrosomal proteins are extracted from two Oryza australiensis accessionscontrasting in salt tolerance Whole roots of 2-week-old seedlings are treatedwith 80 mM NaCl for 30 days to induce salt stress Proteins are quantified bytandem mass tags (TMT) and triple-stage Mass Spectrometry More than 200differentially expressed proteins between the salt-treated and control samplesin the two accessions (p-value lt005) are found Gene Ontology (GO) analysisshows that proteins categorized as ldquometabolic processrdquo ldquotransportrdquo andldquotransmembrane transporterrdquo are highly responsive to salt treatment Inparticular mitochondrial ATPases and SNARE proteins are more abundant inroots of the salt-tolerant accession and responded strongly when roots areexposed to salinity mRNA quantification validated the elevated proteinabundances of a monosaccharide transporter and an antiporter observed inthe salt-tolerant genotype The importance of the upregulatedmonosaccharide transporter and a VAMP-like protein by measuring salinityresponses of two yeast knockout mutants for genes homologous to thoseencoding these proteins in rice are confirmed Potential new mechanisms ofsalt tolerance in rice with implications for breeding of elite cultivars are alsodiscussed
1 Introduction
Rice (Oryza sativa L) is one of the most important staple foodcrops globally providing a primary source of carbohydrates formore than half of the worldrsquos population[1] Demand for rice isexpected to increase tomore than 800million tons in 2035[2] Riceis the leading source of calories in many developing countries
Y Yichie Dr M T Hasan Dr P A Tobias T H RobertsSydney Institute of AgricultureUniversity of SydneySydney AustraliaE-mail yoavyichiesydneyeduauDr D PascoviciAustralian Proteome Analysis FacilityDepartment of Molecular SciencesMacquarie UniversitySydney Australia
The ORCID identification number(s) for the author(s) of this articlecan be found under httpsdoiorg101002pmic201900175
DOI 101002pmic201900175
but substantial areas of otherwise high-yielding environments are subject tosalinization where toxic salt levels arefurther exacerbated by rising sea levelstidal surges and poorly regulated irriga-tion systems[3]
The polygenic nature of salt tolerancein plants has made it difficult to en-act effective countermeasures throughbreeding[4] The risks associated withsalinity are further amplified by globalpopulation growth requiring amore pro-found knowledge of the genetic vari-ation in salt tolerance and traits thatmight be used to improve toleranceSome genetic variation in salt toler-
ance has been reported among cultivatedrice varieties[5ndash7] Indeed several breed-ing programmes have used O sativa cul-tivars such as Pokkali and Nona Bokraas salt-tolerant parent donors incorpo-rating Saltol and other salt tolerancegenes[38] However the allelic variationrequired to breed stress-tolerant cropsmust now be expanded by introgressinggenes from wild relatives[910] because of
the relatively small proportion of the total genetic diversity inthe genus Oryza found in O sativa[11] Salinity tolerance of otherkey crop species such as durum wheat (Triticum durum)[12] andtomato (Solanum lycopersicum)[9] has been improved using natu-ral allelic variationEndemic Australian rice species have been identified as a
source of tolerance to abiotic and biotic stress in cultivated
Dr H D GooldNSW Department of Primary IndustriesMacquarie UniversitySydney AustraliaDr H D GooldDepartment of Molecular SciencesMacquarie UniversitySydney AustraliaDr S C Van Sluyter Prof B J AtwellDepartment of Biological SciencesMacquarie UniversitySydney Australia
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (1 of 12)
208
wwwadvancedsciencenewscom wwwproteomics-journalcom
rice[1314] Tissue tolerance to Na+ in seven pantropical wild ricespecies was reported recently implying the presence of keytolerance genes in the Oryza CC and DD genomes[10] Mem-brane transporters are a vital part of the control of influx ef-flux and partitioning of Na+ and Clminus For example withinthe Saltol QTL region OsHKT8 was identified to encode fora transporter that unloads Na+ from the xylem[15] Howevercare must be taken to acknowledge the many other potentialsources of tolerance such as the development of passage cells inrootsSeveral studies have investigated the molecular responses to
salt stress in rice using qualitative proteomics technologies[61617]
including root samples from O sativa[18] A quantitative riceplasma membrane study identified several important mecha-nisms of plant adaptation to salinity stress[19] Some of thesemechanisms are involved in the regulation of plasma mem-brane pumps and channels amelioration of oxidative stress sig-nal transduction and ldquomembrane and protein structurerdquo To ourknowledge this approach has not been applied to wild Oryzaspecies the accessions we identified recently[20] now make thisa priorityIn this study we used Tandem Mass Tags (TMT) to quantify
salinity-induced differences in the root membrane protein com-plement between two Australian Oryza australiensis accessionswhich we had established as salt-tolerant and susceptible[20]
Oryza australiensis is widely distributed across northern Aus-traliarsquos savannah and is well-adapted to erratic water supply sus-tained heat and spasmodic inundation from coastal and inlandwaterways By adopting the TMT approach we aimed to providea deeper understanding of salt-tolerance mechanisms that maynot have evolved in O sativa with the goal of providing molec-ular markers for the development of rice cultivars with greaterresilience to soil salinity
2 Experimental Section
21 Growth and Salinity Treatments
Following initial screening of a wide range of rice species andaccessions for growth responses to 25 and 75 mM NaCl in a hy-droponic solution two accessions of O australiensis were chosenfor this study Oa-VR and Oa-D which were salinity tolerant andsensitive respectively[20] Seeds were germinated on Petri dishesat 28 degC and at the two- to three-leaf stage transferred to dark-walled containers in Yoshida hydroponic solution[21] Plants weregrown in a temperature-controlled glasshouse with a 14-h pho-toperiod and daynight temperatures of 2822 degC with light in-tensity exceeding 700 micromolmminus2 sminus1 After 1 week in hydroponicsplants were exposed to salt solution (details below) or left as salt-free controls (ldquocontrolrdquo)Fifteen plants of each genotype were grown in each treatment
contributing five plants to each biological triplicate Fifteen daysafter germination (DAG) salt treatment was imposed graduallyin daily increments to concentrations of 25 40 and finally 80mMby adding NaCl to a final electrical conductivity (EC) of 10 dSmminus1[21] Hydroponic solutions were replaced at every 5 days and apH of 5 wasmaintained daily by adding 1 NNaOHorHCl Plantswere grown on a foam tray with netted holes to allow only the
Significance Statement
Expressionof genes in roots plays an important role in re-sponsesof rice to salinity because exclusionmechanismsarean important defense against salt toxicityQuantitative pro-teomics ofmembrane-enriched root preparationsoffers thepossibility of discoveringnewpathways of salt tolerance By ap-plying this approach toOryza australiensis a distant relative ofO sativa we contrast proteomic profiles atmoderate salt levelsin sensitive and tolerant accessions identified fromgenotypesendemic to theAustralian savannahWe found116proteinswere significantlymore abundant in the salt-tolerant than thesensitive accession after salt treatmentwhile 88proteinswererelatively less abundant in the tolerant accession After analysisof themost enrichedpathwaysmitochondrial ATPases andSNAREproteinswere found tobeparticularly responsive tosalt whichwe speculate play an indirect role in ion transportWe validated the salinity tolerancephenotypeof someof thedifferentially expressed root proteins via bothRT-qPCRandtestingof yeast strainswith deletions in homologuesof thegenes encoding thoseproteinsOur findingsprovide valuableinsights into pathways anda few individual proteins that con-tribute to salt tolerance inOaustraliensis andmay serve as thebasis for improving salinity tolerance in elite rice varieties andother important crops
roots to contact the solution The foam trays were covered withfoil to keep the roots in the dark thus preventing algal growthAir pumps were used to maintain vigorous aeration in the hydro-ponic solution
22 Preparation of Root Microsomal Protein Fractions
Thirty days after salt application (DAS) the entire root systemswere harvested and washed thoroughly with deionized waterProteins were extracted by grinding the washed roots with a mor-tar and pestle in 2mL ice-cold extraction buffer per gram of tissueas described[22] but with the addition of 1 mM sodium sulfiteHomogenates were filtered and centrifuged[22] and the pelletswere discarded Supernatants were centrifuged again at 87000 timesg for 35 min The pellets were washed with the same extractionbuffer (without BSA) and centrifuged as above The microsomalprotein and ultracentrifugation steps were repeated three timesso that transmembrane proteins were concentrated in the finalpelletPellets were dissolved with sonication in 100 microL 8 M urea 2SDS 02MN-methylmorpholine 01M acetic acid 10mM tris(2-carboxyethyl)phosphine (TCEP) then incubated at room temper-ature for 1 h to reduce disulphide bonds Cysteines were alkylatedby incubating with 4 microL 25 2-vinylpyridine in methanol for 1h at room temperature Alkylation was quenched with 2 microL of2-mercaptoethanolAlkylated proteins were extracted by acetate solvent pro-
tein extraction (ASPEX) according to Aspinwall et al[23] exceptthat the volumes of solvents and ammonium acetate solutionwere doubled The volumes of 11 ethanoldiethyl ether 01 M
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (2 of 12)
209
wwwadvancedsciencenewscom wwwproteomics-journalcom
triethylamine 01 M acetic acid 1 water 1 DMSO were keptat 15 mLThe ASPEX-extracted pellets were redissolved in 100 microL
8 M urea 2 SDS 02 M N-methylmorpholine 01 Macetic acid and protein concentrations determined by BCAassay (Thermo Scientific Rockford IL) Protein aliquots(50 microg) were then ASPEX extracted without the inclusion ofapomyoglobin[23]
23 Lys-Ctrypsin Digestion and TMT Reaction
Partially air-dried pellets were digested in Rapigest containingLys-C and trypsin as described[23] at pH 84 except that 04Rapigest was used instead of 03 Also instead of stoppingovernight digests by acidification with TFA digests were labeledwith TMT 10-plex reagents (Thermo Scientific) directly beforeacidifying the samplesA master mix of the 12 samples was created by pooling 4 microL
of each sample and labeled with the 126 channel All other chan-nels were randomly assigned to the samples in two sets of sixTMT channels The TMT reagent was dissolved in dry ACN andreactions were carried out according to the manufacturerrsquos in-structions After a 1-h incubation at room temperature reactionswere quenched with 2 microL 5 hydroxylamine for 15 minThe six channels per TMT set and the master mix were com-
bined and incubated with 250 microL of 05 TFA at 37 degC for 45minto hydrolyze the Rapigest The pooled samples were evaporatedto approximately 250 microL with a centrifugal evaporator (Eppen-dorf Hamburg Germany) and 250 microL of 01 TFA was addedfollowed by centrifugation at 15000 times g for 5 minSupernatants were desalted by solid-phase extraction using
Oasis HLB SPE cartridges (Waters Milford MA) as described[24]
Samples were dried to completion overnight in a centrifugalevaporator and reconstituted in water for hydrophilic interac-tion liquid chromatography (HILIC) fractionation Aliquots of25 microL of peptide for the total proteome analysis were fraction-ated as described previously[25] dividing each sample into sevenfractions
24 NanoLCndashMS3 Analysis Using an Orbitrap Fusion TribridtradeMass Spectrometer
Each TMT-labeled HILIC fraction was resuspended in 6 microLof MS Loading Buffer (3 (vv) ACN 01 (vv) formic acid)and analyzed by nanoLCndashMSMSMS using a Dionex Ultimate3000 HPLC system coupled to a Thermo Scientific OrbitrapFusion Tribrid Mass Spectrometer Peptides were injected ontoa reversed-phase column (75 microm id times 40 cm) packed in-housewith C18AQmaterial of particle size 19 microm (DrMaisch Ammer-buch Germany) and eluted with 2ndash30 ACN containing 01(vv) formic acid for 140 min at a flow rate of 250 nL minminus1 at55 degC The MS1 scans were acquired over the range of 350ndash1400 mz (120000 resolution 4e5 AGC 50 ms maximuminjection time) followed by MS2 and MS3 data-dependentacquisitions of the 20 most intense ions with higher collisiondissociation (HCD-MS3) (60000 resolution 1e5 AGC 300 msinjection time 2 mz isolation window)
25 Protein Identification
Raw data files of mass spectra generated using the Xcalibur soft-ware were processed using Proteome Discoverer 22 (ThermoScientific) with local Sequest HT andMascot servers[26] Since thesamples were derived fromO australiensis for which the genomehas not been sequenced a combined Oryza database was assem-bled as the search database Available Oryza species identifiersfrom UniProt were chosen consisting of O barthii O glaber-rima O nivara O punctata O rufipogon O sativa sp indica Osativa sp japonica and O meridionalis (downloaded from httpwwwuniprotcom in August 2018) The database was concate-nated (90 identity threshold) using CD-HIT software[27] givinga total of 133 465 sequences common contaminant protein se-quences were from GPM DB (httpswwwthegpmorgcrap)Search parameters includedMS andMSMS tolerances ofplusmn2 Daand plusmn02 Da and up to two missed trypsin cleavage sites Fixedmodifications were set for carbamidomethylation of cysteine andTMT tags on lysine residues and peptide N-termini Variablemodifications were set for oxidation of methionine and deamina-tion of asparagine and glutamine residues Proteins results werefiltered to 1 FDR quantified by summing reporter ion countsacross all peptide identifications and the summed signal intensi-ties were normalized to the channel that contributed the highestoverall signal
26 Analysis of Differentially Expressed Proteins (DEPs)and Functional Annotation
The TMTPrepPro scripts implemented in the R programminglanguage[28] were used for the subsequent analysis they wereaccessed through a graphical user interface provided via a localGenePattern server The scripts were used to identify DEPs and tocarry out overall multivariate analyses on the resulting datasetsFour quantitative comparisons were made of the DEPs be-
tween the two genotypes and treatments
(a) Oa-VR salt versus Oa-VR control
(b) Oa-D salt versus Oa-D control
(c) Oa-VR salt versus Oa-D salt
(d) (Oa-VR salt versus Oa-VR control)(Oa-D salt versus Oa-Dcontrol) that is the salt times genotype interaction
Student t-tests for each of the above comparisons and an Anal-ysis of Variance (ANOVA) were performed on log-transformedratios Proteins were deemed to be differentially expressed ifthey met the criteria of p-value lt005 and fold change gt15 orlt067 The quantified proteins were classified by parallel se-quence searches against reference databases to compile the re-sults and compute the most likely functional categories (BINs)for each query using MapMan[29] Bioinformatics analysis wasperformed using Mercator and MapMan[2930] to categorize theproteins into their biological processesSequential BLASTP searches with an E-value cut-off of 1eminus10
was used to map the sequences to corresponding identifiers inthe UniProt O sativa database Gene Ontology (GO) informa-tion was extracted from the UniProt database andmatched to theidentified proteins This GO information was used to categorize
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (3 of 12)
210
wwwadvancedsciencenewscom wwwproteomics-journalcom
the biological processes associated with DEPs using the PloGOtool[31] as described before[32] These proteins were categorizedinto a selected number of biological processes of interest usingthe PloGO tool which were further assessed for ldquoenrichmentrdquo inresponse to salt by means of Fisherrsquos exact test and in terms oftheir overall salt response by GO category using the same PloGOtool Proteins were then classified into pathways based on biolog-ical process information available on the KEGG database[29]
27 Primer Design
Primers were designed against the OsMST6 gene encoding aplasma membrane monosaccharide transporter from O sativa(Os07g37320) which was homologous to the correspondingO australiensis protein (UniProt A0A0D3GSD4) while theOs12g03860 gene was used for UniProt A0A0E0MJB0 Primer3software version 040 (httpbioinfouteeprimer3-040) wasutilized ensuring at least one primer spanned an intron Forwardand reverse primers Os07g37320 (F TGGTGGTGAACAACG-GAGG R CACCGACGGGAAGAACTTGA) Os12g03860 (FAGACTTGCATGTTGCTCGGA R AATGACAGGCTTACGGC-CAA) and a reference gene Eukaryotic elongation factor 1-alpha(F TTTCACTCTTGGTGTGAAGCAGAT R GACTTCCTTCAC-GATTTCATCGTAA) were BLASTed against theO sativa genomewithin Phytozome (v121) for target specificity Both primers setswere synthesized by Integrated DNA Technologies Ltd (NSWAustralia) and tested on complementary DNA (cDNA) using theBioLine SensiFAST SYBR No-ROX Kit according to the manu-facturerrsquos instructions Resulting amplicons were visualized us-ing 2 agarose gel electrophoresis and bands were validated withthe expected amplicon sizes
28 RNA Extraction and Quantitative Reverse-Transcription PCR(RT-qPCR) Analysis of Rice Gene Expression
Harvested roots (section 22) were immediately placed in liquidnitrogen before being stored at minus80 ˚C Three biological repli-cates were collected per genotype and treatment giving a total of12 samples Total RNA was extracted using the SigmandashAldrichSpectrumtrade Total RNA Kit (Sigma-Aldrich St Louis MO) usingProtocol A with incubation at 56 ˚C for 6 min for the tissuelysis cDNA was synthesized using the SensiFAST cDNA Syn-thesis Kit (BioLine NSW Australia) as per the manufacturerrsquosinstructions Primer pairs were run separately on 96-well plates(20 microL BioLine SensiFAST SYBR No-ROX Kit) with salt-treatedand control cDNA Serial dilutions were loaded in triplicate[33]
and PCR thermocycling was performed using the BioRad C1000Touch thermocycler as per the previously confirmed assay Rel-ative gene expression in salt-treated plants versus control plantswas calculated for each gene with calibration to the referencegene using efficiency-corrected calculation models based onreplicate samples[34]
29 Validation of Candidate Salt-Responsive Genes Using a YeastDeletion Library
The Saccharomyces cerevisiae deletion library containing gt21000haploid gene deletion mutants and the parental strain BY4742
(MATa his3D1 leu2D0 lys2D0 ura3D0 wild type [WT]) were in-terrogated to validate protein hits from the rice TMT-labeled pro-teomics experiment[35] Rice gene sequences for some of themoststrongly salt-affected proteins were BLASTed against the yeastgenome using the Saccharomyces Genome Database (SGD) toidentify the closest yeast gene homologuesThe corresponding yeast deletion strains identified from the
deletion yeast library[35] were used to assess colony growth versusWT when these lines were exposed to salinity NaCl was added at300mM 700mM and 10 M to the YPD solid medium (1 yeastextract 2 peptone 2d-glucose) at 30 degC These salt concentra-tions were much higher than those used for the rice experimentsbecause yeast is highly salt tolerant[36] For control images strainswere also grown in the absence of exogenous NaCl
3 Results
31 Growth and Phenotype of O australiensis Accessions underSalt Stress
Root microsomal fractions were extracted at 30 days after ex-posure to NaCl Salt-stress symptoms in both accessions wereapparent Growth was markedly more affected in Oa-D than inOa-VR after the salt treatment as previously reported[20] Further-more leaf necrosis was seen only in Oa-D All seedlings grewvigorously in the absence of salt with green and healthy leavesand a visibly larger root system than in the presence of salt
32 Protein Identification
Only peptides with p-values below the Mascot significancethreshold filter of 005 were included in the search result A to-tal of 2680 and 2473 proteins were quantified (FDR lt1) inthe Oa-VR and Oa-D accessions respectively (Table 1A) TheUniProt taxonomy tool was used to sort these hits from individualrice species in a combined rice database comprising sequencesfrom several accessions as described in the section 2 The high-est number of matches was the 1090 annotated proteins fromO punctata while O sativa and O barthii generated 670 and625 hits respectively (Table 1B) The functional MapMan cat-egories of the reference data coverage of quantified proteinswere combined and the numbers of proteins protein domainsand family profiles classified in the 35 main MapMan categories(Figure 1) Of all the quantified proteins 10were categorized astransporters 8 as signaling proteins and 4 as stress proteins(Figure 1A) About 40 of the quantified proteins had at least onetransmembrane region (Figure 1B) of which more than 200 (6of the total proteins identified) had ten or more transmembranedomains
33 Statistically Significant Differentially Expressed Proteins
Sample replicates (control and salt) were plotted to evaluatethe consistency of the TMT experiment Only minor deviationswere observed between replicates and principal component anal-ysis showed that biological replicates were clustered All tested
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (4 of 12)
211
wwwadvancedsciencenewscom wwwproteomics-journalcom
Table 1 (A) Summary of proteins identified and quantified bymultiple pep-tides forO australiensis accessionsOa-VR andOa-D using the TMT quan-tification method (FDR lt1) (B) Number of proteins identified for Oa-VR and Oa-D accessions from the combined Oryza database (consistingOryza barthii Oryza glaberrima Oryza nivara Oryza punctata Oryza rufi-pogon Oryza sativa sp indica Oryza sativa sp Japonica and Oryza merid-ionalis) and the corresponding genome of eachOryza species The numberof hits corresponding to each taxon was determined using the UniProt tax-onomy tool
(A)
Oryzaaustraliensisaccession
Totalredundantpeptides
Uniquepeptides
Totalredundantproteins
Proteinsquantifiedby multiplepeptides
Oa-VR 57 498 43 788 11 046 2680
Oa-D 52 925 40 113 9986 2473
(B)
Oryzaspecies
Numberof hits
Genome
O barthii 625 AA
O glaberrima 192 AA
O meridionalis 547 AA
O punctata 1090 BB
O rufipogon 231 AA
O sativa 670 AA
genotype and treatment combinations had similar log ratio dis-tributions (Figure S1A-S1C Supporting Information) To de-termine whether a protein was significantly up- or downregu-lated between the two treatments or genotypes we imposed twocriteria (i) the absolute fold-change values which had to be gt15or lt067 for up- and downregulated proteins respectively and(ii) the p-value which had to be lt005 according to a t-test per-formed between the three biological replicates (salt vs control)
The TMT overall multirun hits resulted in a multivariateoverview of the data which could be represented as four unsu-pervised cluster patterns (Table S1 and Figure S2 SupportingInformation) Accordingly 190 proteins were upregulated inboth sensitive and tolerant accessions under salt treatment while197 proteins were downregulated in both genotypes under thesame salt treatment (Figure S2 Supporting Information)A total of 268 proteins increased by at least the 15-fold cut-
off in at least one of the tested comparisons (Experimental Sec-tion) This increase was significant for 260 proteins as foundusing an ANOVA test with three replicates at p lt005 (Ta-ble S1 Supporting Information) The largest change in proteinabundance was a 645-fold increase in an uncharacterized pro-tein (UniProt A0A0D3H139) in the sensitive accession (Oa-D) treated with salt compared with the same accession grownwithout salt (Table S1 Supporting Information) The five high-est fold changes that were induced by salt were observed in bothaccessions
34 SaltndashGenotype Interaction
In salt-treated plants 116 proteins were significantly upreg-ulated and 88 proteins were significantly downregulated inOa-VR relative to Oa-D (Table 2) while 1132 responded to asimilar degree in the two genotypes When the data from bothaccessions were combined the numbers of up- and downreg-ulated salt-responsive proteins identified were almost equalwith 1341 up and 1339 down in Oa-VR and 1279 up and 1194down in Oa-D (data not shown) compared with the respectivecontrols However the proportion of individual proteins withsignificantly downregulated expression in response to salt was48 for Oa-VR (the salt-tolerant genotype) which was lowerthan the 55 observed for Oa-D (Table 2)Proteins comprising the functional processes of lipid trans-
porter activity transporter activity and transmembrane trans-porter activity were significantly upregulated (p lt001) in Oa-D
Figure 1 (A) An overview of the percentages of identified proteins categorized in the MapMan BINs of all quantified proteins The quantified proteinswere classified by a parallel sequence search against reference databases to compile the results and compute the most likely MapMan BINs for eachquery (B) Quantified proteins were analyzed for transmembrane (TM) domains using TMHMM ldquo0 TMrdquo represents proteins with no transmembranedomain ldquo1 TMrdquo for one transmembrane domain and so on Protein modification and metabolism including synthesis degradation and localizationProteins involved in cell divisioncycleorganizationvesicle transport Miscellaneous proteins including peroxidases and other enzymes notdesignated to specific groups
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (5 of 12)
212
wwwadvancedsciencenewscom wwwproteomics-journalcom
Table 2 Overall numbers of significantly up- and downregulated (foldchange gt15 or lt067 respectively) proteins in multiple two-sample com-parisons within accessions in response to salt and between accessionswith salt treatment (p-value lt005)
Significant changes(Student t-testp lt005)
Oa-VR_Saltvs Control
Oa-D_Saltvs Control
Oa-VR_Saltvs Oa-D_Salt
Upregulated 104 (52) 128 (45) 116 (57)
Downregulated 96 (48) 154 (55) 88 (43)
Percentage values in brackets represent the proportion number of proteins that wereupdownregulated in each comparison
compared with Oa-VR (Figure 3) All eight proteins involved inlipid transporter activity that were found in the tolerant genotypewere downregulated significantly under salt treatment (Figure 3and Table S2 Supporting Information)
35 Functional Annotation and Pathway Analysis
The identified proteins were classified into several biological pro-cesses and molecular functions of interest When all identifiedproteins from both genotypes were combined the categories con-taining themost upregulated proteins were those associated with
ldquometabolic processrdquo ldquoprotein metabolic processrdquo ldquotransportrdquoand ldquotransmembrane transporter activityrdquo (Figure 2) The firsttwo of these categories were highly enriched in terms of proteinnumbers among the proteins upregulated in the salt-treated Oa-VR compared with the salt-treatedOa-D (Fisher exact test p-valuelt10minus5) the ldquotransmembrane transporter activityrdquo category wasenriched among the proteins upregulated in the salt-treatedOa-Daccession (Figure S3 and Table S3 Supporting Information) Thetransport category was represented by nine subcategories andlog-fold changes were calculated for both genotypes (Figure 3)Several transport categories including ldquotransporter activityrdquo andldquotransmembrane transporter activityrdquo had increased numbers ofproteins when Oa-D plants were salt treated (Table S2 Support-ing Information) consistent with the relative enrichment of pro-teins as a proportion of the numbers of proteins identified witheach of these categoriesThe KEGG pathway mapper was used to assign the identified
proteins to pathways Of the 363 hits for transport proteinsquantified oxidative phosphorylation and SNARE interactionsin vacuolar transport were the pathways with the most proteinsaffected by salt treatment as well as being highly enrichedrelative to other transport proteins in terms of protein numbers(Fisher exact test p-value lt10minus10) Under salt treatment sevenkey subunits (of a total of 12) of vacuolar-type H+-ATPase weredifferentially expressed in the tolerant genotype Additionally
Figure 2 Qualitative comparison of differentially expressed proteins of Oa-VR and Oa-D showing total numbers of up- and downregulated proteinsunder salt and control treatments Up- and downregulated proteins were categorized into several biological process and molecular function categoriesof interest Upregulated proteins are plotted to the right and downregulated proteins are plotted to the left of the central y-axis Values in bracketsrepresent the proportion of each group out of the entire set of proteins
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (6 of 12)
213
wwwadvancedsciencenewscom wwwproteomics-journalcom
Figure 3 Boxplot representing the subset of transport-related Gene Ontology categories used to assess salt-response protein abundance across the twoaccessions Individual up- and downregulation (log fold changes) in the nine transport subgroups were determined for the salt-sensitive (white) andsalt-tolerant (grey) accessions ofO australiensis Fold change values were calculated as a ratio between the response to salt and the control plants Eachbox indicates the 25 and 75 percentiles the bold line across the box depicts the median and the dots represent the outlier proteins The significance ofdifferent values comparing each set of accessions under the same transporter group are denoted by asterisks (p lt005 p lt001 by Student t-test)
13 proteins were differentially expressed in the SNARE inter-actions in the vacuolar transport pathway Of these five andeight proteins were upregulated in Oa-VR and Oa-D respec-tively and six and three proteins were downregulated in Oa-VRand Oa-D respectively under salt treatment In addition totalprotein abundance for each category was summed for the tol-erant and sensitive accessions which revealed that the tolerantaccession had a higher abundance of proteins in the categoryldquometabolic processrdquo under salt treatment (Figure S3 SupportingInformation)
36 Validation of Os07g37320 and Os12g03860 Expression UsingRT-qPCR
A set of six genes derived from six DEPs were chosen for theinvestigation of the expression levels under salt stress for thetested accessions RT-qPCR results indicated that expression lev-els of four of the chosen genes were not consistent across bio-logical samples or that more than one melt curve was presentindicating multiple products being formed Hence out of thisset two genes were suitable for RT-qPCR assays and are dis-cussed here The relative expression of each gene of interest fol-lowing salt treatment was measured for both accessions usingRT-qPCR with calculations of amplification efficiency from se-rial dilutions of a reference gene and the gene of interest[34]
OsMST6 (Os07g37320) expression was upregulated by salt treat-ment in salt-tolerant Oa-VR (delta cycle threshold [ΔCt] = 649
and relative expression change = 64) and downregulated (ΔCt= minus506 with no relative expression change using the Pfafflet al equation[34]) in salt-sensitive Oa-D The expression ofOs12g03860 gene was upregulated under salt treatment in thesalt-tolerant Oa-VR ([ΔCt] = 763 and relative expression change= 146) and downregulated (ΔCt = minus346 with no relative expres-sion change) under salt conditions in the salt-sensitive accessionOa-D
37 Validating Effects of Key Salt-Tolerance Genes on GrowthPhenotype Using a Yeast Deletion Library
A yeast (S cerevisiae) deletion library was used to determinethe salt-response growth phenotype resulting from deletion ofspecific key salt-responsive proteins as identified in our riceexperiment[35] Protein sequences were BLASTed against theyeast genome to find homologous genes and correspondingstrains from the deletion yeast library[35] Eleven strains were cho-sen initially based on deletion of respective homologous genesand screened under YPD medium at 30 degC For three strains nogrowth of the colonies was observed while for six strains thesame growth rate was observed as found for the WT BY4742 un-der the chosen salt concentrations (Figure S4A and S4B Sup-porting Information) Two of the tested yeast deletion strainswere more susceptible to salt treatment compared with the WTBY4742 (Figure S4B Supporting Information) and were chosenfor additional screening
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (7 of 12)
214
wwwadvancedsciencenewscom wwwproteomics-journalcom
Figure 4 Colony growth of BY4742 yeast WT and the two deletion strainsYLR081W and YLR268W Cells at log phase were serially diluted tenfold(vertical array of four colonies in each panel) and spotted onto YPDmedium with three different NaCl concentrations and a ldquono-saltrdquo controlColonies were photographed after 3 days of growth at 30 degC YLR081W hasa deletion in a gene homologue to the riceOsMST6 gene and YLR268W toa V-SNARE gene
The first of these strains YLR081W had a deletion in therice homologue gene identified as UniProt A0A0D3GSD4 Thisgene was chosen because its rice homologue changed by 413-fold under the saltndashgenotype interaction comparison (Oa-VR saltvsOa-VR control)(Oa-D salt vsOa-D control) (Table S1 Support-ing Information) in the proteomics experiment This hit (UniProtA0A0D3GSD4) was identified in the O barthii database asan uncharacterized protein however using UniProtrsquos BLASTtool (httpswwwuniprotorgblast) it was annotated to themonosaccharide transporter gene OsMST6 The second yeaststrain YLR268 lacked a specific V-SNAREgene corresponding tothe rice homologue with the UniProt Q5N9F2 Proteomic datashowed that the rice homologue was differentially expressed inrice roots under mildly saline conditions and was identified aspart of the SNARE interaction complex in the vacuolar transportpathwayA second yeast screening was performed and showed that the
inhibition of growth wasmore pronounced for the YLR268 strainthan the YLR081W strain when compared with the WT controlstrain (Figure 4)
4 Discussion
41 Genome Relationships Between O australiensis and theMore Comprehensively Studied Oryza Species
This research aimed to reveal novel mechanisms of salt tolerancein rice by identifying proteins that enable a salt-tolerant O aus-traliensis accession (Oa-VR) to survive in up to 100 mM NaClwhile a second accession (Oa-D) suffers severe damage at theselevels[20] We posit that salt tolerance in Oa-VR resides largely inroot characteristics and is probably centred on ion exclusion asobserved for O sativa[37]
Oryza australiensis is the sole Oryza species with an EEgenome[38] which is substantially larger than the AA genomeof O sativa and the BB genome of O punctata[39] Dramaticstructural genomic changes in the lineage of O australiensis [38]
combined with stringent natural selection due to environmentalstresses make O australiensis a strong candidate for the discov-ery of novel stress tolerance mechanisms Annotations from thisstudy suggest that O australiensismay be more closely related toO punctata (BB genome) for which there were over 60 moreprotein hits than for the five sequenced Oryza species whichare all AA genome species This is consistent with a previousstudy that showed that the EE genome (O australiensis) is geneti-cally closer to the BB genome (O punctata) than the AA genome(such as O sativa and O meridionalis)[39] and underscores thestrategy of searching among wild germplasm for tolerancegenes
42 Role of Root Proteins in Salt Tolerance
Expression levels of orthologous genes compared across 22Oryza species contribute to salt tolerance[10] but we have nocomparable information on proteomic profiles when roots aresalinized Here proteins involved in energy metabolism wereheavily enriched by salt stress with large numbers of proteinscategorized functionally as relating to primary metabolism aspreviously reported[40]
External salt loads interrupt water absorption through osmoticimbalance and induce toxicity as ions accumulate[41] Thereforethe set of adaptive responses in salt-tolerant plants should ex-tend beyondmodified ion transport capacity (eg Na+ exclusion)to scavenge ROS synthesize osmolytes to minimize metabolicdamage and hydraulic changes in membrane propertiesMembrane proteins use energy to regulate cellular
H+ transport membrane potential and thereby Na+
compartmentation[42] and are especially critical in rice whichhas limited tissue tolerance to salt[7] Membrane proteins aretargeted to various cell compartments including the endomem-brane system plasma membranes interfacing the apoplast andvacuolar (tonoplast) membranes[43] In our experiment rootswere prepared after 30 days of salt treatment to ensure rootmembranes were in a steady state with respect to transportproteinsA core mechanism for tolerance to toxic ions such as Na+
is their compartmentation into vacuoles thereby reducing theirmetabolic impact[42] Generally membrane transport plays a cru-cial role in salinity tolerance across a huge range of nonhalophyte
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (8 of 12)
215
wwwadvancedsciencenewscom wwwproteomics-journalcom
species such as Arabidopsis[44] wheat[45] barley[46] rapeseed[47]
and maize[48] with transporters being critical to the exclusion ofNa+ in rice[4950] Building on our previous study[20] which con-trasted salt tolerance in several wild rice accessions we aimedto identify key proteins that respond differentially to 80 mMNaClSemipurified membrane-enriched (ldquomicrosomalrdquo) fractions
from whole roots were examined to facilitate the enrichment oftransport proteins while acknowledging apoplastic bypass as acontributor to salt sensitivity in rice Functional annotation re-vealed a large number of proteins not directly associated withmembrane transport as discussed below
43 Effectiveness of the Membrane-Enriched Purification
Estimating the purity of a microsomal extraction can be compli-cated since membrane proteomes are dynamic[51] and may varywithin the same organ according to development protein translo-cation and changes in the environment For example the roothomogenate that gave rise to our preparation contained amixtureof mature and developing tissues an unavoidable consequenceof the highly branched fine root system of riceMembrane-specific enzyme markers can be used to evalu-
ate the presence of different membrane fractions in extracts[22]
but cannot be used to quantify contributions arising from eachfraction Hence we evaluated the membrane-enriched fractionby parallel sequence searches against reference databases us-ing Mercator enabling extracted proteins to be given functionalannotations using GO terms This approach provided evidencethat membrane proteins were enriched with about 10 of theextracted proteins (363 unique proteins) categorized as partici-pating in transport In previous studies a microsomal-enrichedfraction from pea roots (Pisum sativum) yielded around 5transporters[52] and a highly purified Arabidopsis plasma mem-brane preparation fromgreen tissue (leaves and petioles) resultedin 17 transporters[53] In the only comparable report on ricemembranes 7 of total proteins extracted from roots were trans-port proteins[54]
To further assess the effectiveness of our microsomal en-richment we predicted the number of transmembrane he-lices in our extracted root proteins using the TMHMMtransmembrane (TM) platform (httpwwwcbsdtudkservicesTMHMM) About 40 of the proteins were found to have atleast one membrane-spanning region similar to the 35 foundfor a membrane-enriched extraction from Arabidopsis roots[55]
The microsomal study referred to above which focused on pearoots[52] reported only 20 of proteins with a transmembraneregionWe conclude that preparation of our microsomal fraction was
successful in terms of membrane protein enrichment
44 Protein Clusters that Respond Collectively to Salt
441 ATPases and Mitochondrial Proteins
Proteins associated with transport phenomena within oxidativephosphorylation were some of the most strongly enriched in
the root microsomal fractions Subunits of both V- and F-typeATPases which are highly related enzymes involved in energytransduction[56] were differentially expressed under salt stress insalt-tolerant and -sensitive accessions In the halophyte Mesem-bryanthemum crystallinum the activity of some ATPase subunitsdecreased while others increased in abundance under salinitystress[5657] Similarly our findings indicate complex regulation ofthe expression of ATPase subunits as a fundamental part of theresponse to salinityThe tolerant accession Oa-VR displayed a higher abundance
of ldquometabolism processrdquo proteins in response to salt than thesensitive genotype In Dunaliella a salt-tolerant green alga up-regulation of ldquometabolic processrdquo pathways was reported withsome of these proteins common to plants[58] Sodium in the ex-ternal soil solution imposes a substantial energy demand onplants for example plasma-membrane associated ATPase activ-ity increased five-fold in sorghum to ldquomanagerdquo growth in 40 mMNaCl[59] Sodium that enters root cells is ideally effluxed viaplasma membrane-associated Na+H+ antiporters which con-sumes substantial amounts of energy[60] Indeed it has beendemonstrated that approximately sevenmoles of ATP are neededto transport one mole of NaCl across a membrane[61]
442 SNARE Proteins
Membrane vesicle traffic is facilitated by the SNARE (solu-ble N-ethylmaleimide-sensitive factor attachment protein recep-tor) superfamily of proteins[62] which fuse vesicles with targetmembranes[63] SNAREs comprise proteins that are located onthe plasma membrane early and late endosome trans-Golgi net-work (TGN) and the endoplasmic reticulum (ER)Among the 363 proteins identified as transporters KEGG
pathway analysis identified 13 SNARE interaction proteins in thevacuolar transport pathway as the third most abundant pathwayto be affected by salt treatment The TGN regulates both secre-tory and vacuolar transport pathways and TGN SYP4 proteinsplay critical roles in salinity stress tolerance in plants by regu-lating vacuolar transport pathways[64] Here the syntaxin-relatedKNOLLE-like protein was significantly upregulated under saltconditions in the tolerant line Oa-VR and downregulated in Oa-D These KNOLLE-like proteins are generally involved in stress-related signaling pathways and play an important role in osmoticstress tolerance in Arabidopsis[63] tobacco [65] and wild soybeanGlycine soja[66] They participate in the compartmentalization ofions once they have entered a living cell our new evidence fromrice suggests that they play this role inmonocotyledonous speciesas well as in the dicotyledons listed aboveSyntaxin is a component of the SNARE complex located
at the target membrane it enables recognition and fusion ofthe desired vesicle with the transmembrane[62] Known saltstress-related proteins such as SOS1 might be candidates forthe cargos of the SNARE complex and could interact with a regu-latory subunit of a potassium channel to regulate gating and K+
influx[67]
A second SNARE component called syntaxin-121 which drivesvesicle fusion[68] was also significantly upregulated inOa-VR anddownregulated in Oa-D Syntaxin is a plasma membrane pro-tein reported in other biological systems such as yeast[69] Some
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (9 of 12)
216
wwwadvancedsciencenewscom wwwproteomics-journalcom
studies have shown that the syntaxin homologue PEN1SYP121in Arabidopsis mediates a resistance reaction to suppress activityof the powdery mildew fungus Blumeria graminis f sp hordei [70]
but a direct link with abiotic stress has not been made until thepresent study
45 Validation of Salt-Tolerance Genes Using RT-qPCR and aYeast Deletion Library
In general the majority of DEPs responded to salt to a simi-lar degree in both genotypes There were relatively few DEPsthat showed an interaction between genotype and salt One wasUniProt A0A0D3GSD4 (BLASTed to O sativa OsMST6) thatincreased 414-fold more in salt-treated Oa-VR than in salt-treatedOa-D (calculated using the formula [Oa-VR salt vsOa-VRcontrol][Oa-D salt vs Oa-D control])OsMST6 is a member of the MST family in O sativa and
known to mediate transport of a variety of monosaccharidesacross membranes[71] MSTs have been reported to confer hy-persensitivity to salt in rice[71] and Arabidopsis[72] There are afew techniques to validate protein expression such as RT-qPCRgene silencing knockdownsouts and homologous expression inother species In this study the expression of theMST gene in thetolerant versus sensitive accessions was further tested using RT-qPCR resulting in verification of the proteomics results Whilethis transcript was heavily upregulated in Oa-VR with salt stressit appears to be downregulated in the salt sensitive Oa-D underthe same treatmentTranscript-level expression analysis in a previous study showed
upregulation of OsMST6 expression under saline conditions inboth shoots and roots of rice seedlings[71] A role ofOsMST6 in en-vironmental stress responses and in establishing metabolic sinkstrength was established[71] In our study abundance of this pro-tein was significantly greater in the salt-tolerant accession andreduced in the salt-sensitive accession (saltndashgenotype interactionvalue 413)In addition to the expression levels of OsMST6 we tested the
yeast growth phenotypes of a yeast strain (YLR081W) with a sin-gle deletion in a gene that encodes amonosaccharide transportera homologue of OsMST6 from rice Yeast bioassays at threesalt concentrations revealed a growth inhibition for the dele-tion strain compared with the WT The differential abundanceof the MST protein and transcript from our RT-qPCR experi-ment coupled with the growth inhibition of the yeast deletionmutants under salt treatment implies that the protein productof OsMST6 plays an important role in salinity stress responsesinOa-VR as described in a simple model (Figure S5 SupportingInformation)Another DEP that showed an interaction between genotype and
salt was UniProt A0A0E0MJB0 The abundance of this proteinwas 28-fold higher in salt-treated Oa-VR than in salt-treatedOa-D (calculated using the same formula as given in section45) Using UniProtrsquos BLAST tool we identified this protein inO sativa (UniProt Q2QY48) as a major facilitator superfamilyantiporter encoded by the Os12g03860 gene To date manyantiporters were identified to confer salinity tolerance in variousplant such as Arabidopsis[73] rice[74] and other species[7576]
During salt treatment V-ATPase activity increased[77] to ensure
tonoplast energisation to drive Na+H+ antiport-mediated se-questration of Na+ in the vacuole[78] In our study utilizingRT-qPCR we verified this superfamily antiporter gene to behighly expressed under salt in Oa-VR while no relative changein expression was measured for salt-sensitive Oa-D corre-sponding with our quantitative proteomics results This genedeletion is lethal in yeast and thus could not be tested via aknockoutWhile our results clearly indicate upregulated expression for
both OsMST6 and the Os12g03860 gene in salt-tolerant Oa-VRthe calculations relative to the reference gene in salt-sensitiveOa-D did not indicate downregulation but rather ldquono changerdquo de-spite negative ΔCt results Calculations based on amplificationefficiencies (E values) in both the reference and target genes arehighly sensitive to small differences in E values thereby explain-ing this relative expression outputDespite the lethality of the gene deletion for the homologue
of Os12g03860 an additional nonlethal gene was tested throughyeast growth phenotypes as described for the YLR081W strainThe second yeast strain (YLR268W) susceptible to salt treatment(compared to WT) had a deletion in a V-SNARE gene Thisgene (Os01g0866300) encodes a vesicle-associated membraneprotein VAMP-like protein YKT62 (UniProt O sativa Q5N9F2corresponding to UniProt O punctata A0A0E0JRG1) Leshemet al[63] reported that suppression of expression of the VAMPprotein AtVAMP7 in Arabidopsis increased salt tolerance A ricestudy reported a contrasting result with reduced salinity tolerancewhen novel SNARE (NPSN) genes (OsNPSNs) were expressed inyeast cells[79] Another study reported that theOsSNAP32 SNAREgenewas found to be involved in the response to biotic and abioticstresses in various tissues including roots[80] To our knowledgeour study is the first to strongly link V-SNARE protein to stresstoleranceOverall our proteome profiling provided key pathways and
proteins that contribute to salt stress tolerance in anO australien-sis accession We found remarkable proteomic contrasts betweenthe accessions as well as between the salt-treated and controlplants These data coupled with our RT-qPCR and yeast pheno-typing results constitute substantial progress toward elucidationof the mechanisms underlying salinity tolerance within the Aus-tralian Oryza and may serve as the basis for improving salinitytolerance in rice and other important cropsThe mass spectrometry proteomics data have been deposited
to the ProteomeXchange Consortium via the PRIDE[81] partnerrepository with the dataset identifier PXD013701
Supporting InformationSupporting Information is available from the Wiley Online Library or fromthe author
AcknowledgmentsThe authors acknowledge Associate Professor Ben Crossett andDr AngelaConnolly from The Mass Spectrometry Core Facility at the University ofSydney for their valuable assistance with MS3 analysis YY acknowledgessupport from The University of Sydney in the form of the InternationalPostgraduate Research Scholarship
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (10 of 12)
217
wwwadvancedsciencenewscom wwwproteomics-journalcom
Conflict of InterestThe authors declare no conflict of interest
Keywordsmembrane proteins Oryza australiensis plant proteomics rice salttolerance
Received May 14 2019Revised August 5 2019
[1] J S Jeon K H Jung H B Kim J P Suh G S Khush J Plant Biol2011 54 1
[2] D Brar G Khush Wild Relatives of Rice A Valuable Genetic Resourcefor Genomics and Breeding Research Springer Cham 2018 1
[3] H Takagi M Tamiru A Abe K Yoshida A Uemura H Yaegashi TObara K Oikawa H Utsushi E Kanzaki C Mitsuoka S NatsumeS Kosugi H Kanzaki H Matsumura N Urasaki S Kamoun RTerauchi Nat Biotechnol 2015 33 445
[4] WWang B Vinocur A Altman Planta 2003 218 1 PMID14513379[5] L Zeng Plant Soil 2005 268 51[6] M J Thomson M de Ocampo J Egdane M A Rahman A G
Sajise D L Adorada E Tumimbang-Raiz E Blumwald Z I SerajR K Singh G B Gregorio A M Ismail Rice 2010 3 148
[7] A R Yeo M E Yeo S A Flowers T J Flowers Theor Appl Genet1990 79 377
[8] L Thi N Huyen L M Cuc L H Ham T D Khanh Am J BioSci2013 1 80
[9] D Zamir Nat Rev Genet 2001 2 983[10] M R Prusty S-R Kim R Vinarao F Entila J Egdane M G Q Diaz
K K Jena Front Plant Sci 2018 9 1[11] Q Zhu X Zheng J Luo B S Gaut S GeMol Biol Evol 2007 24
875[12] P A Kumar D A Bandhu Ecotoxicol Environ Saf 2005 60 324[13] R J Henry N Rice D L E Waters S Kasem R Ishikawa Y Hao S
Dillon D Crayn R Wing D Vaughan Rice 2010 3 235[14] B J Atwell H Wang A P Scafaro Plant Sci 2014 215-216 48[15] Z Ren J Gao L Li X Cai W Huang D Chao M Zhu Z Wang S
Luan H Lin Nat Genet 2005 37 1141[16] Q Wan S Hongbo X Zhaolong L Jia Z Dayong H Yihong Curr
Genomics 2017 18 553[17] P Achard H Cheng L De Grauwe J Decat H Schoutteten T
Moritz D Van Der Straeten J Peng N P Harberd Science 2006311 91 PMID16400150
[18] S Yan Z Tang W Su W Sun Proteomics 2005 5 235[19] M Nohzadeh H R Sahar H Mehran H Manzar G Salekdeh
Biosci Biotechnol Biochem 2007 71 2144[20] Y Yichie C Brien B Berger T H Roberts B J Atwell Rice 2018 11
66 PMID30578452[21] S Yoshida D A Forno J H Cock K A Gomez Laboratory Manual
for Physiological Studies of Rice IRRI Los Bantildeos Philippines 197661
[22] Y Cheng Y Qi Q Zhu X Chen N Wang X Zhao H Chen X CuiL Xu W Zhang Proteomics 2009 9 3100
[23] M J Aspinwall A Varingrhammar M Possell D T Tissue J E DrakeP B Reich O K Atkin P D Rymer S Dennison S C Van SluyterGlobal Change Biol 2019 25 1665
[24] X S Yue A B Hummon J Proteome Res 2013 12 4176[25] G Palmisano S E Lendal K Engholm-Keller R Leth-Larsen B L
Parker M R Larsen Nat Protoc 2010 5 1974
[26] D J C Pappin DM Creasy J S Cottrell D N Perkins Electrophore-sis 1999 20 3551 PMID10612281
[27] S Wu Z Zhu L Fu B Niu W Li BMC Genomics 2011 12 444PMID21899761
[28] M Mirzaei D Pascovici J X Wu J Chick Y Wu B Cooke M PMolloyMethods Mol Biol 2017 1549 45 PMID27975283
[29] T Zhang M Jiang L Chen B Niu Y Cai Biomed Res Int 2013 32401
[30] M Lohse A Nagel T Herter P May M Schroda R Zrenner T To-hge A R Fernie M Stitt B Usadel Plant Cell Environ 2014 371250
[31] D Pascovici T Keighley M Mirzaei P A Haynes B Cooke Pro-teomics 2012 12 406
[32] Y Wu M Mirzaei D Pascovici P A Haynes B J Atwell Proteomics2019 19 1800310
[33] P A Tobias N Christie S Naidoo D I Guest C Kuumllheim Tree Phys-iol 2017 37 565
[34] M W Pfaffl Nucleic Acids Res 2001 29 45e[35] G Giaever C Nislow Genetics 2014 197 451 PMID24939991[36] A Blomberg Yeast 1997 13 529 PMID9178504[37] S Roy U Chakraborty Protoplasma 2018 255 175 PMID28710664[38] B Piegu R Guyot N Picault A Roulin A Saniyal H Kim K Collura
D S Brar S Jackson R A Wing O Panaud Proteome Sci 2006 161262
[39] T Nishikawa D A Vaughan K Kadowaki Plant Genome 2005 110696
[40] M H Nam S Mi Huh K Mi Kim W J Park J B Seo K Cho D YKim B G Kim I S Yoon Proteome Sci 2012 10 25
[41] J K Zhu Trends Plant Sci 2001 6 66[42] E Blumwald Curr Opin Cell Biol 2000 12 431[43] H Shi F J Quintero J M Pardo J K Zhu Plant Cell 2002 14 465[44] F E Tracy M Gilliham A N Dodd A A R Webb M Tester Plant
Cell Environ 2008 31 1063[45] C S Byrt J D Platten W Spielmeyer R A James E S Lagudah E
S Dennis M Tester R Munns E S Dennis M Tester R Munns CS Byrt J D Platten W Spielmeyer R A James E S Lagudah PlantPhysiol 2007 143 1918
[46] L H Wegner K Raschke Plant Physiol 1994 105 799[47] J Wang K Zuo W Wu J Song X Sun J Lin X Li K Tang DNA
Sequence 2003 14 351[48] S K Roberts M Tester J Exp Bot 2007 48 839[49] H Chen R An J H Tang X H Cui F S Hao J Chen X C Wang
Mol Breed 2007 19 215[50] Z -H Ren J -P Gao L Li X Cai W Huang D -Y Chao M Zhu Z
-Y Wang S Luan H Lin Nat Genet 2005 37 1141[51] F Masson M Rossignol Plant J 1995 8 77[52] C -N Meisrimler S Wienkoop S Luumlthje Proteomes 2017 5 8[53] E Alexandersson G Saalbach C Larsson P Kjellbom Plant Cell
Physiol 2004 45 1543[54] F Huang Z Zhang Y Zhang Z ZhangW Lin H Zhao J Proteomics
2017 158 20[55] T J Chiou Y C Tsai T K Huang Y R Chen C L Han C M Sun Y
S Chen W Y Lin S I Lin TY Liu Y J Chen J W Chen P M ChenPlant Cell 2013 25 4044
[56] A Y Mulkidjanian M Y Galperin K S Makarova Y I Wolf E VKoonin Biol Direct 2008 3 13
[57] R Low B Rockel M Kirsch R Ratajczak S Hortensteiner EMartinoia U Luttge T Rausch Plant Physiol 2002 110 259
[58] J Patterson P Kulkarni M Smith N Deller Plant Physiol 2004 1362806
[59] H W Koqro R Stelzer B Huchzermeyer Botanica Acta 1993 106110
[60] M Tester R Davenport Ann Bot 2003 91 503[61] J A Raven New Phytol 1985 101 25[62] Y A Chen R H Scheller H H Medical Nature 2001 2 98
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (11 of 12)
218
wwwadvancedsciencenewscom wwwproteomics-journalcom
[63] Y Leshem N Melamed-book O Cagnac G Ronen Y Nishri MSolomon G Cohen A Levine Proc Natl Acad Sci USA 2006 10318008
[64] T Uemura T Ueda A Nakano Plant Signaling Behav 2012 7 1118[65] B Leyman D Geelen M R Blatt Plant J 2000 24 369[66] X Sun W Ji X Ding Plant Cell Tissue Organ Cult 2013 113 199[67] S Sokolovski P Campanoni A Honsbein M Paneque Z Chen M
R Blatt R Pratelli I Johansson C Grefen Plant Cell 2009 21 2859[68] S R Pant P D Matsye B T McNeece K Sharma A Krishnavajhala
G W Lawrence V P Klink Plant Mol Biol 2014 85 107[69] M Edamatsu Y Y Toyoshima Biochem Biophys Res Commun 2003
301 641[70] V Lipka E Kombrink R Huumlckelhoven S Bau H Thordal-
Christensen P Schulze-Lefert N C Collins S C Somerville AFreialdenhoven J-L Qiu M Stein Nature 2003 425 973 PMID14586469
[71] Y Wang Y Xiao Y Zhang C Chai G Wei X Wei H Xu M WangP B F Ouwerkerk Z Zhu Planta 2008 228 525 PMID18506478
[72] S Reuscher M Akiyama T Yasuda H Makino K Aoki D ShibataK Shiratake Plant Cell Physiol 2014 55 1123
[73] H Shi M Ishitani K Cheolsoo Z Jian-Kang Proc Natl Acad SciUSA 2000 97 6896
[74] A Fukuda A Nakamura A Tagiri H Tanaka A Miyao H HirochikaY Tanaka Plant Cell Physiol 2004 45 146
[75] C Niemietz J Willenbrink Planta 1985 166 545 PMID24241621[76] C Ye H Zhang J Chen X Xia W Yin Physiol Plant 2009 137 166[77] Y Braun M Hassidim H R Lerner L Reinhold Plant Physiol 1986
81 1050[78] F J M Maathuis V Filatov P Herzyk G C Krijger K B Axelsen S
Chen B G Forde G Michael P A Rea L E Williams D SandersA Amtmann Plant J 2003 35 675
[79] Y M Bao J F Wang J Huang H S ZhangMol Biol Rep 2008 35145
[80] Y M Bao J F Wang J Huang H S Zhang Mol Genet Genomics2008 279 291
[81] Y Perez-Riverol A Csordas J Bai M Bernal-Llinares S Hewapathi-rana D J Kundu A Inuganti J Griss G Mayer M Eisenacher EPeacuterez J Uszkoreit J Pfeuffer T Sachsenberg S Yilmaz S Tiwary JCox E Audain M Walzer A F Jarnuczak T Ternent A Brazma JA Vizcaiacuteno Nucleic Acids Res 2019 47 D442
Proteomics 2019 19 1900175 copy 2019 WILEY-VCH Verlag GmbH amp Co KGaA Weinheim1900175 (12 of 12)
219
220
Appendix Table 2-1 Operating parameters as used for determination and analysis of the
inorganic ions from rice leaves
Appendix Table 2-2 summary of dead leaf percentage for each genotype and treatment
was calculated as the weight of dead leaf as a percentage of total leaf weight from the
main tiller
Linetreatment 0 mM 25 mM 50 mM 75 mM 120 mMIR29 0 8 63 93 100
Nipponbare 0 11 29 53 96Oa -VR 0 4 11 17 46Oa -CH 0 11 33 31 85Oa -D 0 45 56 65 94Oa -KR 0 8 48 54 92Om -HS 0 4 5 46 83Om -CY 0 14 72 95 100Oa -T3 0 30 35 69 81300183 0 5 21 45 94Pokalli 0 3 22 54 92
Parameter ValuePump speed (rpm) 15
Sample uptake delay (s) 15Stabilisation time (s) 15
Read time (s) 15Replicates 3
Rinse time (s) 30Sample pump tubing Orangegreen SolvaflexWaste pump tubing Blueblue Solvaflex
Background correction AutoGas source 4107 Nitrogen generator
221
Appendix Figure 2-1 Relationship between net photosynthesis rates of surviving green
leaf tissue and percent dead leaf of the main tiller A linear regression line y = minus102(x) +
182 with R2 = 04 correlation coefficient was found for all genotypes grown under all salt
treatments
0
5
10
15
20
25
30
0 02 04 06 08 1 12
Net
pho
tosy
nthe
tic ra
te
[μm
ol (C
O2)
m-2
s-1]
Dead Leaves []
222
Appendix Table 2-3 Phenotypic measurements of all tested accessions 4 and 29 d after applying the salt treatments (DAS) Different letters
indicate significant differences between means from the non-salinised treatment (0 mM NaCl) per accession based on Studentrsquos t test (Plt005) The
reduction values were calculated between DAS4 and 29 in each combination of salt treatment and accession
DAS4 DAS29 DAS4 DAS29 DAS4 DAS29Genotype Treatment Reduction Reduction Reduction
mM NaCl IR29 0 081 A 028 A 66 2325 A 915 A 61 2335 A 1629 A 3023
40 051 B 034 A 33 1673 B 1232 A 26 1467 B 941 B 358780 037 C 017 B 55 1285 C 653 B 49 1582 B 134 B 1527
Oa -VR 0 074 A 043 A 41 1424 A 1239 A 13 2467 A 2364 A 41340 052 AB 013 B 76 904 B 493 B 45 1939 AB 1013 B 477680 032 B 013 B 59 89 B 499 B 44 1475 B 974 B 3394
Oa -CH 0 065 A 031 A 53 1721 A 91 A 47 2796 A 1817 A 350040 034 B 011 B 68 1117 B 44 B 61 1839 B 797 B 566580 031 B 013 B 56 1005 B 515 B 49 1687 B 207 C 8774
Oa -D 0 069 A 032 A 53 1924 A 1003 A 48 2172 A 172 A 208140 034 B 018 B 49 117 B 646 B 45 1794 A 1423 A 206580 035 B 011 B 70 1205 B 419 B 65 1625 A 983 A 3951
Oa -KR 0 062 A 031 A 50 1656 A 975 A 41 2908 A 1803 A 380140 041 B 018 B 57 138 B 683 B 50 1999 B 1195 A 402180 035 B 017 B 52 117 C 645 B 45 144 C 24 B 8333
Pokkali 0 046 A 021 54 1396 A 757 46 2474 A 1491 A 397040 021 B 017 23 84 B 656 22 1419 B 1298 AB 85280 035 B 019 47 12 B 716 40 1523 B 1087 B 2862
Stomatal Conductance Transpiration Rate mol m-2 s-1 mmol (H2O) m-2 s-1
Net Photosynthetic Rateμmol (CO2) m-2 s-1
223
Appendix Figure 2-2 Linear regressions of salinity-induced injury against ion accumulation (Na+ in red K+ in blue) in rice leaves The visual SES
injury scores were correlated with (a) leaf Na+ concentrations [μmol Na+ g-1 (SDW)] (R2 = 033) and (b) leaf K+ concentrations [μmol K+ g-1 (SDW)] (R2 =
025) Leaf rolling scores were correlated against (c) leaf Na+ concentrations (R2 = 033) and (d) leaf K+ concentrations (R2 = 026)
224
Appendix Figure 4-1 Standard calibration curve for the BCA assay showing absorbances plotted against the BSA standard concentrations
y = 0001439x + 0085718Rsup2 = 0994227
0
01
02
03
04
05
06
07
08
0 100 200 300 400 500
OD 5
62
Protein concentration ugmL
225
Appendix Figure 4-2 Mass spectrometry spectra example (a) BSA calibration of the Thermo Scientific Orbitrap Fusion Tribridtrade Mass Spectrometer
(Thermo Scientific CA USA) (b) Averaged mass spectra of the peptide YICDNQDTISSK (mz 72232 M2H2+) as identified from extracted ion
chromatograms in the LC-MS analysis of a tryptic BSA digest was picked randomly to assess the quality and sensitivity of the machine before loading the
experimental samples
a
b
226
Appendix Figure 4-3 Gradient profile of a test sample (rice root microsomal test sample extraction) for retention times of 9 (red) 60 (blue) and
90 (pink) min One microgram of sample was injected for the blue and the pink gradients while 01 microg was used for the red gradient
Appendix Figure 4-4 Example of a mass spectrum showing the signals obtained for the first TMT set (fraction 1 of Oa-VR) The image shows the
product ion scan spectrum of the 4-foldndashcharged ion signal after collision-induced dissociation Resulting product ions were assigned to the amino acid
sequence respective to the mass-to-charge ratio
227
Appendix Figure 4-5 Protein patterns for the most abundant proteins (label above each
plot represents the protein accession name) from the Oryza database
228
Appendix Figure 4-6 Protein patterns for the most abundant proteins (label above each
plot represents the protein accession name) from the Salt-tolerant species database
229
Appendix Figure 4-7 Protein patterns for the most abundant proteins (label above each
plot represents the protein accession name) from the Grasses database