Rotavirus particles in the extrahepatic bile duct in experimental biliary atresia

ROTAVIRUS PARTICLES IN THE EXTRAHEPATIC BILE DUCT IN

EXPERIMENTAL BILIARY ATRESIA

Christina Oetzmann von Sochaczewski1, Isabel Pintelon2, Inge Brouns2, Anika Dreier1,

Christian Klemann1, Jean-Pierre Timmermans2, Claus Petersen1 and Jochen Friedrich

Kuebler1

1 Department of Pediatric Surgery, University Hospital of Hannover, Hannover, Germany

2 Laboratory of Cell Biology & Histology, Department of Veterinary Sciences, University of

Antwerp, Antwerp, Belgium

Corresponding author:

Christina Oetzmann von Sochaczewski

Address: Department of General Surgery, Dr. Horst Schmidt Klinik,

Wiesbaden, Germany

E-mail: [email protected]

Phone: +49 176 61124081

Abstract:

Background

Biliary atresia (BA) is a fatal disease of the hepatobiliary system and is the most

common indication for liver transplantations in childhood. The experimental model of

BA, induced by rotaviral infection in neonatal mice, has been widely used to

investigate the inflammatory aspects of this disease. We investigated the kinetics

and the localization of the viral infection in this model.

Methods

In this study 399 animals were employed for a detailed investigation of rhesus rota

virus (RRV)-induced BA development. RRV kinetics was analyzed by rtPCR and its

(sub) cellular localization was investigated using whole mounts which were further

processed for confocal and electron microscopy.

Results

The BA mouse model resulted in up to 100% induction of atresia following RRV

injection. The kinetics of RRV infection differed between liver and extrahepatic bile

ducts. While the virus peak was similar in both organs up to day 10 post-infection

was similar in both organs, the virus remained detectable in extrahepatic bile duct

cells up to day 21. Interestingly, RRV particles could not only be localized in

cholangiocytes but also in cells of the subepithelial layers, potentially macrophages.

Conclusions

RRV remains present in the extra hepatic bile duct cells after an initial virus peak.

Viral particles were detected in subepithelial cells in contrast to the described tropism

towards cholangiocytes.

Key words:

Biliary atresia, mouse model, rotavirus, obstruction, liver, extrahepatic bile duct.

Introduction:

Biliary atresia (BA) is the most common cause of chronic progressive liver disease in

childhood and is the leading indication for pediatric liver transplantation worldwide.

The etiologic cause of BA remains unknown, but one leading hypothesis proposes a

virus as the triggering event leading to BA (1, for a review see 2). In BA patients,

several viral strains have been detected in liver or blood samples (3, 4), however,

simultaneous screening of BA patients for all common hepatotropic viruses, yielded

positive results for only 30-55% of the patients undergoing the Kasai procedure (5, 6,

7). Experimental BA is induced by postpartal intraperitoneal infection of BALB/c mice

with rhesus rotavirus (RRV) (8, 9). RRV is widely prevalent in the population as the

most common cause for diarrhea in infants and children and has been one of the

viruses identified in livers of patients with BA (7, 10, 11). In this experimental model,

the virus is cleared in the livers, prior to the development of the full clinical picture of

BA, but triggers an inflammatory reaction that causes the fibrosing destruction of the

extrahepatic bile ducts (8, 9, 12, 13). Most studies describing experimental and

clinical BA have focused on liver tissues. However, we hypothesized, that there are

differences in the virus kinetics between liver and extrahepatic biliary tissue.

Therefore we assessed the dynamics of the viral load in both tissues and used

electron microscopy to localize the viral particles in the extrahepatic bile ducts of

affected animals. However, most of the experimental BA studies have focused on

liver tissues where RRV replicates predominantly in the cholangiocytes. Thus, we

hypothesized, that there might be differences in the virus kinetics between liver and

extrahepatic biliary tissue. To further understand the interaction of viral infection and

tissue remodeling, we localized the viral infection and simultaneously documented

the progressive histological changes in the extrahepatic bile ducts in this model.

Methods:

Biliary Atresia Animal Model

In total, 399 newborn BALB/c mice were divided into two groups and injected within

the first 24 h post partum. The control group (n=102) was injected with 50 µl saline.

297 animals were infected intraperitoneally with 50 µl containing 2.5 x 106 pfu RRV

(14). Animals dying within 72 h due to the injection were excluded as described in the

results section. Animals were scored every other day for weight, cholestasis and fur-

covered skin up to day 21 post-infection. BA was scored at the time point of

preparation of liver and extrahepatic bile ducts.

The extrahepatic bile duct samples were used either for whole mount preparation

(infected n=95, control n=80) and immunohistochemistry imaged by means of

confocal microscopy, rtPCR (infected n=96, control n=0) or electron microscopic

analysis (infected n=19, control n=4). Animals used in a second study (will be

published elsewhere) were included in the numbers for whole mount samples and

analyzed here only for clinical symptoms. A minimum of four animals were sacrificed

daily for whole mount analysis from day 1 to day 10 and additionally on day 12 and

day 14 post-infection. A group of eight animals was analyzed by rtPCR at various

time points. Samples were collected daily around the expected peak of infection and

less frequently at early and late time points (for time points see Figure 3).

Extrahepatic bile ducts were sampled for electron microscopy at days 1, 2, 3, 5, 8,

10, 12, 14 post-infection.

All experiments of this study were approved by the government and performed

according to the national regulations for the protection of animal models (registration

number 11-0360).

Virus Production

RRV strain MMU 18006 was grown in MA-104 African green monkey kidney cells

and assayed for concentration by infectious plaque assay as previously described (8,

9).

Whole Mount of Bile Ducts

Bile duct whole mounts were immersion-fixed 30 min after isolation with 4%

paraformaldehyde (in 0.1 M phosphate buffer; pH 7.4). Immunohistochemical

incubations were carried out at room temperature on free-floating bile ducts. All

primary and secondary antisera were diluted in phosphate-buffered saline (PBS; 0.01

M; pH 7.4) containing 10% normal horse serum, 0.1% bovine serum albumin, 0.05%

thimerosal, 0.01% NaN3 1% and Triton-X-100. Prior to incubation with the primary

antisera, whole mounts were incubated for 1 h with the antibody diluent. Whole

mounts were incubated overnight with a monoclonal primary antibody raised in rat

against the endothelial marker CD31 (1:50; Abcam ab56299, Cambridge, UK). To

visualise immunoreactivity for CD31, whole mounts were further incubated for 4 h

with Cy3-conjugated donkey anti-rat immunoglobulins (DARa-Cy3; 1:200; Jackson

ImmunoResearch, 712-165-150, West Grove, PA, USA). Whole mounts were then

incubated for a consecutive night with a second primary antibody against RRV

(1/2000; Sh Pc; Abcam ab35417) followed by a 4 h secondary incubation with FITC-

conjugated donkey anti-sheep immunoglobulins (DASh-FITC; 1:200; Jackson

ImmunoResearch, 713-095-003).

High-resolution images were obtained using a microlens-enhanced dual spinning

disk confocal microscope (UltraVIEW VoX; PerkinElmer, Seer Green, UK) equipped

with 488 nm and 561 nm diode lasers for excitation of FITC and Cy3, respectively.

Images were processed and analyzed using Volocity software.

Transmission Electron Microscopy

Bile ducts were immersion-fixed after isolation in 2.5% glutaraldehyde solution for 30

min, rinsed in 0.1 M sodium cacodylate-buffered (pH 7.4) and post-fixed in 1% OsO4

solution for 2 h. After dehydration in an ethanol gradient (70% ethanol for 20 min,

96% ethanol during 20 min, 100% ethanol for 2 × 20 min), whole mounts were

embedded in EMbed 812 (Electron Microscopy Sciences, Hatfield, PA, USA).

Ultrathin sections were stained with 2% uranyl acetate and lead citrate, and

examined in a Tecnai G2 Spirit Bio Twin Microscope (FEI, Eindhoven, The

Netherlands) at 120 kV.

Quantitative RT-PCR

Liver and bile duct were sampled independently of each experimental animal. RNA

was isolated using the RNeasy Mini Kit (Qiagen) according to the manufacturer's

instructions. 1 µg RNA was transcribed to cDNA with the RNA-to-cDNA Kit (Applied

Biosystems). qPCR was performed in technical triplicates on a Step One Plus cycler

(Applied Biosystems) using the Maxima Sybr Green / Rox qPCR mastermix

(Fermentas) according to standard protocol. The primers

CACCAGCGGTAGCGGCGTTAT and TTGCTTGCGTCGGCAAGTACTGA were

employed to detect RRV and the signal was normalized against GAPDH in a second

reaction with the primer pair CCCCAGCAAGGACACTGAGCAAG and

TGGTATTCAAGAGAGTAGGGAGGGC. Relative RNA levels were quantified using

the StepOne Software Version 2.0 (Applied Biosystems) and Excel 2007 (Microsoft).

Results:

Biliary Atresia Model

Mice (n=297) were infected with 2.5 x 106 pfu RRV within 24 hours of life to induce

BA.

Lethality

Perinatal mortality - defined as death within the first three days post infection -

resulted in the loss of 28 animals (9.4%). After day 3, nine infected animals (3.0%)

died with a majority of seven animals deceased from day 15 to 17. In the placebo

injected control group (n=102) nine animals (8.8%) died due to perinatal mortality

while no animals were lost after day 3 post-infection.

Clinical Symptoms

Infected individuals showed a delayed weight development compared to healthy

controls, although results were not significant in this study (Figure 1a). Three animals

(1.0%) cleared the infection as documented by a weight gain and loss of clinical

symptoms. The majority of the infected mice developed cholestasis starting from day

3 to day 6 post-infection complemented by an oily fur starting from day 8 to day 11

(Figure 1b).

Development and Incidence of BA

Microscopic and histological evaluation of bile ducts of infected animals showed the

first complete atresia on day 8 (day 8: 1/9). Throughout the following days evidence

of BA increased significantly (day 9: 5/10, day 10: 6/10, day 12: 10/14). All infected

animals sacrificed after day 14 showed BA (day 14: 44/44, day 17: 8/8, day 21: 8/8;

Figure 1c). A subset of the dissected bile ducts was prepared for electron microcopy

to evaluate morphological modifications during disease development. As the disease

progresses in infected animals, the lumen of the extrahepatic bile duct decreases. At

day 14 cholangiocytes are ultimately lost when the bile duct becomes completely

obstructed (data not shown).

The wall of the extrahepatic bile duct of uninfected animals consisted of

cholangiocytes (the innermost layer), subepithelial structures of connective tissue,

myofibroblasts, smooth muscle cells and blood vessels and the outermost

mesothelial layer of the serosa (Figure 2b). As the disease progresses in infected

animals, the lumen of the extrahepatic bile duct decreases and the bile duct becomes

completely obstructed at day 14 (Figure 2e, f). Healthy cholangiocytes are well

connected and form a dense, columnar shaped epithelium (Figure 2d). In infected

individuals, the cholangiocytes are ultimately lost at day 14, when the lumen is

completely obstructed (Figure 2a, c, e). Specific tissue layers can no longer be

distinguished, necrotic cells are present and inflammatory cells as well as immune

cells migrate through the remaining fibrotic bile duct remnant (Figure 2f).

Localization and Kinetics of RRV

An overview picture of RRV spread was obtained by double staining a second subset

of the dissected bile duct whole mounts for viral protein 6 (VP6, green) and the

endothelial marker CD31 and subsequently making 3D reconstructions of stacks of

confocal images. Only scattered cells were infected on day 2 post-infection (Figure

2a). The peak of infected cells was observed around day 5 (Figure 2b), while the

number of infected cells was reduced at day 7 (Figure 2c). The onset and kinetics of

virus replication was similar in liver and bile ducts up to day 7, suggesting a

synchronous infection of both organs (Figure 3). Interestingly, RRV was cleared from

liver cells from day 11 on (Figure 3b), while it replicated in the bile duct at high levels

up to day 10 and remained detectable at 10-30 times lower levels until day 21 (Figure

3a).

The wall of the extrahepatic bile duct of uninfected animals consisted of

cholangiocytes (the innermost layer), subepithelial structures of connective tissue,

myofibroblasts, smooth muscle cells and blood vessels and the outermost

mesothelial layer of the serosa (Figure 4a). Electron microscopical analysis

demonstrated virus particles in cholangiocytes on day 5 (data not shown).

Interestingly, groups of RRV particles could be observed in several cells in the

subepithelial layers as identified by location (Figure 4a-d, 6c).

Although identification of the exact cell type is difficult based only on electron

microscopy without immune labeling, the protrusions observed in these cells would

indicate that these cells have the ability to migrate (Figure 5). Possible cell types

could include macrophages, myofibroblasts or stellate cells.

Discussion:

We closely documented the progressive development of experimental BA after its

induction by perinatal infection of BALB/c mice with rhesus rotavirus. In the first

days, no clinical or histological changes were observed, apart from a few animals

that died likely due to the stress and/or traumatic impact of infecting procedure. This

early lethality was not directly related to the virus infection, as it was similar in the

placebo control group (9.4% vs. 8.8%, respectively). The first sign of BA was

jaundice, which mice developed in the second half of the first week of life.

Throughout this period, histological sections of the bile duct revealed increasing

stenosis of the lumen of the extrahepatic bile ducts, which, however, remained open,

suggesting that the jaundice was caused by hepatic affection rather than by changes

of the extrahepatic biliary system. BA developed in the second week, with the

earliest atretic animal detected on day 8 up to day 14, at which time all dissected

animals showed a complete obstruction of the extrahepatic bile duct (Figure 1).

It is not clear how exactly the fibrosing stenosis in the extrahepatic bile ducts is

triggered in this model. Several authors, who investigated viral and inflammatory

factors in the pathogenesis of BA, predominantly worked with liver tissue samples

which are easily available in the murine experimental model as well as in human

patients (11, 15). However, less data are available on the changes in the

extrahepatic biliary tissue. To investigate the pathogenesis of the bile duct

destruction in experimental BA, we focused on the kinetics of the RRV infection

which we correlated to the different stages of the disease. The amount of viral RNA

increased during the first days in both liver and bile duct tissue in a similar fashion.

However, the viral infection peaked prior to the clinical development of BA at the end

of the first week, as seen in both liver and bile duct tissue. Thereafter, the hepatic

virus load declined and no viral RNA could be detected anymore by rtPCR in the liver

after day 12. These observations are in accordance with those of a number of

published studies, in which the peak of replication in both tissues was reported at day

5 to day 8 (12, 13). Although the overall kinetics were similar in liver and bile duct

tissues up to day 10, reduced amounts of viral RNA persisted in the extrahepatic

biliary system throughout the observation period. These findings This finding could

suggest be suggestive of differences in the kinetics of RRV infection between the

extrahepatic bile duct and the liver.

Both whole mount immunohistochemistry and electron microscopy were used to

localize the virus infection at a (sub)cellular level. Using double staining for CD31

and virus antigen VP6, we observed a virus cluster localized in the lumen of the

extrahepatic bile duct, with some spots of viral antigen localized in the wall structure.

It is well known that RRV has a tropism for cholangiocytes and infection of

cholangiocytes has been postulated as an initial step in the inflammatory reaction in

experimental BA (12, 13, 16). These findings are further supported by our

observation of viral particle clusters within the cholangiocytes at day 5 and 8.

Interestingly, viral particles were also detected in several cells in the subepithelial

layers, in addition to the epithelial layer (Figures 4, 6). The nature of these cells

remains to be identified, but the protrusions observed hint at migrating cells, such as

macrophages, myofibroblasts or stellate cells. Macrophages appear to be a likely

candidate based on a number of reports of macrophage involvement in BA:

Macrophages were shown to be susceptible to infection by RRV in tissue culture (17)

and are known to play an important role in the inflammatory reaction in livers of mice

subjected to experimental BA (18). Furthermore, the appearance of the subepithelial

virus-loaded cells correlates with the development of stenosis and atresia in the

mouse model, suggesting that these cells could play an important role in the

destruction of the extrahepatic bile duct. The exact nature of these cells remains to

be identified, but the protrusions observed suggest that these cells are migrating

cells, most likely macrophages. It is long known, that there is a proliferation of CD68

positive macrophages in the livers of BA patients (17) and the expression of

macrophage-associated antigens has been correlated to a poor outcome (18).

Moreover, immunohistochemical analysis of tissue excidates of the bile duct wall at

the porta hepatis showed a high number of macrophages, but an absence of

lymphocyte infiltration (19). Although this data is in contrast to the findings of strong

influx of t cells in the livers of mice during experimental BA, some studies have

suggested that also in experimental BA, macrophages may play an important role:

Macrophages were shown to be susceptible to infection by RRV in tissue culture (20)

and have been described to support the inflammatory reaction in livers of mice

subjected to experimental BA (21). The appearance of these subepithelial virus-laden

cells correlated with the development of stenosis and atresia of the extrahepatic bile

ducts in our model, suggesting that these cells could indeed contribute to the

destruction of the extrahepatic bile duct. Based on the well known tropism of

rotavirus to cholangiocytes, cholangiocytes have been in the focus of the research

regarding the initiation of the inflammatory response in BA, with in vivo and in vitro

studies (22, 23, 24). Our results suggest that also macrophages might be an

interesting candidate and further studies should explore the possibilities of altering

macrophage functions in order to alleviate the course of experimental BA.

Despite a number of limitations, such as the inability of the conventional electron

microscopy microscopical tool to detect the virus in every state of its cycle, our study

provides a detailed description of the different stages of development of experimental

BA that might be instrumental in furthering our knowledge of this challenging disease.

We showed clearly demonstrated in this study that, following a comparable virus

peak in liver and extrahepatic bile ducts, the virus is cleared from the liver while it

remains detectable in the extrahepatic bile ducts, supporting our hypothesis of

differences in the virus kinetics in hepatic and biliary tissues. Detection of viral

particles in subepithelial cells was not reported up to date and is in contrast to the

observed tropism towards cholangiocytes. These findings could help to better

understand the primary affection of the extrahepatic biliary system and to better

understand the pathogenesis of BA.

Figures

Figure 1

Development of RRV-induced biliary atresia in mice during the first 21 days post

infection. (A) RRV infected animals show reduced weight gain. (B) Most infected

animals show cholestasis from day 5 on followed by an oily fur around day 10. (C)

The majority of all animals developed BA between day 12 and day 14. The high

incidence observed at days 9 and 10 may be overrepresented due to a the small

group size.

Figure 2

Electron microscopic pictures of the common bile duct. Age of mice is given at time of

scarification; scale bar indicates 10 µm. Samples were collected from control animals

(B, D) or RRV-infected animals (A, C, E, F). Overview picture of healthy animal

shows the lumen (L), epithelium and underlying tissue layers composed of

myofibroblasts, smooth muscle cells and blood vessels at day 7 (B). The lumen is

lined with a high columnar epithelium in untreated animals at day 7 (D). In infected

animals, the obstruction of the lumen becomes obvious on day 5 post RRV infection

(A). Infiltration of inflammatory cells is indicated by black arrows. Lumen obstruction

is further increased on day 8 (C). Fulminate inflammation showing the ultrastructural

impact of BA 14 days post infection (E). Complete lumen obstruction is obvious as

indicated by a complete loss of epithelial cells as well as the absence of the actual

lumen that is filled instead with dense fibrous connective tissue with complete

disruption in the middle section of the bile duct. Box indicates the location of

magnified image (F).

Figure 2

Whole mount preparation of extrahepatic bile duct stained for the endothelial marker

CD31 (red) and RRV vp6 antigen (green). (A) Early time point (day 2 post infection)

shows isolated virus particles. (B) Middle time point during disease development (day

5 post infection) indicates that the virus is present in high numbers throughout the

tissue but then starts to reduce (day 7 post infection) (C).

Figure 3

Kinetics of RRV infection evaluated by quantitative PCR of RRV gene VP6 relative to

GAPDH expression. Numbers of positive (product detectable in PCR) and negative

tested animals (copy numbers below detection limit) are given on top of each chart.

Each data point reflects the average of virus presence in positive animals quantified

in bile duct (A) and liver (B). Error bars indicate standard error.

Figure 4

Ultrathin sections of extrahepatic bile duct at day 8 using transmission electron

microscopy. Black arrows point at RRV particles. (A) Overview picture showing a

section of the bile duct with an increasingly obstructed lumen (L) in the center. The

lumen is surrounded by cholangiocytes. The cell marked by a black box was selected

for higher amplification in (B), (C) and (D). (D) Groups of viral particles possibly

forming a viroplasm are visible within the cell.

Figure 6

(A) RRV-infected extrahepatic bile duct at day 5 with a reduced lumen (L). Boxes

indicate the location of regions selected for higher amplification. (B) Infected

cholangiocyte revealing a group of viral particles in the cytoplasm. Black arrows point

at RRV particles. (C) Virus infection is also detectable in a subepithelial cell with a

high virus load.

Figure 5

Subepithelial cell 5 days post RRV infection. The black arrow points Black arrows

point at RRV particles. Cell protrusions are indicated by black triangles.

REFERENCES

1. Landing BH: Considerations of the pathogenesis of neonatal hepatitis,

biliary and choledochal cyst - the concept of infantile obstructive

cholangiopathy. Prog Pediatr Surg 1974;6:113-39.

2. Hertel P, Estes M 2012: Rotavirus and biliary atresia: can causation be

proven? Gastroenterology 2012;28:10-17.

3. Morecki R, Glaser JH, Cho S, et al: Biliary atresia and reovirus type 3

infection. N Engl J Med 1982;307:481-4.

4. Richardson SC, Bishop RF, Smith AL: Reovirus serotype 3 infection in

infants with extrahepatic biliary atresia or neonatal hepatitis. Gastroenterol

Hepatol 1994;9:264-268.

5. Schukfeh N, Al-Gamrah A, Petersen C, et al: Detection of hepatotropic

viruses has no impact on the prognosis after Kasai procedure. J Pediatr Surg

2012;47:1828-1832.

6. Rauschenfells S, Krassmann M, Al-Masri AN, et al: Incidence of

hepatotropic viruses in biliary atresia. Eur J Pediatr 2009;168:469-76.

7. Tyler KL, Sokol RJ, Oberhaus SM, et al: Detection of reovirus RNA in

hepatobiliary tissues from patients with extrahepatic biliary atresia and

choledochal cysts. Hepatology 1998;27:1475-1482.

8. Petersen C, Biermanns D, Kuske M, et al: New aspects in a murine model

for extrahepatic biliary atresia. J Pediatr Surg 1997;32:1190-1195.

9. Riepenhoff-Talty M, Schaekel K, Clark HF, et al: Group A rotavirus produce

extrahepatic biliary obstruction in orally inoculated newborn mice. Pediatr Res

1993;33:393-94.

10. Ramig RF: Pathogenesis of intestinal and systemic rotavirus infection. J

Virol 2004;78:10213-10220.

11. Riepenhoff-Talty M, Gouvea V, Evans MJ, et al: Detection of group C

rotavirus in infants with extrahepatic biliary atresia. J. Infect. Dis. 1996;174:8-

15.

12. Feng N, Kim B, Fenaux M, et al: Role of interferon in homologous and

heterologous rotavirus infection in the intestines and extraintestinal organs of

suckling mice. J Virol 2008;82:7578-7590.

13. Shivakumar P, Campbell KM, Sabla GE, et al: Obstruction of extrahepatic

bile ducts by lymphocytes is regulatet by IFN gamma in experimental biliary

atresia. J Clin Invest 2004;114:322-329.

14. Czech-Schmidt G, Verhagen W, Szavay P, et al: Immunological gap in the

infectious animal model for biliary atresia. J Surg Res 2001;101:62-67.

15. Allen SR, Jafri M, Donelly B, et al: Effect of rotavirus strain on the murine

model of biliary atresia. J Virol 2007;81:1671-1679.

16. Feng N, Sen A, Wolf M, et al: Roles of VP4 and NSP1 in determining the

distinctive replication capacities of simian rotavirus rrv and bovine rotavirus uk

in the mouse biliary tract. J Virol 2011;85:2686-2694.

17. Tracy TF, Jr, Dillon P, Fox ES, et al: The inflammatory response in

pediatric biliary disease: macrophage phenotype and distribution. J. Pediatr.

Surg. 1996;31:121-125.

18. Kobayashi H, Puri P, O'Brian DS, et al: Hepatic overexpression of MHC

class II antigens and macrophage-associated antigens (CD68) in patients with

biliary atresia of poor prognosis. J. Pediatr. Surg. 1997;32:590–593.

19. Schweizer P, Petersen M, Jeszberger N, et al: Immunohistochemical and

molecular biological investigations regarding the pathogenesis of extrahepatic

biliary atresia. (Part 1: immunohistochemical studies). Eur J Pediatr Surg.

2003;13:7-15.

20. Mohanty S, Ivantes C, Mourya R, et al: Macrophages are targeted by

rotavirus in experimentalbiliary atresia and induce neutrophil chemotaxis via

Mip2/Cxcl2. Pediatr Res 2010;67:345-35.

21. Mack CL, Tucker RM, Sokol RJ, et al: Armed CD4+ Th1 effector cells and

activated macrophages participate in bile duct injury in murine biliary atresia.

Clin Immunol 2005;115:200-2009.

22. Barnes BH, Tucker RM, Wehrmann F, et al: Cholangiocytes as immune

modulators in rotavirus-induced murine biliary atresia. Liver Int. 2009;29:1253-

61.

23. Coots A, Donnelly B, Mohanty SK, et al: Rotavirus infection of human

cholangiocytes parallels the murine model of biliary atresia. J Surg Res.

2012;177:275-81.

24. Mohanty SK, Donnelly B, Bondoc A, et al: Rotavirus replication in the

cholangiocyte mediates the temporal dependence of murine biliary atresia.

PLoS One. 2013;8:e69069.